SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The mechanisms mediating hepatic accumulation of inflammatory cells in cholestatic liver disease remain enigmatic. Our thesis is that Hedgehog (Hh) pathway activation promotes hepatic accumulation of immune cells that interact with cholangiocytes. We believe that myofibroblastic hepatic stellate cells (MF-HSCs) release soluble Hh ligands that stimulate cholangiocytes to express chemokines that recruit mononuclear cell types with cognate receptors for these chemokines, thereby orchestrating a repair-related mechanism for liver inflammation. To address this thesis, we used three experimental systems that allow the definition of Hh-dependent mechanisms that induce phenotypic changes in cholangiocytes. First, cholangiocytes were cultured alone or in the presence of Hh-producing MF-HSCs in a transwell coculture system and/or treated with MF-HSC–conditioned medium with or without Hh-neutralizing antibodies. Changes in the cholangiocyte phenotype were then evaluated by microarray analysis, quantitative reverse-transcriptase polymerase chain reaction (QRT-PCR), and/or enzyme-linked immunosorbent assay for chemokine (C-X-C) motif ligand 16 (Cxcl16). Bile duct ligation was chosen to model biliary fibrosis in mice with an overly active Hh pathway, control littermates, and healthy rats, and the gene profile was evaluated by QRT-PCR in whole liver tissue. Second, a transwell chemotaxis assay was used to examine natural killer T (NKT) cell migration in response to cholangiocytes and particularly cholangiocyte-derived Cxcl16. Finally, we studied liver samples from primary biliary cirrhosis patients and controls by QRT-PCR to compare differences in the Hh pathway and Cxcl16. Co-immunostaining of cytokeratin-7 and Cxcl16 was then performed to localize the phenotypic source of Cxcl16. We found that MF-HSCs release soluble Hh ligands that stimulate cholangiocytes to produce Cxcl16 and recruit NKT cells. Hh pathway activation during cholestatic liver injury also induces cholangiocyte expression of Cxcl16. Conclusion: During biliary injury, Hh pathway activation induces cholangiocyte production of chemokines that recruit NKT cells to portal tracts. (HEPATOLOGY 2009.)

Hepatic accumulation of various types of inflammatory cells is a hallmark of many chronic cholestatic liver diseases.1-3 Such cells often cluster in and around neocholangioles (ductular-like structures) and admix with fibroblastic cells in portal triads, but sometimes they extend more deeply into hepatic lobules, particularly when liver injury is accompanied by fibrosis. Foci of dead and injured liver epithelial cells are typically associated with these inflammatory infiltrates, and this suggests that the inflammatory cells themselves and/or mediators that they release are hepatotoxic.2, 4 The resultant elimination of chronically infected and/or irrevocably damaged hepatocytes and cholangiocytes may also be necessary for eventual recovery. In any case, evidence that the numbers of hepatic inflammatory cells and myofibroblasts dwindle as liver injury and fibrosis resolve supports the concept that hepatic accumulation of immune cells and fibrosing biliary injury are linked.2, 4

Biliary fibrosis is accompanied by activation of the Hedgehog (Hh) pathway in rodents and humans.5–8 Hh ligands are pleiotropic morphogens that regulate tissue remodeling responses during embryogenesis and adult tissue repair.6, 7, 9, 10 Two of the major cell types that are involved in repairing chronic biliary injury, immature ductular cells (cholangiocytes) and myofibroblastic hepatic stellate cells (MF-HSCs), produce and respond to Hh ligands.5, 7, 8, 11 Hh pathway activation promotes proliferation and enhances viability of both cell types, permitting accumulation of myofibroblastic cells and immature ductular cells in fibroductular bridges. When unrestrained, this causes progressive fibrosis and hepatic architectural distortion.6, 7

Certain types of T lymphocytes have been shown to be Hh-responsive in adults.12, 13 Whether or not liver cell–derived Hh ligands have any role in regulating immune responses to liver injury has not, to our knowledge, been examined. This merits investigation, however, because immune cells contribute to liver remodeling and typically localize near collections of immature ductular cells and myofibroblasts in injured livers.2, 14–16 Therefore, the current study focused on the thesis that the activation of the Hh pathway promotes the specific accumulation of immune cells that interact with cholangiocytes and results in an orchestrated response that includes a repair-related mechanism for liver inflammation. Our results support the concept that paracrine Hh signaling between myofibroblasts and cholangiocytes promotes immune cell migration towards biliary epithelial cells. These findings identify a mechanism that mediates this process, namely Hh-dependent induction of chemokine production by ductular-type cells. Moreover, functional analysis of one of these Hh-regulated chemokines, chemokine (C-X-C) motif ligand (Cxcl16), provides compelling evidence for the pathobiological significance of such repair-related inflammation in chronic biliary disease in rodents and humans.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Human Subjects

Anonymized liver samples were examined from 14 patients with primary biliary cirrhosis (PBC) and 7 control healthy livers. Tissues were obtained from University of California Davis (Davis, CA), UT Southwestern (Dallas, TX), and the Duke University School of Medicine Tissue Bank Shared Resource (Durham, NC), and they were studied in accordance with National Institutes of Health guidelines for human subjects research.

