Hemodynamic effects of urotensin II and its specific receptor antagonist palosuran in cirrhotic rats

Authors


  • Potential conflict of interest: Nothing to report.

Abstract

In cirrhosis, splanchnic vasodilation contributes to portal hypertension, subsequent renal sodium retention, and formation of ascites. Urotensin II(U-II) is a constrictor of large conductive vessels. Conversely, it relaxes mesenteric vessels, decreases glomerular filtration, and increases renal sodium retention. In patients with cirrhosis, U-II plasma levels are increased. Thus, we investigated hemodynamic and renal effects of U-II and its receptor antagonist, palosuran, in cirrhotic bile duct–ligated rats (BDL). In BDL and sham-operated rats, we studied acute effects of U-II (3 nmol/kg; intravenously) and palosuran (10 mg/kg; intravenously) and effects of oral administration of palosuran (30 mg/kg/day; 3 days) on hemodynamics and renal function. We localized U-II and U-II-receptor (UTR) in livers and portal veins by immunostaining. We determined U-II-plasma levels by enzyme-linked immunosorbent assay (ELISA), and mesenteric nitrite/nitrate-levels by Griess-reaction. RhoA/Rho-kinase and endothelial nitric oxide synthase (eNOS) pathways were determined by western blot analysis and reverse transcription polymerase chain reaction (RT-PCR) in mesenteric arteries. U-II plasma levels, as well as U-II and UTR-receptor expression in livers and portal veins of cirrhotic rats were significantly increased. U-II administration further augmented the increased portal pressure (PP) and decreased mean arterial pressure (MAP), whereas palosuran decreased PP without affecting MAP. The decrease in PP was associated with an increase in splanchnic vascular resistance. In mesenteric vessels, palosuran treatment up-regulated expression of RhoA and Rho-kinase, increased Rho-kinase-activity, and diminished nitric oxide (NO)/cyclic guanosine 3′,5′-monophosphate (cGMP) signaling. Moreover, palosuran increased renal blood flow, sodium, and water excretion in BDL rats. Conclusion: In BDL rats, U-II is a mediator of splanchnic vasodilation, portal hypertension and renal sodium retention. The U-II-receptor antagonist palosuran might represent a new therapeutic option in liver cirrhosis with portal hypertension. (HEPATOLOGY 2008.)

Portal hypertension in liver cirrhosis is mediated by an increased portal tributary blood flow1 and an increase in intrahepatic resistance to portal flow.2 The increased portal tributary blood flow is attributable to decreased splanchnic vascular resistance and consecutive splanchnic vasodilation. Consequences of this vasodilation are activation of the renin angiotensin aldosterone system, renal sodium retention, and formation of ascites.3 This splanchnic vasodilation is mediated by an overproduction of the vasodilator nitric oxide (NO)4, 5 and by concomitant defects in contractile signaling. Thus, we have recently shown that a decrease in RhoA/Rho-kinase signaling contributes to vasodilation in cirrhosis.6, 7

Urotensin II (U-II) is a cyclic oligopeptide with vasoactive potential.8–11 By activation of the urotensin II receptor (UTR), U-II might influence different pathways, depending on the cells and vascular compartment where the receptor is located.11, 12 Activation of the endothelial UTR leads to relaxation via NO formation, whereas activation of UTR on vascular smooth muscle cells leads to contraction via RhoA/Rho-kinase activation.13, 14 In the kidney, UTR influences sodium and water homeostasis and glomerular filtration rate.15–17

Recently, we and others have shown that U-II plasma levels are increased in patients with liver cirrhosis.18, 19 In these patients, U-II plasma levels correlated negatively with mean arterial pressure (MAP) and positively with portal pressure (PP).18, 19 Furthermore, U-II plasma levels were higher in patients with cirrhosis and ascites than in patients with cirrhosis and without ascites, and correlated with the deterioration of renal function.18, 19 These data suggest U-II as a possible mediator of splanchnic vasodilation, portal hypertension, and deterioration of renal function in cirrhosis.

Palosuran (4-ureido-quinoline derivate, ACT-058362) is a specific, nonpeptide competitive UTR-antagonist.20 In diabetic rodents and patients, palosuran improves renal function.21, 22 However, its possible therapeutic potential in the treatment of portal hypertension and its complications have not been studied.

In the current study, we therefore investigated the effects of U-II and UTR-antagonist palosuran on hemodynamics and renal function in rats with secondary biliary cirrhosis. Furthermore, we studied vascular signaling of U-II and its receptor antagonist with respect to RhoA/Rho-kinase and NO/cyclic guanosine 3′,5′-monophosphate (cGMP) pathway.

