SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References

Circulating ferritin levels reflect body iron stores and are elevated with inflammation in chronic liver injury. H-ferritin exhibits a number of extrahepatic immunomodulatory properties, although its role in hepatic inflammation and fibrogenesis is unknown. Hepatic stellate cells respond to liver injury through production of proinflammatory mediators that drive fibrogenesis. A specific receptor for ferritin has been demonstrated on activated hepatic stellate cells, although its identity and its role in stellate cell activation is unclear. We propose that ferritin acts as a cytokine regulating proinflammatory function via nuclear factor kappaB (NF-κB)–regulated signaling in hepatic stellate cell biology. Hepatic stellate cells were treated with tissue ferritin and iron-free apoferritin, recombinant H-ferritins and L-ferritins, to assess the role of ferritin versus ferritin-bound iron in the production of proinflammatory mediators of fibrogenesis, and to determine whether signaling pathways act via a proposed H-ferritin endocytosis receptor, T cell immunoglobulin-domain and mucin-domain 2 (Tim-2). This study demonstrated that ferritin activates an iron-independent signaling cascade, involving Tim-2 independent phosphoinositide 3 (PI3)-kinase phosphorylation, protein kinase C zeta (PKCζ) and p44/p42-mitogen-activated protein kinase, resulting in p50/p65-NF-κB activation and markedly enhanced expression of hepatic proinflammatory mediators interleukin-1β (IL-1β), inducible nitric oxide synthase (iNOS), regulated on activation normal T cell expressed and secreted (RANTES), inhibitor of kappa Bα (IκBα), and intercellular adhesion molecule 1 (ICAM1). Conclusions:This study has defined the role of ferritin as a proinflammatory mediator of hepatic stellate cell biology acting through the NF-κB signaling pathway, and suggests a potential role in the inflammatory processes associated with hepatic fibrogenesis. (HEPATOLOGY 2009;49:887–900.)

Tissue ferritin is an important site for the physiological storage of iron in a nontoxic but biologically available form. The ferritin molecule comprises 24 subunits of two structurally distinct subunit types: the acidic, heavy or H-chain and the basic, light or L-chain. H-ferritin has been shown to regulate immune function, hematopoiesis, hepatocyte apoptosis, and cell differentiation.1 Ferritin is measured in the serum as an indicator of body iron stores and when grossly elevated is indicative of disease severity in patients with hemochromatosis.2 Circulating ferritin levels are also elevated in inflammation and are known to be regulated by proinflammatory cytokines.3 The mechanisms by which inflammatory cytokines regulate ferritin are the focus of much study1; however, the explanation for why and how circulating ferritin is elevated during inflammation and its potential role in chronic injury are unknown.

Chronic liver diseases, leading to fibrosis and cirrhosis, are commonly associated with inflammation and elevated serum ferritin.4, 5 Inflammatory mediators such as tumor necrosis factor alpha and interleukin-1 (IL-1) α contribute directly to elevated ferritin levels1 and the activation of the profibrogenic hepatic stellate cell (HSC)6. Previous studies have demonstrated a very-high-affinity, specific receptor for ferritin on activated HSC and have shown that the binding of ferritin to the HSC is dependent on H-ferritin.7, 8 Further studies demonstrated a role for ferritin in regulating the expression of α-smooth muscle actin (αSMA), a key marker of activated HSCs.8 However, the role of ferritin in regulating the processes associated with HSC activation and subsequent fibrogenesis have not been previously investigated. Hepatic fibrosis is characterized by the transformation of quiescent HSC to a myofibroblastic phenotype exhibiting proliferative and proinflammatory characteristics. HSCs also migrate to the site of hepatic injury in response to various chemokines and cytokines,6 and at the site of injury HSCs are directly responsible for the deposition of extracellular scar matrices such as collagens I, III, and IV, fibronectin, elastin, and laminin.6

The transcription factor nuclear factor kappa B (NF-κB), has been shown to play a crucial role in HSC survival and the wound-healing and inflammatory response of both parenchymal and nonparenchymal cells to hepatic injury.9 In addition, elevated hepatic NF-κB activation has been demonstrated to correlate with hepatic inflammation and fibrosis in human alcoholic liver disease.10 With this knowledge, together with the growing realization that ferritin mediates an array of cellular functions, it is not unreasonable to hypothesize that ferritin may play a role in the processes associated with HSC activation and the subsequent hepatic inflammatory response in chronic liver disease. In this study, we describe the role of ferritin as a proinflammatory mediator in activated rat HSC acting through the NF-κB signaling pathway. We show for the first time that ferritin activates an iron-independent signaling cascade involving phosphoinositol 3 kinase (PI3K), protein kinase C ζ (PKCζ), mitogen activated protein kinase/extracellular regulated kinase kinase (MEK)-1/2, and p44/p42 mitogen-activated protein kinase (MAPK), resulting in the activation of p50/p65 NF-κB and the significantly enhanced expression of hepatic proinflammatory and profibrogenic mediators IL-1β, inducible nitric oxide synthase (iNOS), regulated on activation normal T cell expressed and secreted (RANTES), inhibitor of kappa Bα (IκBα) and intercellular adhesion molecule 1 (ICAM1).

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References

Hepatic Stellate Cell Isolation.

Studies were performed with institutional Animal Ethics Committee approval and compliance with Australian regulatory guidelines. Rat HSCs were isolated from normal male Sprague-Dawley rats (600 ± 50 g) by sequential pronase/collagenase perfusion, cultured on plastic 12-well plates and grown in Medium 199 (Invitrogen) supplemented with 10% calf + 10% horse serum, 50 μg/mL ascorbic acid, and penicillin/streptomycin (100 U and 100 μg/mL, respectively), to induce an activated phenotype.11, 12 In addition, isolated HSCs were cultured on Teflon tissue culture inserts (Millipore) for 24 hours to maintain cells in a quiescent phenotype.11 Twenty-four hours before experimentation, HSCs were washed and cultured in serum-free M199 medium. HSCs were then treated with either the iron-replete tissue ferritins horse spleen or rat liver ferritin (termed “ferritin”) (Sigma-Aldrich), the iron-free recombinant human H-subunit ferritin (rHF) or recombinant human L-subunit ferritin (rLF), or with de-ironed ferritin (apoferritin). Recombinant ferritins rHF and rLF13 and apoferritin7, 8 were prepared as described. Five-day culture-activated HSCs were routinely used except where indicated.

Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis.

Whole cell protein extracts were prepared by lysis of HSC cultures in 1× sodium dodecyl sulfate (SDS) sample buffer (62.5 mM Tris HCl pH6.8, 2% wt/vol SDS, 10% glycerol, 50 mM dithiothreitol, 0.01% wt/vol bromophenol blue). Twenty-five microliters cell protein was subjected to SDS polyacrylamide gel electrophoresis and western blot using specific antibodies, with detection of antigen using the enhanced chemiluminescence system (GE), as described.11 Digital images of blots were captured using the FUJIFILM LAS3000 system and analyzed using FUJIFILM Multi Gauge V3.0 software.

Extraction of RNA from HSC.

