An abnormal gene expression of the β-adrenergic system contributes to the pathogenesis of cardiomyopathy in cirrhotic rats

Authors


  • Potential conflict of interest: Nothing to report.

Abstract

Decreased cardiac contractility and β-adrenergic responsiveness have been observed in cirrhotic cardiomyopathy, but their molecular mechanisms remain unclear. To study β-adrenergic–stimulated contractility and β-adrenergic gene expression patterns, 20 Wistar Kyoto rats were treated with carbon tetrachloride to induce cirrhosis and 20 rats were used as controls. Left ventricular contractility was recorded in electrically driven isolated hearts perfused at constant flow with isoproterenol (10−10 to 10−6 M). A cardiac gene expression profile was obtained using a microarray for the myocyte adrenergic pathway. The cardiac contractility maximal response to isoproterenol was significantly reduced in cirrhotic rats in comparison to control rats, whereas the half-maximal effective concentration was not different. In cirrhotic rats, cardiac gene expression analysis showed a significant overexpression of G protein alpha–inhibiting subunit 2 (Gαi2), cyclic nucleotide phosphodiesterase (PDE2a), regulator of G-protein signaling 2 (RGS2), and down-expression of adenylate cyclase (Adcy3). These results indicate that overexpression of Gαi2, PDE2a, and RGS2 down-regulates the β-adrenergic signaling pathway, thus contributing to the pathogenesis of cirrhotic cardiomyopathy. (HEPATOLOGY 2008;48:1913-1923.)

Liver cirrhosis is associated with abnormal hemodynamics, characterized by reduced splanchnic and systemic vascular resistance, low mean arterial pressure, and increased cardiac output.1 However, experimental and clinical studies have also provided strong evidence for the appearance of latent heart failure termed “cirrhotic cardiomyopathy”, which is characterized by diastolic dysfunction, electrophysiological abnormalities, and impaired cardiac contractility in response to pharmacological or physiological stress, despite increased baseline cardiac output.1, 2

A decrease of β-adrenergic function, an increase of nitric oxide synthesis, abnormalities in plasma membrane fluidity, and augmented synthesis of endocannabinoids are thought to represent the main pathophysiological mechanisms involved in cirrhotic cardiomyopathy.3–5 In particular, several studies have suggested that the decreased responsiveness of cardiomyocytes to β-adrenergic agonists could be the consequence of a defective β-adrenergic function. Gerbes et al. have shown that leukocytes from patients with cirrhosis with severe ascites have a decreased number of β-adrenergic receptors in comparison to normal subjects,6 although others did not confirm these findings.7 Lee et al. have reported that in the biliary cirrhotic rat model, the cardiac β-adrenergic receptor density was reduced and associated with a blunted cardiac contractility, suggesting that β-adrenergic receptor down-regulation may be responsible for the myocardial hyporesponsiveness to catecholamines in cirrhosis.8 Ma et al. have reported reduced function and expression of cardiac G protein in an experimental model of cirrhosis, and have proposed a post-receptor defect of the β-adrenergic pathway.9

Therefore, although all these studies suggest that an impaired β-adrenergic signal transduction may play a predominant role in the pathogenesis of cirrhotic cardiomyopathy, the exact mechanism underlying this phenomenon has not yet been fully clarified.

Carbon tetrachloride (CCl4) is frequently used to induce experimental cirrhosis in the rat.10 Recently, this rat model has been used to obtain the gene expression profile of hepatocytes and of liver endothelial cells, thus providing important insights into the pathogenic mechanisms of fibrosis.11 We used this animal model to investigate the role of β-adrenergic gene expression in the pathogenesis of cirrhotic cardiomyopathy.

Abbreviations

βARs, β-adrenergic receptors; cAMP, adenosine 3′,5′ monophosphate; CCl4, carbon tetrachloride; cDNA, complementary DNA; cGMP, cyclic guanosine monophosphate; CO, cardiac output; cRNA, complementary RNA; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; HR, heart rate; MAP, mean arterial pressure; mRNA, messenger RNA; PDE, phosphodiesterase; TPR, total peripheral resistance; VEGF, vascular endothelial growth factor.

Materials and Methods

The protocols were conducted in accordance with the principles and procedures outlined in the National Institutes of Health guidelines and in the University of Padova Ethical Committee criteria for the care and use of laboratory animals.

Animal Model of Cirrhosis.

Cirrhosis was induced in adult (200-225 g body weight) male Wistar-Kyoto rats (Charles River, Calco, Italy) by exposing the animals to inhalation of CCl4 twice a week, as described.12 Twenty cirrhotic and 20 control rats were housed in environmentally controlled facilities and allowed free access to chow and distilled water containing phenobarbital (Luminal 0.3 g/L; Bracco, Italy). Cirrhotic rats were studied between 13 and 15 weeks after initiating CCl4 administration. All the experiments were performed 1 week after the last CCl4 dose. Cirrhosis was verified by postmortem microscopic examination of hematoxylin-stained liver sections. No rat had ascites at the time of the study.

Hemodynamic Studies.