Abbreviations

ΔCT, the difference in the number of PCR cycles; BDL, bile duct ligation; cGMP, cyclic guanosine 3′,5′-monophosphate; eNOS, endothelial nitric oxide synthase; iNOS, inducible nitric oxide synthase; MAP, mean arterial pressure; mRNA, messenger RNA; NO, nitric oxide; NOx, nitrate/nitrite; PKG, protein kinase G; PP, portal pressure; RT-PCR, reverse transcription polymerase chain reaction; SEM, standard error of the mean; SVR, systemic vascular resistance; U-II, urotensin II; UTR, urotensin II receptor (GPR14); VASP, vasodilator-stimulated phosphoprotein.

Materials and Methods

Animals

For our experiments, male Sprague-Dawley rats with an initial body weight of 180 to 200 g were used. Fifty-six rats underwent bile duct ligation (BDL) as previously described23 and were divided randomly into 3 groups. Five weeks after BDL, when cirrhosis was fully established, the animals of 1 group (n = 18) were treated with palosuran (30 mg/kg body weight per day) per gavage for 3 days. In another group (n = 6), urantide (0.6 mg/kg), a peptidic UTR-antagonist, was administered in the tail vein 3 hours before sacrifice. The rest of these animals remained untreated. Sham-operated rats (n = 32) served as controls. In these rats, the common bile duct was exposed by median laparotomy, but no ligation or resection was performed. The study was approved by the local committee for animal studies (Bezirksregierung Kǒln, 50.203.2-BN 22, 18/06).

Biochemical Analyses and Metabolic Cages

Five weeks after BDL or sham operation, 9 animals of each group were housed in individual cages (Techniplast, Buguggiate, Italy) and received normal chow and water ad libitum for 4 days. On a daily basis, palosuran (30 mg/kg/day for 3 days) or solvent were administered per gavage, and water intake as well as urinary volume were measured. At the end of the experiment, the animals were sacrificed. Blood and urine samples were obtained to measure biochemical parameters (aspartate aminotransferase, alanine aminotransferase, gamma glutamyltransferase, alkaline phosphatase, bilirubin, creatinine, sodium) using standard methods.

Immunohistochemistry

Sections from shock-frozen tissues were stained by an indirect immunoperoxidase technique as described previously.24 Shortly, endogenous peroxidase activity was blocked by 0.03% H2O2/NaNO3. The sections were incubated with primary antibody against U-II (A80.24.2, Immundiagnostik, Bensheim, Germany) or the UTR (SP4528P, Acris, Hiddenhausen, Germany). Staining patterns of these antibodies were confirmed by other primary antibodies against U-II (A80.20.2, Immundiagnostik, Bensheim, Germany; H071.05, Phoenixpeptide, Burlinghame, CA), or UTR (GPR14-A, Acris, Hiddenhausen, Germany). Antibodies were diluted in “antibody diluent with background reducing components” at room temperature and incubated with the sections for 90 minutes. After washing 3-fold in phosphate-buffered saline, peroxidase-coupled secondary antibody (BioRad, Munich, Germany) was applied for 30 minutes. Bound antibody was detected with 3-amino-9-ethylcarbazole (Sigma Chemicals, Munich, Germany). All sections were then counterstained with hemalaun.

Double Staining.

To identify U-II–positive and UTR-positive cells, double staining was performed in rat livers with fluorescein isothiocyanate–conjugated CD68 antibodies (Dako, Hamburg, Germany) and fluorescein isothiocyanate–conjugated CD31 antibodies as described previously.24 After the immunoperoxidase reaction, sections were incubated with unspecific immunoglobulin G1 and immunoglobulin G2 antibodies to block any possible free binding site of the secondary antibody, before the fluorescein isothiocyanate–conjugated antibody was applied. Analysis was done by bright-field and fluorescent photomicrographs on a Leica DMLB fluorescence microscope with an MPS60 photo camera.

Quantification.

In each liver the total numbers of U-II–positive and UTR-positive cells were counted in at least 10 randomly selected fields at 400-fold magnification. The positive intrahepatic veins, arteries, and bile ducts were counted. Furthermore, we counted the proportion of positive cells in the extrahepatic portal vein. Results are given as the mean standard error of the total numbers of positive cells per visual field and as the percentage of veins, arteries, and bile ducts.

Urotensin-II Plasma Levels

U-II plasma levels were determined using an enzyme immunoassay kit (Phoenix Pharmaceutical, Inc., St. Joseph, MO), based on the principle of a “competitive” enzyme immunoassay,25, 26 according to the manufacturer's guidelines.