Animals

Patched-deficient mice (Ptc+/−) and their wild-type (WT) littermates were obtained from P.A. Beachy (Johns Hopkins University, Baltimore, MD).17 Fisher rats were obtained from Charles River (Wilmington, MA).

Cell Lines

Murine cholangiocyte line 603B was provided by Yoshiyuki Ueno (Tohoku University, Sendai, Japan) and G. Gores (Mayo Clinic, Rochester, MN).18, 19 Clonally derived rat MF-HSC line 8B was obtained from M. Rojkind (George Washington University, Washington DC).20 The normal rat cholangiocyte (NRC) line was a gift from N. LaRusso (Mayo Clinic, Rochester, MN).21 The murine invariant natural killer T (iNKT) hybridoma cell line DN32 was provided by Dr. Albert Bendelac (University of Chicago, Chicago, IL).22

Animal Experiments

Mice and rats were subjected to bile duct ligation (BDL) or sham surgery (n = 6 per group) and sacrificed after 1 week to obtain liver tissues (from mice)5, 7 or cholangiocytes (from rats). Cholangiocytes were purified with a monoclonal antibody (from R. Faris, Brown University, Providence, RI) against a membrane antigen expressed by all intrahepatic cholangiocytes.23 Purity of the cholangiocytes was confirmed by cytochemistry for γ-glutamyl transpeptidase, a cholangiocyte-specific marker.5, 23 As assessed by trypan blue exclusion, cell viability was greater than 97%.5, 23 All animal experiments were approved by the Institutional Animal Care and Use Committees of Duke University and Scott and White Hospital as set forth in the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health.

Cell Culture Experiments

Assessment of MF-HSC–Derived Factors on the Cholangiocyte Phenotype.

Immature7 cholangiocytes (603B cells) were cultured in six-well plates for 6 days alone (monoculture) or in a transwell coculture system with MF-HSCs (MF-HSC-8B) as described.5, 7 In each experiment, messenger RNA (mRNA) and conditioned medium were pooled from all six wells and used for a subsequent microarray, quantitative reverse-transcriptase polymerase chain reaction (QRT-PCR) analysis, or enzyme-linked immunosorbent assay (ELISA). MF-HSC-8B cells were also monocultured for 6 days to obtain MF-HSC–conditioned medium for other studies (discussed later). All experiments were repeated three times.

Pharmacological Inhibition of Hh Signaling In Vitro.

Hh-neutralizing antibody (5E1; Developmental Studies Hybridoma Bank, Iowa City, IA) or control immunoglobulin G (IgG; R&D; 10 μg/mL) was added to MF-HSC–conditioned medium and used to treat cholangiocyte monocultures that had been serum-starved for 18 hours.5 Cholangiocytes that had been treated with unconditioned medium served as controls. Twenty-four hours later, supernatants and cell pellets were harvested. Cxcl16 protein in supernatants was quantified by ELISA, and mRNA extracted from cell pellets was analyzed by QRT-PCR for chemokine-related genes.5, 7 These studies were repeated with freshly isolated primary rat cholangiocytes,23 and supernatants were harvested after 6 hours for Cxcl16 quantification. All experiments were repeated three times.

Natural Killer T (NKT) Cell Migration Assay.

Monocultures/cocultures were repeated with 24-well plates.5, 7 After 6 days, inserts containing MF-HSCs were removed, conditioned medium was collected, and it was kept at −80°C until ELISA for Cxcl16 was performed. Monocultured/cocultured cholangiocytes were then treated with NKT cell culture medium and anti-Cxcl16 antibody (R&D Systems) or irrelevant IgG (5 μg/mL). After 1 hour, a modified chemotaxis assay24, 25 was performed. Briefly, new inserts (5-μm pore size) were placed in the wells, and NKT cells (1.5 × 105/0.2 mL) were added to the upper chambers. Cultures were incubated at 37°C in 5% CO2 for 2 hours, supernatants were collected from the bottom chamber, and NKT cells that had migrated through filters were quantified with a hemocytometer. Experiments were repeated three times.