Hemodynamic studies were performed under ketamine anesthesia (100 mg/kg body weight) in 10 cirrhotic and 10 control rats. This condition has been shown to approximate most closely the conscious state in terms of blood pressure and cardiac output and has been used extensively to investigate hemodynamics in animal models of cirrhosis and portal hypertension. Under anesthesia, a tracheotomy was performed and a polyethylene PE-240 catheter was inserted into the trachea to ensure airway patency. A polyethylene PE-50 catheter was placed in the left femoral artery, was connected to a highly sensitive transducer (Hewlett Packard, Avondale, PA) for blood pressure measurement, and the artery was perfused with Ringer solution (0.5 mL/hour) using a continuous flow system (Critiflo; Gould Inc., Oxnard, CA) to maintain patency.

Another PE-50 catheter was placed in the right atrium through the right jugular vein. A thermocouple (Columbus Instruments, Columbus, OH) was advanced to the aortic arch through the left carotid artery to monitor intra-arterial temperature during cardiac output (CO). CO, mean arterial pressure (MAP), and heart rate (HR) were recorded using a microcomputer system designed for CO determination (Cardiomax IIR, Columbus, OH), which was connected to a multichannel system (MXP4 and MT4; Lectromed Ltd., Jersey, Channels Islands, UK). CO was measured by thermodilution, following the administration of a 200 μL bolus of Ringer solution (20-23°C) into the right atrium. A spring-loaded syringe was used (model CR-700-200, Hamilton Syringe, Reno, NV) to ensure constant injection rate and volume. Total peripheral resistance (TPR) was estimated using the formula TPR = MAP/CO. Each value represents the average of three experiments.

Measurement of Cardiac Contractility.

Ten cirrhotic and 10 control rats were sacrificed by decapitation after intraperitoneal injection of 300 μL of heparin (5000 U/mL). The ventricles from four cirrhotic and from four control rats were then rapidly isolated and weighed for the determination of cardiac mass index, calculated as the ratio of heart weight (mg) to body weight (g). Subsequently, the heart, cannulated through the aorta, was mounted in a Langendorff apparatus for retrograde perfusion, perfused at constant flow (10 mL/minute), and electrically driven at a frequency of 6 Hz using platinum electrodes placed in the left atrium as previously described.13 Left ventricular developed pressure (LVDP) was measured by inserting a steel cannula into the left ventricle and connecting it to a pressure transducer (2B Instruments, Varese, Italy). The perfusion medium was a modified Krebs-Henselheit saline solution with the following composition: 118 mM NaCl, 4.7 mM KCl, 2.5 mM CaCl2, 1.2 mM MgSO4, 25 mM NaHCO3, 11.1 mM glucose, and 2.0 mM disodium pyruvate, bubbled with a 95%/5% O2/CO2 mixture at 37°C. Following a stabilizing period of 20 minutes, the heart was stimulated with increasing concentrations of isoproterenol (from 10−10 to 10−6 M) to obtain a concentration-response curve. The LVDP was continuously recorded and stored by a real-time digital acquisition and analysis system (model MP-100; Biopac System, Santa Barbara, CA). LVDP was calculated as the difference between systolic and diastolic values of left ventricular pressure.

RNA Extraction and Purification.

Pieces of left ventricular tissue from six cirrhotic and from six control rats were minced in a mortar in order to obtain fractions smaller than 30 mg, which were then homogenized using a bead beater homogenizer (Qiagen, Hilden, Germany; steel bead, 3 mm diameter). Total RNA extraction was performed using the RNeasy Fibrous Tissue kit (Qiagen). RNA quantification and purity were determined by spectrophotometric measurement (260/280 nm). RNA integrity was checked with a 2100 BioAnalyzer (Agilent Tech, Santa Clara, CA) using RNA Nano LabChips.

Microarray Analysis.