Quantitative Reverse Transcription Polymerase Chain Reaction

RNA was isolated from 30 mg shock-frozen mesenteric artery homogenates with the RNeasy-mini kit (Qiagen, Hilden, Germany) according to the manufacture's guidelines. RNA concentrations were measured spectrophotometrically at 260 nm. For each sample, 0.5 μg total RNA was used. Before reverse transcription, samples were DNA-digested by incubation with RQ1 RNase-free DNase (Promega, Madison, WI). Reverse transcription was performed using MMLV reverse transcriptase (Invitrogen, Karlsruhe, Germany) and random primers (1 μg; Promega, Madison, WI). Primers and probes for reverse transcription polymerase chain reaction (RT-PCR) were designed using the Primer Express Software (Applied Biosystems, Foster City, CA) and custom synthesized by Microsynth and Applied Biosystems, respectively (Table 1). 18SrRNA served as endogenous control (primers and probes ready-to-use mix by Applied Biosystems). RT-PCR was performed using the ABI 7300 sequence detector (Applied Biosystems, Foster City, CA).27 PCR reaction was performed in a volume of 25 μL containing 12.5 μL 2× TaqMan-PCR master-mix (Applied Biosystems, Foster City, CA) and 2 μL complementary DNA. The ΔCT-method was used for quantification of the results. The difference in number of cycles (ΔCT) of the target genes and endogenous control are expressed as negative ΔCT (higher -ΔCT denotes higher mRNA levels). For each of the genes, a validation experiment was performed. The efficiencies of the RT-PCR for the target gene and the endogenous control were approximately equal.

Table 1. Primers and Probes Used for Quantitative RT-PCR for RhoA, Rho-Kinase and eNOS
GenePrimer/Probe Sequence 5′-3′(forward/reverse/probe)Primer/Probe Concentration (nM)
RhoAGGCAGAGATATGGCAAACAGG,300
TCCGTCTTTGGTCTTTGCTGA,300
CACTCCATGTACCCAAAAGCGCCAA100
Rho-kinaseCCCGATCATCCCCTAGAACC,300
TTGGAGCAAGCTGTCGACTG,300
ACAAAACCAGTCCATTCGGCGGC200
eNOSCTACCGGGACGAGGTACTGG,100
GGAAAAGGCGGTGAGGACTT,100
CGCCCAGCAGCGTGGAGTGTTT200

Western Blotting

Samples of shock-frozen mesenteric arteries were homogenized in a buffer containing 25 mM Tris/HCl, 5 mM ethylenediaminetetra-acetic acid, 10 μM phenylmethanesulfonyl fluoride, 1 mM benzamidine, and 10 μg/mL leupeptin. Samples were diluted with sample buffer. Protein determination of the homogenates was performed with the DC assay kit (Bio-Rad, Munich,Germany). Samples (20 μg protein/lane) were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis [15% gels for RhoA; 8% gels for Rho-kinase, endothelial nitric oxide synthase (eNOS), inducible nitric oxide synthase (iNOS), 10% gels for moesin, p-moesin, VASP, p-VASP], and proteins were blotted on nitrocellulose membranes. Ponceau S staining was performed to ensure equal protein loading. The membranes were blocked, incubated with primary antibodies (RhoA 119, Rho-kinase H-85, eNOS (N-20), iNOS, moesin clone E10, p-moesin (Thr-558), VASP (Santa Cruz Biotechnology, Santa Cruz, CA), p-VASP (Ser-239) clone 16C2 (Calbiochem, San Diego, CA), and thereafter with corresponding secondary peroxidase-coupled antibodies (Calbiochem, San Diego, CA). Blots were developed with enhanced chemiluminescence (Amersham, UK). Intensities of the resulting bands on each blot were densitometrically compared with a FLA-3000 phosphoimager (Fuji-Film, Dusseldorf, Germany).

Assessment of Protein Kinase G and Rho-Kinase Activity

Protein kinase G (PKG) activity was assessed as phosphorylation of the endogenous PKG substrate, VASP, at Ser-239. The phosphorylation state of VASP has been used as a sensitive marker of PKG activity.28–30 Rho-kinase activity was assessed as phosphorylation of the endogenous Rho-kinase substrate, moesin, at Thr-558.6, 31, 32 This was done by western blot analysis using site-specific and phosphospecific antibodies.

Nitrite/Nitrate Concentration in Mesenteric Arteries

Nitrite/nitrate (NOx) content of homogenates from shock-frozen mesenteric artery was determined via Griess reaction,33 using the Nitralyzer-II kit (WPI, Berlin, Germany) according to the manufacturer's guidelines.

Hemodynamic Studies

Hemodynamic studies were performed under ketamine anesthesia (60 mg/kg intramuscularly). This condition has been shown to approximate most closely the conscious state in terms of cardiac output and regional blood flow34 and has been used extensively to investigate hemodynamic effects of PP-lowering drugs in animal models of portal hypertension.23, 35 Median laparotomy was performed, and a PE-50 catheter was introduced into a small ileocecal vein and advanced to the portal vein for the measurement of PP. The left femoral artery was cannulated with PE-50 catheters for measurement of MAP and blood withdrawal. Via the right carotid artery, another PE-50 catheter was advanced into the left ventricle under pulse curve control. This catheter was used for microsphere application. The catheters in the femoral artery and the portal vein were connected to a pressure transducer (Hugo Sachs Elektronik, March-Hugstetten, Germany) for blood pressure measurement. The zero point was 1 cm above the operating table. After insertion of all catheters, rats were allowed to stabilize hemodynamically for 30 minutes.