Subconfluent (80%-90%) rat HSCs were washed with ice-cold phosphate-buffered saline and placed on ice before total RNA isolation using the RNeasy mini kit (Qiagen) as per the manufacturer's instructions. Total RNA was then treated with 1 μL RNA-qualified ribonuclease-free deoxyribonuclease I (1U/μL; Promega) per 1 μg total RNA for 30 minutes at 37°C to ensure complete removal of DNA contamination. Total RNA concentration and quality was estimated by spectrophotometry at 260 to 280 nm.

Quantitative Real-Time Reverse Transcription Polymerase Chain Reaction.

Three micrograms total RNA was used to generate the complementary DNA template using an oligodT15 primer and SuperScript III (Invitrogen). Real-time polymerase chain reaction (PCR) reactions were performed in a final volume of 15 μL with forward and reverse oligonucleotide primers (Table 1) used at a final concentration of 500 nM, using Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen) and the reaction profile as recommended by the manufacturer. All PCR reaction efficiencies were between 0.95 and 1.10. Melt curve analysis revealed the presence of a single product with a single melt signature. PCR was performed using an RG-3000 thermal cycler (Corbett Research Australia). Messenger RNA (mRNA) quantitation was achieved using the two standard curves method, with the fluorescence measurements of the unknown samples back-referenced to a standard curve relating concentration to fluorescence in arbitrary units. Messenger RNA levels were normalized to expression of the housekeeping gene Basic Transcription Factor 3 and expressed relative to untreated or control samples (presented as relative mRNA expression).

Table 1. Details of the Oligonucleotide Primers Used in the Real-Time PCR Assays
Rat GeneAccession NumberForward Primer SequenceReverse Primer Sequence
IL-1βNM_031512ATCCCAAACAATACCCAAAGAAGAATGGGGAACTGTGCAGACTCAAAC
RANTESNM_031116TGCCCACGTGAAGGAGTATTTTTATGGCGGTTCCTTCGAGTGACAA
iNOSNM_012611AGGGAGTGTTGTTCCAGGTGTCTGCAGGATGTCTTGAACG
ICAM1NM_012967TGATCATTGCGGGCTTCGTGGGCGGGGCTTGTACCTTGAGT
IκBαNM_001105720GCTGACCCTGGAAAATCTTGTCATCGTAGGGCAACTCATC
αSMANM_031004GGCCACTGCTGCTTCCTCTTCTTTGCCCGCCGACTCCATTC
Collagenα1(I)NM_053304GCCCAAACCCCAAGGAGAAAAAGGACATCAGGCGCAGGAAGG
BTF3NM_001008309TGGCAGCAAACACCTTCACCAGCTTCAGCCAGTCTCCTCAAAC

Nitric Oxide Determination.

Freshly isolated HSCs were cultured with ferritin (100 pM-100 nM). At days 3, 5, and 7, culture medium was harvested and at days 3 and 5 replaced with fresh medium containing ferritin. The concentration of the stable and nonvolatile breakdown product of nitric oxide (NOmath image nitrite) in the conditioned medium was then determined using the Griess Reagent System (Promega) as per the manufacturer's instructions.

Immunoprecipitation.

Day 5 culture-activated HSCs were incubated with rHF, rLF, or ferritin for 1 hour. Cells were then lyzed for immunoprecipitation studies as per manufacturer's instructions (Roche). Five hundred microliters cell lysate was precleared for 3 hours with 25 μL of the homogeneous protein-A-agarose suspension before immunoprecipitation with the rabbit anti-phospho-YXXM PI3K target motif (Cell Signaling Technology, 1:100) at 4°C overnight. Immunoprecipitate was washed and the resultant bead-antibody-protein complex resuspended in 1× SDS sample buffer and boiled for 3 minutes. Beads were pelleted by brief centrifugation and the supernatant resolved using 9% SDS polyacrylamide gel electrophoresis. After transfer to nitrocellulose, blots were probed with goat anti-mouse antibody to T cell immunoglobulin-domain and mucin-domain 2 (Tim-2) (R&D Systems, 1:1250 in 5% skim milk powder blocking buffer) overnight at 4°C. Primary antibodies were detected using a rabbit anti-goat immunoglobulin G antibody conjugated to horseradish peroxidase (Sigma, 1:1000 in 5% skim milk powder blocking buffer).

Electrophoretic Mobility Shift Assay.

The consensus double-stranded NF-κB binding site oligonucleotide (5′-AGT TGA GGG GAC TTT CCC AGG C-3′ Promega) was 5′-end-labeled with [γ-32P]adenosine triphosphate (3000 Ci/mmol/L; Amersham Pharmacia Biotech) using T4 polynucleotide kinase (New England Biolabs). Nuclear extracts were prepared as described14 and protein content determined using the Lowry method with Peterson's modification (Sigma). Electrophoretic mobility shift assay (EMSA) was performed as described,15 with protein/DNA complexes resolved on 8% non-denaturing polyacrylamide gel (37:5:1). For supershift analysis of NF-κB subunits, 2 μg anti-p50 and anti-p65 antiserum (Santa Cruz) were added after the initial oligonucleotide probe and nuclear extract reactions, and incubated at room temperature for 1 hour.

Statistical Analysis.

Data are presented as mean values of three to four separate experiments performed in duplicate ± standard error of the mean (SEM). Groups were compared using one-way analysis of variance (ANOVA) with Dunnett's multiple comparison post hoc test or the Student t test, where applicable using Prism 4.0 (GraphPad Software). P < 0.05 was considered statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References

Ferritin Activates NF-κB in Activated Rat HSCs.

Given the role NF-κB plays in mediating the inflammatory response of HSCs, the potential for ferritin to influence this inflammatory response was assessed by investigating its effect on NF-κB activity. Ferritin induced a significant dose-dependent increase in IkappaB kinase (IKK) α/β phosphorylation (Fig. 1A, B). An optimal ferritin concentration of 10 nM was chosen, giving maximal effects on IKK phosphorylation, with no effect on cell viability. HSCs incubated with 10 nM ferritin demonstrated a significant time-dependent, transient increase in IKKα/β phosphorylation with maximal expression of 4.3-fold after 120 minutes (Fig. 1C, D). The binding of nuclear extracts from HSC treated with ferritin to consensus NF-κB binding sites was analyzed by EMSA. NF-κB DNA-binding activity was increased within 5 minutes, peaking at 6 hours, returning to basal levels by 24 hours (Fig. 1E-G). EMSA supershift showed that NF-κB up-regulated by ferritin contained both p50 and p65 subunits (data not shown).

thumbnail image

Figure 1. Ferritin induces the phosphorylation of IKKα/β and activation of NF-κB in activated rat HSCs. Day 5 activated rat HSCs were cultured with increasing concentrations of ferritin (A, B) for 1 hour, or with 10 nM ferritin for 0 to 240 minutes (C, D) before IKKα/β phosphorylation was assessed by western blotting. Induction of IKKα/β phosphorylation by ferritin was both dose-dependent and time-dependent (ANOVA, P = 0.043 and P = 0.04; respectively). IKKα/β phosphorylation was maximally induced after 120 minutes' incubation with 10 nM ferritin (P < 0.05). Day 5 activated HSCs were also incubated with 10 nM ferritin for 0 to 24 hours and nuclear extracts subjected to EMSA and densitometric analysis (E-G). Ferritin rapidly induced a twofold increase in NF-κB DNA-binding activity in a time-dependent manner in short-term (60 minutes) exposure (F; ANOVA, P = 0.0059), peaking at 6 hours, and remained significantly elevated and time-dependent for up to 18 hours (G; ANOVA, P = 0.0007), before returning to control levels by 24 hours. One or two stars, indicate a significant difference from the control untreated cell population (P < 0.05 and P < 0.01, respectively). Data is expressed as the mean value of three separate experiments performed in duplicate ± SEM.