We used a custom-made Oligo GEArray Rat microarray (Superarray Inc., Bethesda, MD). The Oligo GEArray system uses long (60-unit oligomer) oligonucleotides as the probes for selected genes and a nylon membrane as the array matrix. The array used in these experiments contained 120 sequences associated with the myocyte adrenergic pathway14 and with apoptosis-related and stress response–related genes, 16 housekeeping sequences, negative controls (Blank, PUC18), positive controls to check biotin incorporation (Biotinylated Artificial Sequence 2 complementary, BAS2C), and positive controls to check the specificity of incorporation (Artificial Sequence 1 Related 1, AS1R1), as indicated in Table 1. Extracted RNA was enzymatically converted into a biotinylated complementary RNA (cRNA) target with the TrueLabelling-AMP 2.0 kit in a thermal cycler, according to SuperArray instructions. RNA pooled from six hearts from control rats was used as the reference in the microarray analysis. Then, each heart from six cirrhotic rats was compared to the pooled heart RNA. Briefly, 3 μg of total RNA was retrotranscribed to complementary DNA (cDNA) in a reaction mixture containing 5× cDNA Synthesis Buffer, cDNA Synthesis Enzyme Mix, ribonuclease inhibitor, and TrueLabelling Primer (total reaction volume 20 μL). The reaction mixture was incubated first at 42°C for 50 minutes, then at 75°C for 5 minutes, and finally cooled down to 37°C. Next, 20 μL of amplification Master Mix containing 2.5× RNA polymerase buffer, biotinylated-uridine triphosphate, and RNA polymerase enzyme was added to the cDNA in order to obtain labeled cRNA. The reaction mixture was incubated overnight at 37°C. The cRNA obtained was then purified using a SuperArray Grade cRNA cleanup kit and quantified by spectrophotometric measurement. Next, biotin-labeled cRNA was added to the nylon membranes and hybridized overnight at 60°C. Membranes were then washed first in 2× SSC buffer (sodium chloride/sodium citrate with 1% sodium dodecyl sulfate [SDS]) and then with 0.1× SSC buffer with 0.5% SDS at 60°C for 15 minutes. Finally, the hybridized membranes were incubated with AP-SA buffer (alkaline phosphatase conjugated to streptavidin) and with CDP-star, a chemiluminescent substrate, at 37°C for 1 minute, according to the manufacturer's instructions. Image acquisition was obtained using a Versa DOC 3000 imaging system (Bio-Rad Laboratories, Hercules, CA). Quantitative data were analyzed with GEArray Expression Analysis Suite software (SuperArray, Frederick, MD). The raw data were filtered to ensure that individual spots met a number of quality criteria, including minimal-intensity levels and minimal signal-to-background ratios. Genes that met these criteria were used for further data analysis. After background correction, normalization of the microarray results was obtained by dividing the signal intensity of each gene by the average intensity of the housekeeping genes' signals, which had relatively constant expression levels among the different arrays. A data analysis of six independent experiments was performed. The ratio of gene expression in cirrhotic to control rats was considered significant only when less than 0.5 or greater than 2.0.