Microsphere Technique.

Cardiac output was measured using the colored microsphere method as previously described.23, 36 The colored microsphere technique was validated by the more frequently used radioactive microsphere method.36 It has the advantage of being nonradioactive. A reference sample was obtained for 1 minute at a rate of 0.65 mL/minute, using a continuous withdrawal pump (Hugo Sachs Elektronik, March-Hugstetten, Germany). About 300,000 yellow microspheres (15-μm diameter, Triton Technologies, San Diego, CA) were suspended in 0.3 mL saline containing 0.05% Tween and injected in the left ventricle 10 seconds after the withdrawal pump had been started. Portosystemic shunting was estimated after injection of 150,000 blue microspheres in 0.3 mL saline containing 0.05% Tween in an ileocecal vein within 30 seconds.37

The blood reference probe was digested by addition of 3.8 mL 5.3 M KOH and 0.5 mL Tween80 and subsequent boiling for 1 hour. The digested tissues and blood samples were vortexed and filtered using Whatman Nucleopore filters (Whatman International Ltd., Madison, UK). The color of the filtered microspheres was dissolved in 0.2 mL dimethyl-formamide, and the absorption was measured by spectrophotometry. Thereafter, cardiac output and portosystemic shunting was calculated using software obtained by Triton Technologies and expressed per 100 g body weight. Splanchnic perfusion pressure was defined as MAP–PP. Splanchnic vascular resistance was calculated from the ratio between splanchnic perfusion pressure and splanchnic blood flow. Hepatic vascular resistance was calculated as PP divided by sum of gastrointestinal and splenic perfusion minus shuntflow. Systemic vascular resistance (SVR) was estimated as the ratio between MAP and cardiac output.

Acute Experiments.

U-II (3 nmol/kg) or palosuran (10 mg/kg) were applied intravenously after stabilization, and PP and MAP were monitored continuously for a further 20 minutes, followed by application of microsphere technique.

Hemodynamic Experiments After Oral Administration of Palosuran (30 mg/kg/day) or Solvent.

After hemodynamic stabilization, PP and MAP were monitored continuously for a further 45 minutes, followed by application of microsphere technique.

Statistical Analysis

Data are presented as mean ± standard error of the mean (SEM). Analysis of variance followed by Mann-Whitney U tests were used for comparison between groups (SPSS 14 for Windows; SPSS Inc., Chicago, IL). P-values < 0.05 were considered statistically significant.

Results

General Characteristics

Mean body weights did not differ between palosuran-treated and untreated cirrhotic rats. Liver and spleen weights were significantly increased in cirrhotic animals compared with sham-operated rats (Table 2). There was no difference in liver weight between untreated and palosuran-treated cirrhotic rats, but spleen weight of treated rats was significantly decreased (Table 2). Mortality was less than 15% and did not differ between both groups of BDL animals.

Table 2. General Characteristics of the Different Groups of Rats
GroupBody Weight(g)Liver(g)Spleen(g)
  • Data are means ± SEM. (n = 9/group;

  • *

    P < 0.05 versus sham;

  • P < 0.05 versus BDL)

sham425 ± 1313.7 ± 0.60.53 ± 0.06
BDL338 ± 12*23.3 ± 2.3*2.50 ± 0.20*
BDL + palosuran322 ± 9*20.0 ± 1.8*1.60 ± 0.20*

Biochemical Parameters

An increase in all liver-specific biochemical parameters analyzed was observed in BDL rats when compared with sham-operated control animals (Table 3). This elevation remained unchanged after treatment with palosuran.

Table 3. Biochemical Parameters of the Different Groups
Groupγ-GT(U)ALT(U)AST(U)AP(U)Bilirubin(mg/dL)
  • Data are means ± SEM. (n = 9/group;

  • *

    P < 0.05 versus sham).

sham2.8 ± 0.443 ± 8128 ± 18152 ± 160.09 ± 0.01
BDL33.8 ± 5.6*129 ± 13*610 ± 45*301 ± 40*6.5 ± 0.8*
BDL + palosuran34.4 ± 3.2*132 ± 14*677 ± 65*332 ± 23*7.9 ± 0.6*

Intrahepatic U-II and UTR Expression

We found a strong expression of both U-II and UTR in livers of the examined rats (Fig. 1). U-II was expressed on endothelial cells of arteries, veins, and bile ducts as well as on sinusoidal lining cells (Fig. 1A,B). In double staining experiments, these U-II–expressing sinusoidal lining cells were identified as Kupffer cells, whereas sinusoidal endothelial cells were negative (Fig. 1C). Hepatocytes did not express U-II. This principal expression pattern of U-II did not differ between BDL and control rats. However, we found a significant increase in the numbers of U-II–positive cells in livers of BDL rats compared with sham-operated controls (Fig. 3A).