Download figure to PowerPoint

Ferritin Induces NF-κB–Responsive Proinflammatory Genes.

The consequences of ferritin-induced NF-κB DNA-binding activity were then assessed. Activated HSCs were treated with 0 to 100 nM ferritin for 0 to 240 min. Ferritin induced a significant dose-dependent (Fig. 2A) and time-dependent (Fig. 2B-E) increase in expression of NF-κB transcriptionally regulated genes known to play a role in mediating hepatic fibrogenesis,15–19 including ICAM1 (5.24 ± 0.72-fold; Fig. 2B), IκBα (3.54 ± 0.73-fold; Fig. 2C), iNOS (92.42 ± 37.20-fold; Fig. 2D), IL-1β (48.10 ± 8.30-fold; Fig. 2E), and RANTES (37.84 ± 14.32-fold; results not shown) after 2 to 4 hours. The effect of ferritin was most evident when using 5 to 100 nM ferritin (Fig. 2A). The sensitivity of activated HSCs to ferritin was reflected in the EC50 values (Table 2). Ferritin had no effect on the expression of HSC activation markers procollagen α1(I) or αSMA mRNA (results not shown).

thumbnail image

Figure 2. Incubation of activated rat HSCs with ferritin increased the transcription of NF-κB–responsive genes in both a time-dependent and dose-dependent manner. Quiescent and day 5 culture-activated rat HSC were treated with 1-100 nM ferritin for 3 hours before analysis of NF-κB-transcriptionally regulated gene expression by quantitative real-time PCR. Incubation of day 5 activated HSCs with increasing concentrations of ferritin (1-100 nM) for 3 hours enhanced the expression of ICAM1, IκBα, RANTES, and IL-1β mRNA in a dose-dependent manner (A, ANOVA; P < 0.001 for all genes) and subsequent half maximal effective concentration values can be see in Table 2. A time-dependent increase in the mRNA expression of ICAM1 (ANOVA, P < 0.0001; (B); IκBα (ANOVA, P = 0.0013; (C)); iNOS (ANOVA, P = 0.0079; (D)); and IL-1β (ANOVA, P < 0.0001; (E) was also observed after incubation of day 5 HSCs with 10 nM ferritin for between 15 and 240 minutes. The expression of RANTES, ICAM1, and IκBα in quiescent HSCs (cultured on Teflon tissue culture inserts for 24 hours), was not significantly altered by ferritin, although IL-1β expression was increased by 2.5-fold using 100 nM ferritin only (F). Pretreatment of day 5 activated HSCs with 10 μM Bay11-7082 (an inhibitor of cytokine-induced IκBα phosphorylation) for 1 hour before the incubation of HSCs with 10 nM ferritin in the continued presence of Bay11-7082 was able to completely block (approximately 100%) the increased mRNA expression of IL-1β induced by ferritin (P < 0.001, G). Two stars and three stars indicate a significant difference of the indicated mean values (P < 0.01 and P < 0.001, respectively). Data are expressed as a mean value of three separate experiments performed in duplicate ± SEM.

Download figure to PowerPoint

Table 2. Calculated EC50 Values for the Dose-Dependent Effects of Ferritin on Activated Rat HSC
GeneFerritin EC50(nM)
ICAM13.84
IκBα3.80
RANTES27.54
IL-1β10.16

Teflon-cultured (quiescent) HSCs were incubated with ferritin (1-100 nM) for 3 hours. Ferritin had no effect on RANTES, ICAM1, or IκBα expression, and only 100 nM ferritin induced IL-1β (2.5-fold; Fig. 2F). αSMA and procollagen α1(I) expression also were unaffected (data not shown).

To further confirm the role of NF-κB in ferritin-induced signaling in activated HSCs, IκBα phosphorylation (therefore NF-κB activation) was blocked using the specific inhibitor Bay11-7082,20 and the ferritin-induced expression of IL-1β mRNA assessed. IL-1β transcription stimulated by 10 nM ferritin was completely inhibited by Bay11-7082 (Fig. 2G), confirming that ferritin induced IL-1β via IκBα phosphorylation and NF-κB activation.

Ferritin Induces ICAM1, IκBα, and Nitric Oxide Production.

Ten nanomolar ferritin induced a significant time-dependent increase in ICAM1 protein expression in activated HSCs after 24 hours (1.52 ± 0.11-fold) and 48 hours (1.93 ± 0.15-fold) (Fig. 3A, B). IκBα protein levels were also increased by ferritin (Fig. 3A). Nitric oxide produced by ferritin-treated HSCs was assessed as a functional consequence of iNOS mRNA induction. Ferritin induced a significant dose-dependent increase in nitric oxide production after 3 days and 5 days, with maximal increases of 3.22 ± 0.78 and 4.78 ± 1.36-fold, respectively (Fig. 3C). After 7 days, nitric oxide production returned to basal levels (Fig. 3C).

thumbnail image

Figure 3. Incubation of activated rat HSCs with ferritin induces the expression of ICAM1 and IκBα protein and the production of nitric oxide. Day 5 culture-activated HSCs were incubated with 10 nM ferritin for 0 to 48 hours, with culture medium including ferritin replenished after 24 hours. Whole cell protein extracts were subjected to western blot, analyzing the expression of ICAM1 and IκBα protein (A). There was a significant time-dependent increase in the expression of ICAM1 protein (ANOVA, P = 0.0001; B). IκBα was also increased in a time-dependent manner, although this did not reach statistical significance. Additionally, HSCs were culture-activated on plastic in the presence of ferritin (0-100 nM) for up to 7 days (C), with culture media containing ferritin replenished at days 3 and 5. At days 3, 5, and 7, the concentration of the stable nitric oxide breakdown product, nitrite (NOmath image) was determined using the Griess Reagent system (C). Ferritin induced a significant dose-dependent increase in nitric oxide production at day 3 (ANOVA P = 0.0174) and day 5 (ANOVA P = 0.0052), returning to basal levels after 7 days. One star and two stars indicate a significant difference of the indicated mean values from control untreated samples (P < 0.05 and P < 0.01, respectively). Data shown here are expressed as mean values ± SEM derived from four separate experiments performed in duplicate.

Download figure to PowerPoint

Rat HSC Express Tim-2.