Table 1. GeArray Rat Microarray
PositionGenBankGeneDescription
1NM_017101PpiaPeptidylprolyl isomerase A
2NM_031009Agtr1Angiotensin II type-1 receptor
3NM_012494Agtr2Angiotensin II receptor, type 2
4NM_030851Bdkrb1Bradykinin receptor B1
5NM_173100Bdkrb2Bradykinin receptor b2
6NM_012550EdnraEndothelin receptor type A
7NM_017333EdnrbEndothelin receptor type B
8NM_017191Adra1aAdrenergic receptor, alpha 1a
9NM_016991Adra1bAdrenergic receptor, alpha 1b
10NM_024483Adra1dAdrenergic receptor, alpha 1d
11NM_012701Adrb1Adrenergic receptor, beta 1
12NM_012492Adrb2Adrenergic receptor, beta 2
13NM_013108Adrb3Adrenergic receptor, beta 3
14NM_031034Gna12Guanine nucleotide binding protein, alpha 12
15NM_053542Gna15Guanine nucleotide binding protein, alpha 15
16NM_031036GnaqGuanine nucleotide binding protein, alpha q polypeptide
17NM_031035Gnai2Guanine nucleotide binding protein, alpha inhibiting 2
18NM_019132GnasGNAS complex locus
19NM_013106Gnai3Guanine nucleotide binding protein 3
20NM_013189GnazGuanine nucleotide binding protein, alpha z subunit
21NM_053453Rgs2Regulator of G-protein signaling 2
22NM_019340Rgs3Regulator of G-protein signalling 3
23NM_017214Rgs4Regulator of G-protein signaling 4
24NM_019341Rgs5Regulator of G-protein signaling 5
25XM_345702Rgs6Regulator of G-protein signaling 6
26NM_019343Rgs7Regulator of G-protein signaling 7
27NM_019344Rgs8Regulator of G-protein signaling 8
28NM_019224Rgs9Regulator of G-protein signaling 9
29XM_341936Rgs10Regulator of G-protein signaling 10
30NM_019339Rgs12Regulator of G-protein signaling 12
31NM_053764Rgs14Regulator of G-protein signaling 14
32NM_021661Rgs19Regulator of G-protein signaling 19
33NM_130779Adcy3Adenylate cyclase 3
34NM_019285Adcy4Adenylate cyclase 4
35NM_022600Adcy5Adenylate cyclase 5
36XM_341661PrkacaProtein kinase, cAMP-dependent, catalytic, alpha
37NM_013181Prkar1aProtein kinase, cAMP dependent regulatory, type I, alpha
38XM_343046Prkar2bProtein kinase, cAMP dependent regulatory, type II beta
39NM_030871Pde1aPhosphodiesterase 1A, calmodulin-dependent
40NM_022710Pde1bPhosphodiesterase 1B
41NM_031079Pde2aPhosphodiesterase 2A, cGMP-stimulated
42NM_017337Pde3aPhosphodiesterase 3A
43NM_017229Pde3bPhosphodiesterase 3B
44NM_013101Pde4aPhosphodiesterase 4A
45NM_017031Pde4bPhosphodiesterase 4B
46XM_214325Dpde1Phosphodiesterase 4C, cAMP-specific
47NM_017032Pde4dPhosphodiesterase 4D
48NM_133584Pde5aPhosphodiesterase 5A, cGMP-specific
49NM_053688Pde6hPhosphodiesterase 6H, cGMP-specific, gamma
50XM_215540Pde7aPhosphodiesterase 7A
51NM_080894Pde7bPhosphodiesterase 7B
52NM_198767Pde8aPhosphodiesterase 8A
53NM_012580Hmox1Heme oxygenase 1
54NM_024387Hmox2Heme oxygenase 2
55NM_012611Nos2Nitric oxide synthase 2, inducible
56NM_021838Nos3Nitric oxide synthase 3, endothelial cell
57NM_013012Prkg2Protein kinase, cGMP-dependent, type II
58XM_219805Prkg1Protein kinase, cGMP-dependent, type 1
59XM_342524Plcb1Phospholipase C, beta 1
60NM_053478Plcb2Phospholipase C, beta 2
61NM_024353Plcb4Phospholipase C, beta 4
62NM_017318Ptk2bProtein tyrosine kinase 2 beta eta
63NM_033230Akt1v-akt murine thymoma viral oncogene homolog 1
64NM_017093Akt2Murine thymoma viral (v-akt) oncogene homolog 2
65NM_031575Akt3Thymoma viral proto-oncogene 3
66NM_031081Pdpk13-Phosphoinositide dependent protein kinase-1
67NM_053481Pik3cbPhosphatidylinositol 3-kinase, catalytic, b
68XM_574916Pik3caPhosphatidylinositol 3-kinase, catalytic, alpha
69NM_030992Pld1Phospholipase D1
70NM_033299Pld2Phospholipase D2
71XM_343975PrkcaProtein kinase C, alpha
72NM_012713Prkcb1Protein kinase C, beta 1
73NM_017171PrkceProtein kinase C, epsilon
74XM_234108PrkcmProtein kinase C, mu
75NM_133307PrkcdProtein kinase C, delta
76NM_022507PrkczProtein kinase C, zeta
77NM_053842Mapk1Mitogen activated protein kinase 1
78NM_017347Mapk3Mitogen activated protein kinase 3
79NM_031020Mapk14Mitogen activated protein kinase 14
80XM_341399Mapk8Mitogen-activated protein kinase 8
81NM_017322Mapk9Mitogen-activated protein kinase 9
82NM_022707PlnPhospholamban
83NM_058213Atp2a1Serca-1
84NM_017290Atp2a2Serca-2
85NM_017144Tnni3Troponin I type 3
86NM_012676Tnnt2Troponin T2
87NM_015981Camk2aCalcium/calmodulin-dependent protein kinase II, alpha
88NM_001220Camk2bCalcium/calmodulin-dependent protein kinase II, beta
89NM_012519Camk2dCalcium/calmodulin-dependent protein kinase II, delta
90NM_021696Serpinb2Serine (or cysteine) proteinase inhibitor
91NM_012620Serpine1Serine proteinase inhibitor or PAI-1
92NM_012889Vcam1Vascular cell adhesion molecule 1
93XM_342346Nfkb1Nuclear factor of kappa light chain gene
94NM_017174Pla2g5Phospholipase A2, group V
95NM_001005560Pla2g6Phospholipase A2, group VI
96NM_017176Pla2g10Phospholipase A2, group X
97NM_031585Pla2g1bPhospholipase A2, group IB
98NM_031598Pla2g2aPhospholipase A2, group IIA
99NM_133551Pla2g4aPhospholipase A2, group IVA
100NM_012520CatCatalase
101NM_017050Sod1Superoxide dismutase 1
102NM_017051Sod2Superoxide dismutase 2, mitochondrial
103NM_031513Il3Interleukin 3
104NM_012589Il6Interleukin 6
105NM_013110Il7Interleukin 7
106NM_013129Il15Interleukin 15
107NM_017059BaxBcl2-associated X protein
108NM_012762Casp1Caspase 1
109NM_012922Casp3Caspase 3
110NM_012675TnfTumor necrosis factor superfamily
111NM_021578Tgfb1Transforming growth factor, beta 1
112NM_031131Tgfb2Transforming growth factor, beta 2
113NM_133523Mmp3Matrix metallopeptidase 3
114NM_031055Mmp9Matrix metallopeptidase 9
115NM_053963Mmp12Matrix metallopeptidase 12
116XM_340799Csf2Colony stimulating factor 2
117NM_017104Csf3Colony stimulating factor 3
118NM_030845Cxcl1Chemokine (C-X-C motif) ligand 1
119NM_053647Cxcl2Chemokine (C-X-C motif) ligand 2
120NM_031970Hspb1Heat shock 27kDa protein 1
121N/APUC18PUC18 Plasmid DNA
122BlankBlankBlank
123N/APUC18PUC18 Plasmid DNA
124BlankBlankBlank
125BlankBlankBlank
126N/AAS1R2Artificial Sequence 1 Related 2
127N/AAS1R1Artificial Sequence 1 Related 1
128N/AAS1Artificial Sequence 1
129NM_013226Rpl32Ribosomal protein L32
130NM_017025LdhaLactate dehydrogenase A
131NM_012495AldoaAldolase A
132NM_012495AldoaAldolase A
133NM_017008GapdGlyceraldehyde-3-phosphate dehydrogenase
134NM_017008GapdGlyceraldehyde-3-phosphate dehydrogenase
135N/ABAS2CBiotinylated artificial sequence 2
136N/ABAS2CBiotinylated artificial sequence 2

Validation of Gene Expression Data by Quantitative Real-Time Reverse Transcription-Polymerase Chain Reaction.