Figure 1.

Intrahepatic immunohistochemical localization of U-II and of the UTR in sham-operated and cirrhotic rats: U-II expression in the liver of sham-operated (A) and cirrhotic BDL rats (B) show positive staining on the endothelial layer of vessels and on intrasinusoidal cells. Co-localization experiments with U-II (on the left) and CD68-antibody (on the right) show that these cells are Kupffer cells (C). UTR expression in the liver of sham-operated (D) and BDL rats (E). Co-localization experiments with UTR (on the left) and CD68-antibody (on the right) show that these cells are Kupffer cells (F). Shown are representative experiments.

Figure 3.

Quantification of immunohistochemical analysis: Intrahepatic U-II (A) and its receptor UTR (B) in sham-operated and cirrhotic BDL rats. The expression of U-II (C) and its receptor UTR (D) in portal veins of sham-operated and cirrhotic BDL rats. U-II plasma levels (E) in sham-operated rats receiving solvent and in untreated as well as palosuran-treated cirrhotic BDL rats (30 mg/kg/day; 3 days) (minimum n = 6/group; *P < 0.05 versus sham, †P < 0.05 versus BDL). Shown are means ± SEM.

The UTR was only faintly expressed in livers of sham-operated rats but up-regulated in samples of BDL rats. UTR-expressing cells included endothelial cells of arteries, central and portal veins, and bile ducts as well as Kupffer cells (Fig. 1D-F). Interestingly, we found an up-regulation of UTR expression in BDL rats compared with sham-operated control rats (Fig. 3B).

U-II and UTR Expression in Portal Veins

Endothelial cells of portal veins strongly expressed U-II as well as its receptor (Fig. 2). While U-II was expressed on endothelial cells exclusively (Fig. 2A,B), the UTR was additionally expressed on vascular smooth muscle cells in these vessels (Fig. 2C,D). Interestingly, we found significant up-regulation in the expression of U-II and its receptor in portal veins of BDL rats compared with sham-operated control animals (Fig. 3C,D).

Figure 2.

Immunohistochemical localization of U-II and of the UTR in portal veins of sham-operated and cirrhotic rats: U-II staining in extrahepatic portal veins of sham-operated (A) and BDL rats (B) show U-II expression by endothelial cells of the portal vein. UTR expression was found on vascular smooth muscle cells (*) and on endothelial cells (**) of the extrahepatic portal veins of sham-operated (C) and BDL rats (D). Shown are representative experiments.

U-II Plasma Levels

U-II levels in the plasma of BDL rats were significantly higher compared with sham-operated noncirrhotic rats (Fig. 3E). In BDL rats, oral treatment with palosuran induced a further significant increase in plasma U-II levels.

mRNA Levels of RhoA, Rho-Kinase, and eNOS

Messenger RNA concentrations of both RhoA and Rho-kinase remained unchanged in mesenteric arteries of cirrhotic rats compared with sham-operated noncirrhotic rats. In mesenteric arteries of cirrhotic rats treated with palosuran, RhoA and Rho-kinase mRNA levels were significantly increased when compared with vessels of untreated BDL rats (Fig. 4A,B). In mesenteric arteries of BDL rats, eNOS mRNA levels were increased compared with those of sham-operated rats. Palosuran treatment caused a further increase in eNOS mRNA in cirrhotic mesenteric arteries (Fig. 4C).

Figure 4.

mRNA expression of RhoA (A), Rho-kinase (B), and eNOS (C) in mesenteric arteries as determined by quantitative RT-RCR and corrected to 18-S-RNA as housekeeping gene (n = 6/group; *P < 0.05 versus sham, †P < 0.05 versus BDL).

Protein Expression of RhoA and Rho-Kinase in Mesenteric Arteries

Western blot analysis showed no difference in mesenteric protein expression of RhoA between mesenteric arteries from BDL and sham-operated rats, but Rho-kinase protein expression was decreased in mesenteric arteries of BDL rats when compared with vessels from sham-operated rats. Oral administration of palosuran increased the protein expressions of both RhoA and Rho-kinase in mesenteric arteries of BDL rats (Fig. 5A,B). Intravenous application of a single dose of urantide increased the protein expression of Rho-kinase in mesenteric arteries of BDL rats 3 hours after injection (Fig. 5C).

Figure 5.