Recent data suggest that Tim-2 acts as a receptor for H-ferritin endocytosis in B cells,21 although its role in initiating cell signaling is not known. We investigated the expression of Tim-2 in HSCs. Western blot revealed two Tim-2 bands in quiescent HSCs (Fig. 4A). Tim-2 expression (both bands) was unchanged with time as HSCs became activated (Fig. 4A, B), as evidenced by the upregulation of αSMA, a marker of HSC activation (Fig. 4A).

thumbnail image

Figure 4. Rat HSCs express Tim-2 from quiescence to activation. Rat HSCs were isolated and culture-activated in plastic tissue culture wells. At regular 24-hour intervals up to and including day 6 post-isolation, whole cell proteins were extracted and analysed for the presence of Tim-2. Anti-Tim-2 antibody identified two bands – the upper band was the same 48 kDa molecular weight (arrow) of Tim-2 as seen in immunoprecipitation experiments outlined in Fig. 5C, the lower band potentially representing a molecular weight variant (A). Both protein bands were quantitated, and the combined result for Tim-2 protein was expressed relative to time in culture (B). Tim-2 expression was demonstrated in quiescent HSCs (day 0-1), and expression levels remained unchanged over the duration of HSC activation, indicated by increasing expression of αSMA. This result did not change when upper and lower Tim-2 bands were analyzed separately (data not shown). Data are expressed as mean value of four separate experiments performed in duplicate ± SEM.

Download figure to PowerPoint

thumbnail image

Figure 5. Ferritin activates PI3K in activated rat HSCs. Day 5 culture-activated HSCs were incubated with 10 nM ferritin for 0 to 240 minutes before whole cell protein was extracted and subjected to western blotting. YXXM motif phosphorylation was assessed using polyclonal rabbit antibodies raised specifically to the phosphorylated Tyr residue in the YXXM motif (A). Ferritin induced a time-dependent increase in the level of YXXM phosphorylation (ANOVA, P = 0.0014; (B), that is, all proteins with phosphorylated-YXXM-motif (PI3K target site), peaking at 120 minutes. To assess Tim-2 phosphorylation in response to ferritin, activated HSCs were treated with 10 nM ferritin, iron-free recombinant H-ferritin (rHF), or iron-free recombinant L-ferritin (rLF) for 1 hour, whole cell protein extracts were then subjected to immunoprecipitation using an anti-phospho-YXXM PI3K target motif. After SDS-polyacrylamide gel electrophoresis resolution and transfer, proteins were probed for the presence of Tim-2 using a mouse anti-Tim-2 antibody (C). None of the ferritin molecules used had any effect on the levels of Tim-2 phosphorylation, suggesting that Tim-2 acting through PI3K is not involved in the signaling pathway elicited by ferritin in HSCs. Day 5 culture-activated HSCs were also incubated with 100 nM wortmannin (Wort), a PI3K inhibitor, for 1 hour before treatment with 10 nM ferritin for 3 hours with continued wortmannin culture medium presence; transcription of the IL-1β gene was then assessed using quantitative PCR (D). One hundred nanomolar wortmannin significantly blocked the ferritin induced of IL-1β gene transcription by 80%. Two stars and three stars indicate a significant difference of the indicated mean values or from control untreated samples (P < 0.01 and P < 0.001, respectively). Data are expressed as mean value of three separate experiments performed in duplicate ± SEM.

Download figure to PowerPoint

PI3K is Activated by Ferritin.

Contained within the Tim-2 amino acid sequence is a consensus PI3K target phosphorylation motif (YXXM).21 Thus, we investigated the potential role of Tim-2 and PI3K in mediating the NF-κB-transcriptional events triggered by ferritin. Activated HSCs were incubated with 10 nM ferritin for 0 to 240 minutes before cell protein extracts were subjected to western blot (Fig. 5A). A significant relationship between YXXM phosphorylation (that is, all proteins with phospho-YXXM-motif, PI3K target site) and ferritin exposure time was observed with a maximal increase of 2.87 ± 0.31-fold at 120 minutes (Fig. 5B). rHF and rLF induced similar increases in YXXM phosphorylation (data not shown). To assess whether Tim-2 was one of these phosphorylated proteins, we immunoprecipitated all proteins that had undergone YXXM phosphorylation in response to treatment with either ferritin, rHF, or rLF and probed for Tim-2 (Fig. 5C). No difference in phospho-Tim-2 expression was observed 1 hour after treatment of activated HSC with 10 nM ferritin, rHF, or rLF. This suggests that Tim-2, acting through PI3K, is not involved in ferritin-induced signaling. To further assess the role of PI3K in ferritin-induced NF-κB gene transcription, the PI3K inhibitor wortmannin was used.22 Wortmannin (100 nM) alone had no effect on IL-1β mRNA expression; however, wortmannin significantly inhibited the ferritin-induced expression of IL-1β by 78.4% (Fig. 5D).

Ferritin Is a PKCζ Activator.

PKCζ, a downstream target of PI3K, is intimately involved in NF-κB activation.23 Because ferritin activates both PI3K and NF-κB, we investigated the role of PKCζ in the ferritin-induced signaling events. Ferritin induced the time-dependent phosphorylation of PKCζ (Fig. 6A, B). Significant enhancement of PKCζ phosphorylation (4.19 ± 0.24-fold) by ferritin was evident after 30 minutes, which increased until 120 minutes (5.78 ± 1.0-fold). Using a pseudosubstrate inhibitor of PKCζ (100 μM), we attempted to block the effects of ferritin on IL-1β gene transcription (Fig. 6C). Two variants of the PKCζ pseudosubstrate inhibitor were used; the first was myristoylated (M) to allow cell entry, the second non-myristoylated (NM; in other words, non–cell permeable), serving as a control (Fig. 6C). The M-PKCζ pseudosubstrate inhibitor completely abolished the effects of ferritin on IL-1β transcription; conversely, the NM-PKCζ pseudosubstrate inhibitor control had no effect. To further assess the role of ferritin as a PKCζ activator, activated HSCs were exposed to ferritin (10 fM-100 nM) for up to 7 days. Long-term treatment with PKC activators has been shown to cause PKC down-regulation in fibroblasts.24 Ferritin induced a dose-dependent decrease in expression of the 80-kDa, or phosphorylated form of PKCζ, becoming significant at 10 pM (51.5 ± 8.0% decrease), with expression undetectable using 100 nM ferritin (Fig. 6D). This provides further strong support for the role of ferritin as a PKCζ activator in HSC biology.