First-strand cDNA was synthesized with 1 μg of RNA extracted using iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) according to the manufacturer's instructions. Quantitative real-time polymerase chain reaction (PCR) assay was performed in a Thermal Cycler (iCycler; Bio-Rad). In brief, 2 μL cDNA was amplified in a real-time PCR reaction containing 400 nmol of each primer and 5× SYBR Green SuperMix (Bio-Rad). All the reactions were performed in in triplicate in 96-well plates. A negative control containing all reagents but no cDNA template was included in all runs. Real-time PCR was performed following the thermal protocol: 95°C for 3 minutes to denature, 45 cycles of 95°C for 30 seconds for denaturing, and 60°C for 1 minute for annealing and extension. Primers were designed from sequences derived from the GenBank database using Primer 3 (provided by the Whitehead Institute, Cambridge, MA) and Oligo software (Operon Technologies Inc., Alameda, CA) and were purchased from Eurofins MWG (Ebersberg, Germany). Primer sequences were the following: Gαi2, tcaatgactcagccgcttac (forward) and gggatatagtcactctgtgctatgc (reverse); PDE2a, cgctgttgtccaattcctc (forward) and aggctcagcaaagcatcc (reverse); RGS2, cgctgttgtccaattcctc (forward) and aggctcagcaaagcatcc (reverse); Adcy3, 5′-gccttagagaagatgcaggt-3′ (forward) and 5′-aca gtc atc gag tac ttg gga ag-3′ (reverse); β actin, 5′-ccg cga gta caa cct tct-3′ (forward) and 5′-cgt cat cca tgg cga act-3′ (reverse); glyceraldehyde 3-phosphate dehydrogenase (GAPDH), 5′-tcaccaccatggagaaggc-3′ (forward) and 5′-gctaagcagttggtggtgca-3′ (reverse); and hypoxanthine guanine phosphoribosyl transferase (HPRT), 5′-ggt cca ttc cta tga ctg tag att tt-3′ (forward) and 5′-caatcaagacgttctttccagtt-3′ (reverse). β-Actin, GADPH, and HPRT were used as housekeeping genes. Data analyses were performed with the iQ Optical System Software (Bio-Rad). The comparative cycle threshold method (ΔΔCt), which compares the difference in cycle threshold values between groups, was used to obtain the relative fold change in gene expression, as previously described.15 Quantification of messenger RNA (mRNA) included normalization to β actin level. Furthermore, we used two additional housekeeping genes for the normalization: GAPDH and HPRT. No difference was found in the gene expression of these two housekeeping genes when compared to the β-actin normalization. Furthermore, the abundance of mRNA for these three genes remained stable regardless of the cardiac status (data not shown).The statistical analysis was performed using a t-test (SPSS software; SPSS Inc., Chicago, IL) and P values <0.05 were considered to be statistically significant.

Protein Extraction.

A total of 50 mg heart tissue was homogenized in hypotonic lysis buffer (20 mmol HEPES, 2 mmol EGTA, 10 mmol β-glycerophosphate, 1 mmol dithiothreitol, 2 mmol vanadate, 10 μg/mL phenylmethyl sulfonylfluoride, 1 μg/mL leupeptin, 5 μmol aprotinin). The homogenate was then centrifuged at 10,000 g for 10 minutes at 4°C. The supernatant was frozen in liquid nitrogen and stored at −80°C until use. Protein concentration was determined using Lowry's method, using bovine serum albumin (BSA) as the standard.

Western Blot Analysis.

Protein samples (30 μg) were separated by SDS-polyacrylamide gel electrophoresis using a 10% polyacrylamide gel, as previously described.16 Proteins separated in the gel were electroblotted onto nitrocellulose membrane (Hybond ECL; Amersham Biosciences, Amersham, UK) in blotting solution containing 48 mmol/L Tris, 39 mmol/L glycine, 0.037% SDS, and 20% vol/vol methanol for 3 hours at 100 V at 4°C, using a Transblot cell system (Elettrofor, Padova, Italy). The membranes were blocked overnight at 4°C in T-PBS containing phosphate-buffered saline, 0.05% vol/vol Tween and 5% BSA. Then, membranes were exposed to anti-Gαi2 (1:3000 dilution), anti-RGS2 (1:3000 dilution), anti-PDE2a (1:2000 dilution), anti-β1 (1:1000) and anti-β2 (1:1000) adrenergic receptors or anti-β actin (1:5000) primary antibody overnight at 4°C (Santa Cruz Biotechnology, Santa Cruz, CA). The membranes were washed (four times for 20 minutes each) in T-PBS and then incubated with horseradish peroxidase–conjugated secondary antibody (1:10,000). Detection was achieved using an enhanced chemiluminescence system (Pierce Biotechnology, Rockford, IL). The blots were scanned and quantified using a chemiluminescence molecular imaging system (Versa Doc 3000; Bio-Rad, Hercules, CA). The results were expressed relative to the control(s), on the same blot, which were defined as 100%, and by the protein of interest/β-actin densitometric ratio.