Protein expression of RhoA (A) and Rho-kinase (B, C) in mesenteric arteries as determined by western blot analysis. Levels of phospho-moesin (C, D) in mesenteric arteries as determined by western blot analysis with a phospho-specific and site-specific (Thr558) antibody (minimum, n = 6/group; *P < 0.05 versus sham, †P < 0.05 versus BDL). Shown are relative densitometric quantifications of all experiments with values of sham-operated rats set to 100 du (means ± SEM) and representative western blots.

Rho-Kinase Activity

As a marker of Rho-kinase activity, we determined the phosphorylation state of the Rho-kinase substrate moesin.6, 31, 32 Moesin is phosphorylated at Thr-558 by Rho-kinase. Western blot analysis with a phospho-specific and site-specific moesin antibody (Thr-558) showed a decreased phosphorylation of moesin in mesenteric arteries of cirrhotic rats compared with sham-operated rats. Of note, oral administration of palosuran, as well as intravenous application of a single dose of urantide in cirrhotic rats, significantly increased the phosphorylation of moesin in mesenteric arteries (Fig. 5D,E). Thus, long-term blockade of UTR with palosuran or urantide enhances Rho-kinase activity in mesenteric arteries of cirrhotic rats.

Protein Expression of eNOS

Western blot analysis revealed no difference in eNOS expression between mesenteric arteries of cirrhotic and noncirrhotic rats but an increase in eNOS expression in vessels of palosuran-treated BDL rats when compared with those of untreated cirrhotic BDL rats (Fig. 6A).

Figure 6.

Protein expression of eNOS (A) in mesenteric arteries as determined by western blot analysis. Levels of phospho-VASP (B) in mesenteric arteries as determined by Western blot analysis with phospho-specific and site-specific (p-VASP Ser239) antibody. Shown are relative densitometric quantifications of all experiments with values of sham-operated rats set to 100 du (means ± SEM) and representative western blots. Mesenteric NOx concentration (C) in mesenteric arteries homogenates. Shown are means ± SEM (minimum, n = 6/group; *P < 0.05 versus sham, †P < 0.05 versus BDL).

Protein Expression of iNOS

iNOS expression could hardly be detected in mesenteric arteries of cirrhotic BDL rats. Western blot analysis showed no difference in iNOS expression between mesenteric arteries of cirrhotic untreated and palosuran-treated cirrhotic BDL rats (data not shown).

PKG Activity

As a marker of PKG activity, we determined the phosphorylation of the PKG substrate VASP as described previously.28–30 VASP is phosphorylated at Ser-239 by PKG. Western blot analysis with a phospho-specific and a site-specific (Ser-239) VASP antibody revealed an increased phosphorylation of VASP in mesenteric arteries of cirrhotic rats when compared with vessels of sham-operated rats. The administration of palosuran in cirrhotic rats decreased the phosphorylation of VASP in mesenteric arteries (Fig. 6B).

Nitrate/Nitrite Concentration in Mesenteric Arteries

Measurement of NOx concentration revealed a significant increase in NOx in mesenteric arteries from untreated cirrhotic BDL rats compared with vessels from sham-operated rats. Palosuran treatment significantly decreased NOx concentration in mesenteric arteries of cirrhotic rats to levels similar to those observed in vessels of sham-operated rats (Fig. 6C).

Acute Hemodynamic Studies

As expected, PP was markedly increased in BDL rats when compared with sham-operated rats (Fig. 7A). In cirrhotic rats, intravenous U-II application caused a significant increase in PP (Fig. 7A). This was accompanied by a further decrease in splanchnic vascular resistance (which was diminished in BDL rats at baseline), and a further increase in portal tributary blood flow (which was elevated in BDL rats at baseline) compared with BDL rats receiving vehicle (Fig. 8A,B). Of note, a decrease in PP (Fig. 7A), due to an increase in splanchnic vascular resistance and a decrease in portal tributary blood flow, was observed in BDL rats receiving palosuran (Fig. 8A,B).

Figure 7.

Effects of acute intravenous administration of U-II (3 nmol/kg) or palosuran (10 mg/kg) on portal pressure (A) and MAP (B) in sham-operated and BDL rats (Comparisons between the groups were carried out by Mann-Whitney tests.) (n = 7/group, *P < 0.05 versus sham; †P < 0.05 versus BDL).

Figure 8.

Splanchnic vascular resistance (A), portal tributary blood flow (B), systemic vascular resistance (C), and cardiac output (D) in sham-operated, cirrhotic BDL rats and cirrhotic BDL rats after acute intravenous administration of U-II (3 nmol/kg) or palosuran (10 mg/kg). Comparisons between the groups were carried out by Mann-Whitney tests (n = 7/group; *P < 0.05 versus sham; †P < 0.05 versus BDL; #P < 0.05 versus BDL + Urotensin-II).