thumbnail image

Figure 6. PKCζ is activated by ferritin in activated rat HSCs. Day 5 culture-activated HSCs were incubated with 10 nM ferritin for 0 to 120 minutes. Whole cell protein extracts were isolated and subjected to western blotting (A). Ferritin elicited a time-dependent increase in the level of PKCζ phosphorylation (ANOVA, P = 0.0042, B), with a sixfold elevation evident after 120 minutes. To block potential ferritin-induced signaling events, activated HSCs were also incubated with 100 μM myristoyl (M, cell permeable) or non-myristoyl (NM, non-cell permeable) PKCζ pseudosubstrate inhibitor for 1 hour before treatment with 10 nM ferritin and for 3 hours in the continued presence of the M or NM PKCζ pseudosubstrate inhibitor, to assess the role of PKCζ in ferritin-induced IL-1β gene expression (C). M- but not NM-PKCζ pseudosubstrate inhibitor completely abolished the effects of ferritin on IL-1β gene expression. To assess the long-term effects of ferritin on HSCs, freshly isolated rat HSCs were culture-activated on plastic and treated with ferritin (10 fM–100 nM) for 7 days. Culture medium containing ferritin was replenished at days 3 and 5. Whole cell protein extracts were isolated at day 7 and subjected to western blot for PKCζ (D). The 80-kDa (phosphorylated) PKCζ subunit was observed to undergo a dose-dependent decrease in expression (ANOVA, P = 0.0002), whereas the expression of the 66-kDa subtype remained unchanged. One star and two stars indicate a significant difference of the indicated mean values or from control untreated samples (P < 0.05 and P < 0.01). Data are expressed as mean value of four separate experiments performed in duplicate ± SEM.

Download figure to PowerPoint

Ferritin Induces the Phosphorylation of MAPK.

MAPK is a downstream target of PKCζ and an activator of NF-κB25; thus, we investigated the role of MAPK in ferritin-induced signaling. Treatment of day 5 activated HSCs with ferritin (10 pM-100 nM) for 1hour caused a significant dose-dependent increase in MAPK phosphorylation (Fig. 7A, B). Maximal MAPK p42/p44 phosphorylation was observed using 100 nM ferritin (7.7 ± 0.62 and 16.9 ± 2.65-fold, respectively). Fig. 7C and D demonstrate the time-dependent increase in MAPK p42/p44 phosphorylation after ferritin treatment. Maximal expression was observed after 60 minutes (2.23 ± 0.41 and 2.83 ± 0.35-fold, respectively), returning to basal levels after 4 hours (Fig. 7C, D). Similar effects were observed using rHF and rLF (data not shown). To further assess the role of MAPK in ferritin-induced signaling, HSCs were treated with 10 nM ferritin + U0126 (10 μM, 30 minutes), a selective inhibitor of MEK1/2 (a known activator of MAPK), and IL-1β expression assessed. Ferritin-induced IL-1β expression was inhibited by 70 ± 7.5% (Fig. 7E), implicating both MEK1/2 and MAPK in ferritin-induced signaling.

thumbnail image

Figure 7. MAPK (p42/p44) is activated by ferritin in activated rat HSCs. Day 5 culture-activated HSCs were incubated with either increasing concentrations of ferritin (10 pM–100 nM) for 1 hour (A, B), or 10 nM ferritin for 0 to 240 minutes (C, D). Reactions were terminated and whole cell protein extracted and subsequently subjected to western blotting to identify changes in the phosphorylation status of p42/p44. Both p42 and p44 were significantly phosphorylated in a dose-dependent manner (ANOVA; P < 0.0001 and P < 0.0001, respectively; B), with peak phosphorylation occurring between 10 and 100 nM. In addition both p42 and p44 were significantly phosphorylated in a time-dependent manner (ANOVA; P = 0.0447 and P = 0.0016, respectively D), with peak phosphorylation occurring between 60 and 120 minutes. U0126, an inhibitor of MAPK/extracellular signal-regulated kinase kinase (MEK)-1/2, was used to inhibit potential signalling via MAPK phosphorylation. Day 5 culture-activated HSCs were preincubated with 10 μM U0126 for 30 minutes before incubation with 10 nM ferritin in the continued presence of U0126. U0126 significantly inhibited the ferritin-induced expression of IL-1β mRNA, implicating a role for MEK1/2 and MAPK in the signalling pathway induced by ferritin (E). Two stars and three stars indicate a significant difference from control untreated HSCs (P < 0.01 and P < 0.001, respectively) or indicated mean values. Data are expressed as mean value of three separate experiments performed in duplicate ± SEM.

Download figure to PowerPoint

Ferritin Induces NF-κB Activation and IL-1β Expression via an Iron-Independent Pathway.

Because tissue ferritin stores iron, it is possible that the NF-κB transcriptional events elicited by ferritin may be, in part, attributable to iron-induced oxidant stress. We used de-ironed ferritin (apoferritin) and iron-free rHF and rLF to assess their effect on NF-κB DNA-binding activity and IL-1β gene transcription. Treatment of activated HSCs with apoferritin, rHF, or rLF caused a significant increase in NF-κB DNA-binding activity (Fig. 8A). rHF and rLF also induced a significant time-dependent increase in IL-1β expression (Fig. 8B). rHF induced a 221.7 ± 51.2-fold increase in IL-1β; significantly greater than rLF (69.9 ± 17.7-fold) (Fig. 8B). In addition, iron chelators of both Fe2+ (dipyridyl) and Fe3+ (deferoxamine) were used to block the potential effects of iron contained within tissue ferritin. Neither dipyridyl (Fig. 8C) nor deferoxamine (Fig. 8D) had any effect on IL-1β gene expression induced by ferritin. Taken together, these data provide further evidence of a ferritin-induced signaling pathway resulting in NF-κB-regulated gene expression that is independent of iron.

thumbnail image

Figure 8. Iron does not mediate the effects of ferritin on activated rat HSCs. Day 5 culture-activated HSCs were incubated with 10 nM apoferritin, iron-free recombinant H-ferritin (rHF), or iron-free recombinant L-ferritin (rLF) for 0 to 2 hours. Nuclear extracts were then harvested and assessed for NF-κB DNA-binding activity using EMSA, with densitometric analysis of EMSA blots analyzed and quantitated (A). All three iron-free ferritin molecules induced significant NF-κB DNA-binding activity in a time-dependent manner (ANOVA: P = 0.0112, apoferritin; P = 0.0017, rHF and P = 0.0242, rLF), with rHF inducing the most rapid and significant changes in NF-κB activity. To determine the effects of iron-free 10 nM rHF or rLF on day 5 activated HSCs, cells were incubated with either rHF or rLF for 0 to 4 hours before total RNA was isolated and analyzed for changes in IL-1β gene transcription using quantitative PCR (B). Both rHF and rLF caused a significant elevation in IL-1β mRNA expression in a time-dependent manner (ANOVA, P = 0.05 and P = 0.028, respectively), with the effect of rHF being significantly greater than that of rLF at 2 hours. To further test the role of iron in ferritin-induced gene expression, day 5 culture-activated HSCs were incubated with the Fe2+ chelating agent dipyridyl (DP, 250 μM; C) or the Fe3+ chelating agent deferoxamine (DFO, 200 μM; D) for 1 hour before treatment with 10 nM ferritin for 3 hours in the continued presence of either dipyridyl or deferoxamine. Total RNA was harvested and analyzed for the expression of IL-1β using quantitative PCR. The chelation of iron by either dipyridyl or deferoxamine had no influence on the ferritin-induced transcription of the IL-1β gene. One star, two stars and three stars indicate a significant difference of the indicated mean values or from control untreated samples (P < 0.05, P < 0.01, and P < 0.0001, respectively). Data are expressed as mean value of three separate experiments performed in duplicate ± SEM.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References