Statistical Analysis.

Data are presented as the mean ± standard error (SE). The statistical analysis was performed using a Student t-test for unpaired data. A P value <0.05 was accepted as statistically significant.

Results

Hemodynamic Studies.

Table 2 shows the baseline characteristics in cirrhotic rats and control rats. MAP and TPR were decreased whereas CO was increased in cirrhotic rats compared to control rats. No difference was observed between groups for HR, body weight, or cardiac mass index.

Table 2. Baseline Characteristics of Control and Cirrhotic Rats
CharacteristicControl RatsCirrhotic RatsP Value
  1. Values are means ± standard error of the mean. P values are related to a Student's t-test.

Body weight (g)549 ± 12540 ± 9Ns
Heart (mg)/body weight (g)3.1 ± 0.13.0 ± 0.2Ns
MAP (mmHg)125.5 ± 1.8108.5 ± 2.6*0.01
HR (beats/minute)396 ± 5404 ± 4Ns
CO (mL/minute)247.5 ± 5320.9 ± 4*0.01
TPR (mmHg × minute/mL)0.48 ± 0.040.31 ± 0.01*0.01

Cardiac Contractility.

Left ventricular contractility was not significantly different between cirrhotic and control rats in the absence of stimuli. However, analysis of the dose-response curves to isoproterenol (from 10−10 M to 10−6 M) revealed that the maximal response to the drug was significantly reduced in the cirrhotic rats in comparison to control rats (55.3 ± 5% versus 100 ± 2%, P < 0.01) whereas no differences were observed in the half-maximal response (EC50) values (−8.6 ± 0.2 versus −8.7 ± 0.7 Log M) (Fig. 1).

Figure 1.

Dose-response curves of isoproterenol-stimulated LVDP in isolated left ventricular heart from cirrhotic and control rats. The heart was mounted in a Langendorff apparatus. LVDP was calculated as the difference between systolic and diastolic values of left ventricular pressure, and the data is expressed as percentage of the maximal effect. *P < 0.01, n = 4.

Gene Expression Analysis.

Figure 2 shows two representative images of the membranes used to analyze the gene expression profile of one cirrhotic and one control rat. Some spots show a greater intensity in the cirrhotic sample. These spots correspond to the following proteins: regulator of G-protein signaling 2 (RGS2), G protein alpha–inhibiting subunit 2 (Gαi2), and phosphodiesterase 2a (PDE2a). The spot corresponding to adenylate cyclase 3 (Adcy3) shows diminished intensity. Table 3 reports the up-regulated genes with a fold change greater than 2.0 and down-regulated genes with a fold change less than 0.5.

Figure 2.

Microarray of the myocyte adrenergic pathway of left ventricular heart from cirrhotic and control rats. Analysis was performed on RNA extract from heart tissue using Oligo GEArray microarray containing 120 sequences associated with the myocyte adrenergic pathway and 16 housekeeping sequences (HKG), including negative and positive controls. Pooled RNA, obtained from six hearts from control rats, was used as the reference; it was compared with individual heart RNA from six cirrhotic rats. Two representative arrays from the pooled heart RNA of control rats (left panel) and from the heart RNA of a cirrhotic rat (right panel) are shown. Genes for which detectable changes in mRNA expression were observed in hearts of cirrhotic as compared with control rats are indicated by the arrows.

Table 3. Up-Regulated/Down-Regulated Genes in the Heart of CCL4-Treated Rats
IdentifierDescriptionFold Change (Versus Control)P Value
Guanine nucleotide alpha i2Gαi23.60.01
Regulator of G-protein signaling 2RGS22.70.01
Adenylate cyclase 3Adcy30.20.01
Phosphodiesterase 2APDE2a3.10.01
Plasminogen activator inhibitor-1PAI-16.80.01
CatalaseCat0.20.01
Superoxide dismutaseSOD-10.240.01

Furthermore, we found a significant increase in gene expression for plasminogen activator inhibitor-1 (PAI-1) and a significant reduction in gene expression for catalase (Cat) and superoxide dismutase (SOD-1) in cardiac tissue from CCl4-treated rats when compared to controls.

Real-Time PCR Analysis.

In order to confirm the results obtained using the microarray technique, the mRNA levels of Gαi2, PDE2a, RGS2, and Adcy3 were evaluated with real-time PCR. A relative quantification was achieved by normalizing the expression of the gene of interest to that of β-actin, a housekeeping gene, by the ΔΔCt method. As reported in Fig. 3, the expression of Gαi2, PDE2a, and RGS2 in the heart was augmented two-fold in cirrhotic rats as compared to control rats (P < 0.01). Meanwhile, the expression of ADCY3 in the heart tissue from cirrhotic rats was diminished by 60% (Fig. 3).

Figure 3.