Basal MAP and SVR were significantly lower in cirrhotic rats when compared with sham-operated rats. The acute administration of U-II led to a further sustained decrease in MAP in cirrhotic rats, whereas the application of palosuran caused only a transient decrease in MAP (Fig. 7B). SVR was significantly decreased in BDL rats by the application of U-II, compared with BDL rats receiving palosuran (Fig. 8C). Cardiac output was significantly decreased in BDL rats after application of U-II when compared with BDL rats receiving palosuran (Fig. 8D).

Hemodynamic Studies After Oral Administration of Palosuran

Importantly, oral palosuran caused a significant decrease in PP in BDL rats (Fig. 9A). This was attributable to an increase in splanchnic vascular resistance and a decrease in portal tributary blood flow (Fig. 9C,D). In contrast, hepatic vascular resistance remained unchanged in response to palosuran (Fig. 9B).

Figure 9.

Portal pressure (A), hepatic vascular resistance (B), splanchnic vascular resistance (C), and portal tributary blood flow (D) in sham-operated, untreated, and orally palosuran-treated cirrhotic BDL rats (30 mg/kg/day; 3 days). Comparisons between the groups were carried out by Mann-Whitney tests (n = 9/group; *P < 0.05 versus sham, †P < 0.05 versus BDL).

The oral administration of palosuran caused no changes in MAP in cirrhotic rats (Fig. 10A). SVR was significantly decreased in BDL rats when compared with sham-operated rats (Fig. 10B). Cardiac output was significantly increased in BDL rats when compared with sham-operated rats, but again, no change was observed after treatment with palosuran in cirrhotic rats (Fig. 10C). Portosystemic shunting in cirrhotic rats remained unchanged after treatment with palosuran (Fig. 10D).

Figure 10.

Mean arterial pressure (A), systemic vascular resistance (B), cardiac output (C), and shunt volume in sham-operated, untreated, and orally palosuran-treated cirrhotic BDL rats (30 mg/kg/day; 3 days). Comparisons between the groups were carried out by Mann-Whitney tests (n = 9/group; *P < 0.05 versus sham).

Renal Function

Renal arterial flow was markedly increased in BDL rats when compared with sham-operated rats. The treatment with palosuran led to a further increase in renal arterial flow (Fig. 11A). Creatinine clearance and sodium excretion were significantly decreased in BDL rats compared with sham-operated rats. Administration of palosuran caused an increase in creatinine clearance and sodium excretion compared with untreated cirrhotic rats, although they remained significantly lower than in sham-operated rats (Fig. 11B,C). These effects of palosuran on renal function of cirrhotic rats were accompanied by an increase in urine volume (Fig. 11D).

Figure 11.

Renal arterial flow (A), creatinine clearance (B), sodium excretion (C), and urine volume (D) in sham-operated, untreated, and orally palosuran-treated cirrhotic BDL rats (30 mg/kg/day; 3 days). Comparisons between the groups were carried out by Mann-Whitney tests (n = 9/group; *P < 0.05 versus sham,†P < 0.05 versus BDL).

Discussion

The current study suggests that U-II contributes to mesenteric vasodilation and portal hypertension in rats with secondary biliary cirrhosis. Consequently, the UTR antagonist palosuran lowered portal pressure via splanchnic vasocontraction in these rats. This was associated with an activation of mesenteric vascular Rho-kinase and an inhibition of NO/cGMP-dependent PKG signaling (Fig. 12). Finally, palosuran improved renal function in cirrhotic rats.

Figure 12.

Vasomotoric pathways: Activation of the UTR stimulates the RhoA/Rho kinase pathway, resulting in increased myosin light chain (MLC) phosphorylation and thus contraction. Counterbalance is achieved through activation of myosin light chain phosphatase (MLCP) by NO/cGMP-dependent protein kinase G (PKG) activation. VASP phosphorylation depends on the activation of protein kinase G, and analog phosphorylation of moesin depends on the activity of Rho-kinase; both can thus be used as markers of the respective enzyme activity. NO production is stimulated by agonist activation of UTR. As indicated, Rho-kinase might inhibit eNOS activity and thus NO formation. Conversely, protein kinase G might also inhibit RhoA/Rho-kinase.13, 14

In patients with liver cirrhosis, plasma levels of the vasoactive peptide U-II correlate positively with the degree of portal hypertension and renal dysfunction.18, 19 However, data regarding the hemodynamic and vascular effects of UTR blockade in liver cirrhosis are lacking.

In our study, U-II plasma levels were up-regulated in portal hypertensive BDL rats. This was associated with an increased expression of U-II in endothelial cells of hepatic vessels, Kupffer cells, and portal veins, identifying them as a possible source of increased U-II plasma levels in cirrhosis. Moreover, the expression of the U-II receptor UTR was up-regulated in the intrahepatic vasculature and portal veins. Interestingly, the distribution pattern of U-II expression and its receptor did not change in BDL rats as compared with sham-operated rats. Probably because of this general intrahepatic up-regulation (endothelial cells of intrahepatic veins and arteries, but not sinusoids), UTR blockade had obviously no effect on hepatic vascular resistance (Fig. 9B).