The association between inflammation and raised circulating ferritin in chronic liver injury is well established; however, rather than simply being a consequence of inflammation, elevated ferritin levels may play a role in mediating the processes associated with hepatic injury. This study is the first to demonstrate the potential role of ferritin as a cytokine-like signaling molecule in the liver rather than a passive indictor of iron stores or inflammation. L chain-rich tissue ferritin, recombinant H-chain ferritin, and recombinant L-chain ferritin all initiated the activation of a signaling pathway in rat HSCs, independent of iron, involving PI3K, PKCζ, MEK1/2, MAPK, IKKα/β and NF-κB, within minutes resulting in the upregulation of proinflammatory mediators associated with HSC activation and hepatic fibrogenesis (Fig. 9). Although this study did not directly assess the role of serum ferritin in HSC activation, serum ferritin comprises glycosylated L-ferritin, and our data show a clear role for L-ferritin as a proinflammatory mediator in HSC biology. Although this suggests that serum ferritin may have similar effects to tissue-derived L-ferritin, further investigation is required to assess the role of serum ferritin on this signaling pathway.

thumbnail image

Figure 9. Proposed hypothetical ferritin-induced signaling pathway in activated HSCs. Ferritin binds to an unknown receptor expressed by activated rat HSC s and stimulates a signaling cascade that results in the activation of NF-κB and subsequently enhances the expression of a number of NF-κB-responsive genes including, IL-1β, IκBα, ICAM1, RANTES, and iNOS. Data presented in this study implicate PI3K, PCKζ, MEK1/2, MAPK, and IKKα/β in this signaling cascade. The observed up-regulation in gene expression and phosphorylation of the signaling intermediates occurs independently of iron. Dotted arrows indicate the hypothesized sequence of signaling events. IKK, inhibitor kappa B kinase α/β MAPK, mitogen-activated protein kinase; MEK1/2, MAPK extracellular signal-regulated kinase 1/2; PI3K, phosphatidylinositol 3 kinase; PKCζ, protein kinase C ζ.

Download figure to PowerPoint

While the precise mechanisms of ferritin release and the functions of secreted ferritins in the circulation are unclear, tissue ferritin is known to be released from reticuloendothelial cells after erythrophagocytosis of senescent red blood cells.26 Ferritin is present in the circulation either via secretion in the form of serum ferritin or through release from damaged cells in the form of tissue ferritin.27 In the liver, ferritin released by damaged hepatocytes or Kupffer cells is thought to contribute considerably to the local ferritin concentration27 and may have a direct paracrine effect on cells in close proximity. In iron overload diseases such as hereditary hemochromatosis, circulating ferritin levels are substantially elevated and can range in concentration from 200 to 6500 μg /L (0.5-15 nM).28 Circulating ferritins are also elevated independently of iron overload in conditions of inflammation, alcohol abuse, liver necrosis, or in patients with non-alcoholic fatty steatohepatitis (NASH) or diabetes mellitus.29–31 Indeed, ferritin may play a role in an array of inflammatory/fibrogenic states associated with infection in organs such as the heart, lungs, kidney, and pancreas, all of which have cell types similar to HSC that mediate the fibrogenic response to injury.2, 3

Activated rat HSCs were used as a model to investigate the role of ferritin as a mediator of inflammation because they express a specific binding site for ferritin7 and play a key role in the liver's response to injury.6 To test the hypothesis that ferritin exhibits cytokine-like activity, we selected NF-κB as its potential mediator because it is a common target for proinflammatory factors and is known to regulate both HSC survival and the expression of proinflammatory factors associated with fibrogenesis.15, 16, 32 In this study we have shown that ferritin induces the activation of NF-κB in HSCs through PI3K, PKCζ, MEK1/2, MAPK, and IKK, leading to the enhanced transcription of the NF-κB–responsive genes ICAM1, IκBα, iNOS, RANTES, and IL-1β. The rapid induction of these genes suggests the direct effect of ferritin on a second messenger system. Considerable elevations in iNOS, RANTES, and IL-1β were observed (>40-fold), and all have a well-documented role in inflammation and fibrosis.19, 33, 34 Their induction by ferritin lends considerable support to the hypothesis that ferritin acts as a proinflammatory mediator. Quiescent HSCs also were assessed for their ability to respond to ferritin; however, no effects were observed on IκBα, RANTES, or ICAM1, with only a small 2.5-fold increase seen in IL-1β expression using 100 nM ferritin. These findings support earlier studies suggesting that quiescent HSCs do not express a specific receptor for ferritin7, 8 and also add considerable weight to our hypothesis that ferritin induces a specific receptor-mediated signaling event in activated HSCs. To further substantiate these observations, we used a well-characterized inhibitor of cytokine-induced IκBα phosphorylation, Bay11-7082.20, 35 This compound completely blocked the ferritin-induced expression of the NF-κB-responsive gene IL-1β. Taken together, these results provide strong evidence that tissue ferritin activates NF-κB, and the inhibitory effects of Bay11-7082 suggest that the effects of ferritin may be cytokine-like rather than attributable to ferritin-bound iron. ICAM1 protein expression and nitric oxide production were also significantly elevated in rat HSCs treated with ferritin, suggesting that the transcriptional changes observed result in actual changes in cellular protein. The degree of iNOS gene expression induction would suggest that greater production of nitric oxide might have been expected. This inconsistency may in part be attributable to the potential instability of the iNOS mRNA or rapid iNOS protein turnover.

The identity of the HSC ferritin receptor is unknown. Tim-2 has been proposed as a cell surface receptor for H-ferritin endocytosis in recent studies using B cells.21 Two additional proteins, H-Kininogen36 and the granulocyte colony-stimulating factor receptor,37 have both been shown to interact with H-ferritin in different cell systems, although the functional consequences are unclear. Because previous studies have shown H-ferritin–dependent binding of tissue ferritin to activated HSCs, followed by internalization,7 it is possible Tim-2 may play a role in the ferritin-induced changes observed in activated HSCs. Tim-2 expression was demonstrated in quiescent HSC with expression unchanged during HSC activation. The observation that Tim-2 is expressed in quiescent HSC and our observation that quiescent HSC do not respond to ferritin suggests that Tim-2 may not be responsible for mediating the effects of ferritin on HSCs. Contained within the intracellular amino acid sequence of Tim-2 are potential tyrosine kinase and PI3K target sites thought to mediate the intracellular signaling of another Tim-2 ligand, Semaphorin 4A.38 Thus, we investigated the potential for PI3K to mediate the effects of ferritin, iron-free rHF, and rLF. Ferritin induced the phosphorylation of the tyrosine amino acid in the consensus PI3K target motif YXXM. However, when all YXXM phosphoproteins were immunoprecipitated, no ferritin molecule had any effect on Tim-2 protein YXXM phosphorylation. Although this does not discount a role for Tim-2 in mediating the effects of ferritin, it suggests that it is not through phosphorylation of the Tim-2 YXXM motif by PI3K. In addition, the steady-state expression of Tim-2 protein is at odds with earlier observations suggesting that the ferritin receptor is only present on activated, not quiescent HSCs7 and that ferritin receptor expression increases with culture activation.8 This fact, coupled with our observation that Tim-2–expressing quiescent HSCs do not respond to ferritin, suggest that Tim-2 is not responsible for eliciting the ferritin-induced signaling events demonstrated in this study. Tim-2 may indeed represent the “scavenger ferritin receptor” described by Moss et al.,39 and thus it is likely that activated HSC express another, as yet unidentified, ferritin receptor.