Real-time PCR of PDE2a, Gαi2, RGS2, and Adcy3 in the left ventricle from cirrhotic (black columns) and control rats (white columns). The relative quantification was achieved by normalizing the expression of the gene of interest to β-actin by the ΔΔCt method. Error bars represent the standard deviation (n = 6 independent experiments, *P < 0.01).

Western Blot Analysis.

The protein expression levels of Gαi2, PDE2a, RGS2, and of β-adrenergic receptors (β1-AR and β2-AR) were evaluated by Western Blot analysis. Figure 4A,C shows representative immunoblots of the expression of Gαi2, PDE2a, RGS2, β1-AR, and β2-AR as well as β-actin, as a housekeeping protein. Figure 4B,D report the densitometric analysis of protein expression. Gαi2, PDE2a, and RGS2 were significantly increased in hearts of cirrhotic rats in comparison to those of normal rats (P < 0.01), while β1-AR and β2-AR protein expression were unchanged.

Figure 4.

Protein expression of PDE2a, Gαi2, RGS2, β1-AR, and β2-AR by western blot in hearts of cirrhotic (black columns) and control rats (white columns). The proteins were separated by electrophoresis and immunoblotted. The upper panels report the representative immunoblots of PDE2a, Gαi2, RGS2, and β1-AR and β2-AR (A, C). The lower panels report the densitometric analysis after normalization for β-actin (B, D). Data is expressed as PDE2a/β-actin, Gαi2/β-actin, RGS2/β-actin, β1-AR/β-actin, and β2-AR/β-actin and normalized to control, defined as 100%. *P < 0.01, n = 6.

Discussion

This study demonstrates that in the heart of rats with CCl4-induced experimental cirrhosis: (1) the β-adrenergic–dependent positive inotropic effect is markedly reduced and (2) the β-adrenergic signaling pathway is impaired due to an abnormal expression of Gαi2, PDE2a, RGS2, and Adcy3.

The contractile dysfunction, which was observed in our cirrhotic rats, is characterized by a reduction in the maximal contraction induced by isoproterenol, a β-adrenergic agonist, with unchanged EC50 value, suggesting that the affinity of the β-adrenergic receptor for its ligand is not altered, and that the blunting of the β-adrenergic effect may be caused either by reduced β-adrenergic density or by post-receptor mechanisms.

These results are in keeping with previous observations showing that in bile duct–ligated rats, the maximal stimulation with isoproterenol is blunted in the left ventricular papillary muscle3 and the chronotropic responses to isoproterenol are impaired in isolated atria.17 Several factors are thought to be involved in the development of cirrhotic cardiomyopathy, including: impaired cardiac excitation-contraction coupling, conductance abnormalities and abnormal plasma membrane fluidity, generation of cardiodepressant substances, a hyperdynamic circulation with changes in cardiac preload and afterload, and reduced β-adrenergic receptor signal transduction.3, 17, 18

Cardiac contractility is regulated primarily by the sympathetic nervous system through β-adrenergic receptors (βARs).14 Stimulation of βARs leads to activation of adenylyl cyclase and production of adenosine 3′,5′ monophosphate (cAMP). The cAMP-dependent protein kinase A (PKA) phosphorylates several substrates that are essential for cardiac contraction and relaxation, including the L-type Ca2+ channel, phospholamban, troponin I, and others. The βARs belong to the family of heptahelical receptors which couple with G proteins to activate several effectors, and are divided into three subtypes: β1, β2, and β3. Cardiomyocytes express all three subtypes of βARs. Stimulation of β1AR and β2AR increase heart rate and contractility, whereas stimulation of β3AR has a negative inotropic effect. β1AR and β2AR are coupled to the stimulatory G protein (Gs) to elevate cAMP, but β2AR also couples to the inhibitory G protein (Gi) which inhibits adenylyl cyclases, leading to the activation of downstream effectors.19 Therefore, to understand the underlying cellular mechanisms responsible for contractile dysfunction in cirrhosis, our approach was to investigate the gene expression pattern of the cardiomyocyte adrenergic pathway in CCl4-treated rats. We found that Gαi2, PDE2a, and RGS2 are overexpressed, while Adcy3 is down-expressed. As depicted schematically in Fig. 5, all these genes may be related to the β-adrenergic signaling pathway. Gαi2 is coupled to β2AR and inhibits adenylyl cyclases. An overexpression of Gαi2 could lower basal levels of adenylyl cyclase activity through inhibition of this enzyme and it could reduce the inotropic effect of β-adrenergic agonists. In isolated myocytes, the overexpression of Gαi2 by adenovirus-mediated gene transfer induced a severe attenuation of the β-adrenergic response to isoproterenol.20 Furthermore, heart failure in human and in animal models is characterized by a deterioration in cardiac contractility and a reduction of catecholamine responsiveness, which are associated with an increase in Gαi2 mRNA levels.21 Therefore, our findings indicate that the increased Gαi2 mRNA and protein expression in CCl4-treated rats contribute to an abnormal β-adrenergic signaling pathway and, consequently, to altered myocardial contractility. Nevertheless, our results are in contrast with those reported by Ma et al., who found a decrease in Gαi2 protein expression in cardiomyocytes from bile duct–ligated cirrhotic rats with ascites.9 At present, the different experimental model appears to be the only explanation for these discordant results.