In cirrhotic rats, U-II induced splanchnic vasodilatation and consecutively increased portal pressure (Figs. 7, 8). Vice versa, palosuran increased splanchnic vascular resistance and decreased portal pressure (Figs. 7–10). Oral application of palosuran had no effect on MAP in these rats, confirming the region-specific properties of U-II (Fig. 10). These data strongly suggest a role of U-II and its receptor for the diminished mesenteric vascular tone in cirrhosis with portal hypertension.

Next we investigated the molecular mechanism of U-II–mediated splanchnic vasodilation. Vascular tone is modulated by many factors, but it essentially depends on the equilibrium between phosphorylated and nonphosphorylated myosin light chains. RhoA/Rho-kinase and the eNOS/NO/PKG pathways are important regulators of this equilibrium.4–6 In extrahepatic cirrhotic vessels, this equilibrium is shifted toward vasodilation because of defective RhoA/Rho-kinase signaling6 and enhanced eNOS/NO/PKG activity.4, 5 U-II can activate RhoA and its effector Rho-kinase, leading to vasoconstriction in vascular smooth muscle cells38 (Fig. 12). Conversely, U-II might activate eNOS, leading to NO- dependent vasorelaxation39 (Fig. 12).

However, in cirrhotic rats, exogenous U-II failed to induce vasocontraction, and Rho-kinase activity was low despite elevated U-II levels (Figs. 5–8). These data (Fig. 5) confirm the concept of defective RhoA/Rho-kinase signaling in extrahepatic vessels from cirrhotic species.6 In cirrhotic BDL-rats, UTR antagonism by palosuran decreased mesenteric NO production (nitrite/nitrate levels) and inhibited its downstream effector PKG (measured via VASP-phosphorylation) (Fig. 6), resulting in splanchnic vasocontraction (Fig. 8). We therefore assume that increased plasma levels of U-II contribute at least partially to splanchnic overproduction of NO in cirrhotic animals.

Interestingly, the blockade of UTR led to an increased expression of RhoA, Rho-kinase, and eNOS in mesenteric arteries of cirrhotic rats by an unknown mechanism (Figs. 4, 5). The Rho-kinase expression and activity was increased by 2 different antagonists (the peptide urantide and the nonpeptide palosuran) of UTR (Fig. 5). This proves the specificity of palosuran.

Increased Rho-kinase activity as shown in our experiments (Fig. 5) can inhibit eNOS activity and NO production as previously described40, 41 (Fig. 12). Although we cannot explain why, in our experiments the UTR blockade increased Rho-kinase expression and activity. This explains the decreased eNOS activity and the vasoconstrictive effect as depicted in Fig. 12. Besides the expression level, posttranslational modifications of eNOS are essential regulators of its enzyme activity.42, 43 For instance during liver diseases, intrahepatic eNOS activity is diminished despite unchanged expression.44

This vasoconstriction induced by palosuran might increase shear stress in mesenteric arteries. Indeed, shear stress is well known to cause such an up-regulation of eNOS expression43, 45 and might represent a mechanism of eNOS up-regulation induced by palosuran, although its activity is blunted (see previous discussion).

In addition to the systemic and splanchnic hemodynamic effects,8–11 U-II also affects renal function. It has been shown that U-II decreased glomerular filtration rate, urine flow, and sodium excretion in rats.15 Vice versa, the UTR-antagonist palosuran improved glomerular filtration rate and filtration fraction in diabetic rats.22 In diabetic patients, palosuran decreased albuminuria.21 The exact effects of U-II on the regulation of renal vascular tone and exchange of electrolytes and water remain unclear. In liver cirrhosis, U-II levels are increased in cirrhotic patients with ascites and correlate positively with renal deterioration in cirrhosis.18, 19

Here, we found that palosuran increased renal perfusion, glomerular filtration rate, renal sodium excretion, and urine flow in cirrhotic rats (Fig. 11). This improvement of renal function in cirrhotic rats might be a direct effect of UTR blockade at the tubules and glomeruli. Because it has been shown that a drop in portal pressure positively influences renal function,46 it also could be an indirect effect because of the decrease of portal hypertension by palosuran.

We conclude that urotensin II possibly plays a role in portal hypertension by inducing splanchnic vasodilation and effecting kidney dysfunction. The urotensin II receptor blockade should be tested as a new therapeutic option in humans with liver cirrhosis and portal hypertension.

Acknowledgements

The authors thank Gudrun Hack for excellent technical support.

Ancillary