Because the target motif of PI3K was phosphorylated in response to ferritin, we investigated the role of PI3K in ferritin-induced signaling by using the inhibitor wortmannin.22 Wortmannin inhibited ferritin-induced IL-1β transcription by approximately 80%, but even at the highest concentration was unable to completely abolish IL-1β expression. Thus, ferritin appears to function in activated HSCs via PI3K, although a non-PI3K ferritin-dependent pathway (possibly tyrosine kinase-dependent) also may exist.

The results of this study also implicate the signaling intermediate PKCζ in the ferritin-induced signaling cascade. Our data demonstrated a rapid, time-dependent increase in PKCζ phosphorylation by ferritin and the induction of IL-1β transcription by ferritin was highly sensitive to the pseudosubstrate inhibitor of PKCζ. Long-term (7 days) incubation of HSCs with ferritin resulted in marked down-regulation of PKCζ expression, an event that was exquisitely sensitive to ferritin, with significant decreases noted with 10 pM ferritin. PKCζ is an atypical PKC and is known to be crucial for cell survival. It is also often constitutively active and has been shown to be an upstream regulator of NF-κB activity.23 Chronic (long-term) activation of PKC is known to lead to the depletion of cellular levels of PKC in other cell types via a desensitization mechanism.24 Taken together, these results suggest that PKCζ plays an integral role in ferritin-induced signaling and indeed that ferritin acts as a PKC-ζ activator in HSC biology.

This study also demonstrated that ferritin activated another downstream signaling target, MAPK (p42/p44). As previously mentioned, MAPK is a known target of PKCζ and has been shown to regulate IKK phosphorylation and the activity of NF-κB.25 Our results clearly show that tissue ferritin induced the rapid phosphorylation of MAPK in a time-dependent and dose-dependent manner similar to that observed for IKKα/β, PI3K, and PKCζ. We were also able to demonstrate the susceptibility of ferritin-induced IL-1β expression to the MEK1/2 (and hence MAPK) inhibitor U0126. The ability of ferritin to induce these changes in such a rapid manner lends further support to the proposal that ferritin exhibits cytokine-like activity mediated by a receptor coupled to a signaling cascade.

Because we have proposed that ferritin influences proinflammatory events in the HSC activation cascade via cytokine-like signal transduction, it was important to rule out the potential role of ferritin-bound iron. Iron is a potent mediator of oxidant stress,40 with reactive oxygen species known to play a role in NF-κB activation.9 Iron-free ferritin molecules rHF, rLF (a serum ferritin analog), and apoferritin were all shown to induce the time-dependent activation of NF-κB, and both rHF and rLF caused marked up-regulation of IL-1β gene expression. Interestingly, rHF was considerably more effective, possibly because of the expression of a known H-chain–dependent binding site on activated HSC.7 In addition, these iron-free ferritin molecules activated IKKα/β, PI3K, and MAPK (results not shown). As further evidence of an iron-independent ferritin signaling pathway, neither iron chelator deferoxamine (Fe3+) nor dipyridyl (Fe2+) had any inhibitory effect on ferritin-induced IL-1β transcription. These chelators block cellular uptake of iron (bound to transferrin) and endosomal release, respectively.41 Thus, use of these chelating agents removes all available unbound cellular iron, preventing the potential generation of oxidant stress, thus ruling out iron as a mediator of ferritin-induced signaling in HSCs.

In conclusion, previous studies have shown a role for ferritin in mediating immune function, hematopoiesis, hepatocyte apoptosis, and cell differentiation, but no studies have defined the potential mechanism. Our study is the first to provide strong evidence that ferritin exhibits iron-independent, cytokine-like activity in activated HSCs, inducing a signaling cascade that up-regulates expression of proinflammatory mediators associated with hepatic fibrogenesis. Although this study has demonstrated the expression of an H-ferritin endocytotic receptor, Tim-2, its role as a potential mediator of ferritin-induced HSC signaling is unclear. The role of ferritin as a modulator of hepatic/extrahepatic inflammation warrants further investigation.