Figure 5.

Mechanism of cardiac contraction stimulated by β-adrenergic receptors (β-AR). AR, adrenergic receptors; Adcy, adenylate cyclase; Gαs, stimulatory G protein; Gαi, inhibitory G protein; SR, sarcoplasmic reticulum; PLN, phospholamban; PKA, protein kinase A; RGS2, regulator of G-protein signaling 2; PDE2a, phosphodiesterase.

Another important aspect of the β-adrenergic pathway's regulation is that cAMP signal is abolished by hydrolysis to 5′-AMP. This inactivation is catalyzed by phosphodiesterases (PDEs), a superfamily of enzymes grouped into nine families. At least four different PDE families are expressed in the rat heart: PDE1, which is activated by Ca2+/calmodulin; PDE2, which is stimulated by cyclic guanosine monophosphate (cGMP); PDE3, which is inhibited by cGMP; and PDE4, which is cGMP-independent.22 Among all these PDEs, we found that the PDE2a isoform is overexpressed in rats with CCl4-induced cirrhosis. PDE2a is tightly associated to the adenylyl cyclase pool in the cytosol, directly controlling the synthesis of cAMP that is induced by β-adrenergic agonists.23 Some studies have demonstrated that PDE2a is up-regulated during cellular phenotype changes24 and by vascular endothelial growth factor (VEGF) during endothelial proliferation.25 In particular, VEGF specifically increases the PDE2 and PDE4 isoforms at the transcriptional level, whereas inhibitors of the PDE2 and PDE4 isoforms prevent VEGF-induced endothelial proliferation.26 VEGF is increased in mesenteric microvasculature from cirrhotic rats, contributing to the development of angiogenesis.27 Blockade of the VEGF signaling pathway inhibits this process and reverses portal hypertension and hyperdynamic circulation.28 Even in the absence of data on the effects of VEGF on cardiomyocytes in cirrhosis, it may be hypothesized that increased VEGF contributes to the increased expression of PDE2 and to the reduction of β-adrenergic signaling in the heart of cirrhotic rats.

We also found that RGS2 expression is increased in heart tissue from rats with CCl4-induced cirrhosis. RGS2 has emerged as a potentially critical regulator not only of vascular tone but also of cardiac contractility. In particular, it has been recently suggested that in cardiac tissue, RGS2 plays a major role in attenuating the stimulation of the Gαs subunit and in blunting the activity of adenylyl cyclase.29 This effect is mediated by acceleration of guanosine triphosphate hydrolysis by the Gα-subunit, resulting in the promotion of G-protein deactivation.30 Furthermore, our results are supported by the findings that, in failing human hearts, the level of RGS2 expression is increased in comparison to normal hearts,31 suggesting that alterations in RGS2 expression have the potential to significantly alter cardiac contractility.

The expression of the Adcy3 isoform was reduced in the hearts from our rats with CCl4-induced cirrhosis in comparison to control rats. Adcy is the family of enzymes responsible for the synthesis of cAMP from ATP, and is activated by stimulation of Gαs and inhibited by stimulation of Gαi.32 The gene expression profiling of the β-adrenergic pathway in the hearts of rats with CCl4-induced cirrhosis, showing unchanged expression of Gαs and increased expression of Gαi, suggests the latter as the cause of reduced Adcy activity. These results are in agreement with previous reports which found that cAMP production induced by Adcy is reduced in the cardiac tissue of cirrhotic rats.33 Thus, it may be hypothesized that the reduced expression of Adcy3 contributes to the reduced production of cAMP in the heart of cirrhotic rats.

Finally, we also observed overexpression of PAI-1 and a marked reduction of gene expression of catalase and superoxide dismutase in cardiac tissue from CCl4-treated rats, suggesting the presence of cardiac inflammation and a reduction of the antioxidant system when cirrhosis is present. These results are consistent with the hypothesis that an increase of proinflammatory cytokines and oxidative radicals are involved in the pathophysiologic process of heart failure in several clinical conditions.34

Our observations, therefore, confirm that cardiac contractility in cirrhosis is impaired early on and show the prominent role of a defect in the β-adrenergic pathway. These results could potentially lead to new gene targeting pharmacological strategies for the treatment of the cardiovascular complications of cirrhosis. The development of new therapeutic approaches seems even more important, taking into account that a drop in cardiac output has been recently claimed as an important event in the pathogenesis of the hepatorenal syndrome in patients with cirrhosis in the presence of ascites.35, 12

In conclusion, all these results indicate that, in rats with experimental cirrhosis, an abnormal gene expression of the β-adrenergic system at a postreceptor level contribute to the early pathogenesis of cirrhotic cardiomyopathy by reducing the production and accelerating the degradation of cAMP. A deeper knowledge of the molecular pathways which are involved in the pathogenesis of cirrhotic cardiomyopathy may represent the basis for the development of new pharmacological treatments.

Acknowledgements

The authors would like to gratefully acknowledge Ellen Murphy, Ph.D., for her critical reading and editing contribution to this article.

Ancillary