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References
  • 1
    Recalcati S, Invernizzi P, Arosio P, Cairo G. New functions for an iron storage protein: The role of ferritin in immunity and autoimmunity. J Autoimmun 2008; 30: 8489.
  • 2
    Waalen J, Felitti VJ, Gelbart T, Beutler E. Screening for hemochromatosis by measuring ferritin levels: a more effective approach. Blood 2008; 111: 33733376.
  • 3
    Torti FM, Torti SV. Regulation of ferritin genes and protein. Blood 2002; 99: 35053516.
  • 4
    Bridle KR, Crawford DH, Fletcher LM, Smith JL, Powell LW, Ramm GA. Evidence for a sub-morphological inflammatory process in the liver in haemochromatosis. J Hepatol 2003; 38: 426433.
  • 5
    Farinati F, Cardin R, De Maria N, Della Libera G, Marafin C, Lecis E, et al. Iron storage, lipid peroxidation and glutathione turnover in chronic anti-HCV positive hepatitis. J Hepatol 1995; 22: 449456.
  • 6
    Friedman SL. Hepatic stellate cells: protean, multifunctional, and enigmatic cells of the liver. Physiol Rev 2008; 88: 125172.
  • 7
    Ramm GA, Britton RS, O'Neill R, Bacon BR. Identification and characterization of a receptor for tissue ferritin on activated rat lipocytes. J Clin Invest 1994; 94: 915.
  • 8
    Ramm GA, Britton RS, O'Neill R, Kohn HD, Bacon BR. Rat liver ferritin selectively inhibits expression of alpha-smooth muscle actin in cultured rat lipocytes. Am J Physiol 1996; 270: G370375.
  • 9
    Elsharkawy AM, Mann DA. Nuclear factor-kappaB and the hepatic inflammation-fibrosis-cancer axis. HEPATOLOGY 2007; 46: 590597.
  • 10
    Ribeiro PS, Cortez-Pinto H, Sola S, Castro RE, Ramalho RM, Baptista A, et al. Hepatocyte apoptosis, expression of death receptors, and activation of NF-kappaB in the liver of nonalcoholic and alcoholic steatohepatitis patients. Am J Gastroenterol 2004; 99: 17081717.
    Direct Link:
  • 11
    Bridle KR, Crawford DH, Ramm GA. Identification and characterization of the hepatic stellate cell transferrin receptor. Am J Pathol 2003; 162: 16611667.
  • 12
    Ramm GA. Isolation and culture of rat hepatic stellate cells. J Gastroenterol Hepatol 1998; 13: 846851.
  • 13
    Santambrogio P, Levi S, Cozzi A, Rovida E, Albertini A, Arosio P. Production and characterization of recombinant heteropolymers of human ferritin H and L chains. J Biol Chem 1993; 268: 1274412748.
  • 14
    Dignam JD. Preparation of extracts from higher eukaryotes. Methods Enzymol 1990; 182: 194203.
  • 15
    Elsharkawy AM, Wright MC, Hay RT, Arthur MJ, Hughes T, Bahr MJ, et al. Persistent activation of nuclear factor-kappaB in cultured rat hepatic stellate cells involves the induction of potentially novel Rel-like factors and prolonged changes in the expression of IkappaB family proteins. HEPATOLOGY 1999; 30: 761769.
  • 16
    Andoh A, Takaya H, Saotome T, Shimada M, Hata K, Araki Y, et al. Cytokine regulation of chemokine (IL-8, MCP-1, and RANTES) gene expression in human pancreatic periacinar myofibroblasts. Gastroenterology 2000; 119: 211219.
  • 17
    Jung YD, Fan F, McConkey DJ, Jean ME, Liu W, Reinmuth N, et al. Role of P38 MAPK, AP-1, and NF-kappaB in interleukin-1beta-induced IL-8 expression in human vascular smooth muscle cells. Cytokine 2002; 18: 206213.
  • 18
    Oakley F, Meso M, Iredale JP, Green K, Marek CJ, Zhou X, et al. Inhibition of inhibitor of kappaB kinases stimulates hepatic stellate cell apoptosis and accelerated recovery from rat liver fibrosis. Gastroenterology 2005; 128: 108120.
  • 19
    Rockey DC, Chung JJ, McKee CM, Noble PW. Stimulation of inducible nitric oxide synthase in rat liver by hyaluronan fragments. HEPATOLOGY 1998; 27: 8692.
  • 20
    Gao R, Brigstock DR. Activation of nuclear factor kappa B (NF-kappaB) by connective tissue growth factor (CCN2) is involved in sustaining the survival of primary rat hepatic stellate cells. Cell Commun Signal 2005; 3: 14.
  • 21
    Chen TT, Li L, Chung DH, Allen CD, Torti SV, Torti FM, et al. TIM-2 is expressed on B cells and in liver and kidney and is a receptor for H-ferritin endocytosis. J Exp Med 2005; 202: 955965.
  • 22
    Wymann MP, Bulgarelli-Leva G, Zvelebil MJ, Pirola L, Vanhaesebroeck B, Waterfield MD, et al. Wortmannin inactivates phosphoinositide 3-kinase by covalent modification of Lys-802, a residue involved in the phosphate transfer reaction. Mol Cell Biol 1996; 16: 17221733.
  • 23
    Hirai T, Chida K. Protein kinase Czeta (PKCzeta): activation mechanisms and cellular functions. J Biochem (Tokyo) 2003; 133: 17.
  • 24
    Xu J, Zutter MM, Santoro SA, Clark RA. PDGF induction of alpha 2 integrin gene expression is mediated by protein kinase C-zeta. J Cell Biol 1996; 134: 13011311.
  • 25
    Berra E, Diaz-Meco MT, Lozano J, Frutos S, Municio MM, Sanchez P, et al. Evidence for a role of MEK and MAPK during signal transduction by protein kinase C zeta. EMBO J 1995; 14: 61576163.
  • 26
    Sibille JC, Kondo H, Aisen P. Interactions between isolated hepatocytes and Kupffer cells in iron metabolism: a possible role for ferritin as an iron carrier protein. HEPATOLOGY 1988; 8: 296301.
  • 27
    Worwood M. Ferritin. Blood Rev 1990; 4: 259269.
  • 28
    Cragg SJ, Wagstaff M, Worwood M. Detection of a glycosylated subunit in human serum ferritin. Biochem J 1981; 199: 565571.
  • 29
    Bell H, Skinningsrud A, Raknerud N, Try K. Serum ferritin and transferrin saturation in patients with chronic alcoholic and non-alcoholic liver diseases. J Intern Med 1994; 236: 315322.
  • 30
    Fargion S, Mattioli M, Fracanzani AL, Sampietro M, Tavazzi D, Fociani P, et al. Hyperferritinemia, iron overload, and multiple metabolic alterations identify patients at risk for nonalcoholic steatohepatitis. Am J Gastroenterol 2001; 96: 24482455.
    Direct Link:
  • 31
    Turnbull AJ, Mitchison HC, Peaston RT, Lai LC, Bennett MK, Taylor R, et al. The prevalence of hereditary haemochromatosis in a diabetic population. Qjm 1997; 90: 271275.
  • 32
    Lang A, Schoonhoven R, Tuvia S, Brenner DA, Rippe RA. Nuclear factor kappaB in proliferation, activation, and apoptosis in rat hepatic stellate cells. J Hepatol 2000; 33: 4958.
  • 33
    Schwabe RF, Bataller R, Brenner DA. Human hepatic stellate cells express CCR5 and RANTES to induce proliferation and migration. Am J Physiol Gastrointest Liver Physiol 2003; 285: G949958.
  • 34
    Zhang YP, Yao XX, Zhao X. Interleukin-1 beta up-regulates tissue inhibitor of matrix metalloproteinase-1 mRNA and phosphorylation of c-jun N-terminal kinase and p38 in hepatic stellate cells. World J Gastroenterol 2006; 12: 13921396.
  • 35
    Pierce JW, Schoenleber R, Jesmok G, Best J, Moore SA, Collins T, et al. Novel inhibitors of cytokine-induced IkappaBalpha phosphorylation and endothelial cell adhesion molecule expression show anti-inflammatory effects in vivo. J Biol Chem 1997; 272: 2109621103.
  • 36
    Torti SV, Torti FM. Human H-kininogen is a ferritin-binding protein. J Biol Chem 1998; 273: 1363013635.
  • 37
    Yuan X, Cong Y, Hao J, Shan Y, Zhao Z, Wang S, et al. Regulation of LIP level and ROS formation through interaction of H-ferritin with G-CSF receptor. J Mol Biol 2004; 339: 131144.
  • 38
    Kumanogoh A, Marukawa S, Suzuki K, Takegahara N, Watanabe C, Ch'ng E, et al. Class IV semaphorin Sema4A enhances T-cell activation and interacts with Tim-2. Nature 2002; 419: 629633.
  • 39
    Moss D, Fargion S, Fracanzani AL, Levi S, Cappellini MD, Arosio P, et al. Functional roles of the ferritin receptors of human liver, hepatoma, lymphoid and erythroid cells. J Inorg Biochem 1992; 47: 219227.
  • 40
    Philippe MA, Ruddell RG, Ramm GA. Role of iron in hepatic fibrosis: one piece in the puzzle. World J Gastroenterol 2007; 13: 47464754.
  • 41
    Wong CT, McArdle HJ, Morgan EH. Effect of iron chelators on placental uptake and transfer of iron in rat. Am J Physiol 1987; 252: C477482.