Microarray Analysis

Total RNA from monocultured or cocultured cholangiocytes (603B cells) was evaluated with a microarray (n = 3 samples per group).5 After RNA quality was assessed with an Agilent 2100 bioanalyzer (Agilent Technologies, Santa Clara, CA), RNA was hybridized to Mouse 430-2 Affymetrix GeneChips (Duke University Microarray Facility, Durham, NC).5 The probe expression values of the GeneChips were subsequently calculated by the application of the robust multichip average (RMA) algorithm by means of RMAExpress5, 26-28 based on the Affymetrix CEL and CDF files as standard inputs. The RMA-based gene expression in the coculture group was expressed as a ratio of the expression in the monoculture control group. A 1.5-fold increase or decrease in relative gene expression (i.e., probes having an expression ratio in cocultures/monocultures above 1.500 and below 0.666) was considered to be significant.29, 30 These were further evaluated by gene ontology analysis.31 Each gene probe was assigned to its gene ontology families, and Expression Analysis Systematic Explorer scores were calculated.32 Chemokine genes that were differentially expressed in the microarray analysis were then validated by QRT-PCR.

Two-Step Real-Time Polymerase Chain Reaction

Total RNA from cholangiocyte cell lines (603B and NRC), primary cholangiocytes, or liver tissues was reverse-transcribed to complementary DNA templates after RNase-free DNase I treatment (Qiagen, Valencia, CA). Semiquantitative QRT-PCR was then performed.5 Species-specific primers are listed in Table 1. Target gene expression was normalized to housekeeping gene expression according to the ΔΔCt method. In each experiment, data were expressed with respect to the corresponding control group.5 Amplicon products were also separated by electrophoresis on a 2.0% agarose gel buffered with 0.5× trishydroxymethylaminomethane–borate–ethylene diamine tetraacetic acid, and representative products were then visualized with the AlphaImager 3400 gel analysis system.7

Table 1. Sequences of Primers Used for QRT-PCR
Target GeneForward SequenceReverse Sequence
  • Abbreviations: Ccl, chemokine (C-C) motif ligand; Cxcl, chemokine (C-X-C) motif ligand; IFN-γ, interferon γ; MCP-1, monocyte chemotactic protein-1; MIP3α, macrophage inflammatory protein-3α.

  • *

    Mouse.

  • Rat.

  • Human.

Ccl2/MCP1*TGATCCCAATGAGTAGGCTTCAGATTTACGGGTCAACTT
Ccl5*CCCTCACCATCATCCTCACTCCCTCACCATCATCCTCACT
Ccl20/MIP3α*CCCAGCACTGAGTACATCAAGTATGTACGAGAGGCAACAGTC
Cxcl1*CCCAAACCGAAGTCATAGCCTCAGAAGCCAGCGTTCACC
Cxcl2*GCCCAGACAGAAGTCATAGCCTTCTCTTTGGTTCTTCCGTTGA
Cxcl5*TCATGAGAAGGCAATGCTACATTATGCCATACTACGAAGA
Cxcl10*TGAATCCGGAATCTAAGACCATAAGACCAAGGGCAATTAGGACT
Cxcl11*CCTGGCTGCGATCATCTGCATTATGAGGCGAGCTT
Cxcl16*TTCTTGTTGGCGCTGCTGACTGCGCTCAAAACAGTCCACTAG
S9*GACTCCGGAACAAAGGTGAGGTCTTCATCTTGCCCTCGTCCA
Ccl2/MCP1CAGTTAATGCCCCACTCACCTTCCTTATTGGGGTCAGCAC
Ccl20/MIPαGCGAGAATTTTTGTGGGTTTCGGATCTTTTCGACTTCAGG
Cxcl1AGACAGTGGCAGGGATTCACTGGCTATGACTTCGGTTTGG
Cxcl2GGCTTCAGGGTTGAGACAAAAGGGTACAGGGGTTGTTGTG
Cxcl5AGTCGATTCCGCTTTGTTTTAACCCCAAAATGATCGCTAA
Cxcl11TCAAAATGGCAGCAATCAAGCCAGGCACCTTTGTCCTTTA
Cxcl16CCAGCAGTCCACTTTTCCATGCTCCTGGTTCTTTTTGCTG
S9GACTCCGGAACAAAGGTGAGGTCTTCATCTTGCCCTCGTCCA
IFN-γTGACCAGAGCATCCAAAAGACTCTTCGACCTCGAAACAGC
Cxcl16ACTCGTCCCAATGAAACCACATGAAGATGATGGCCAGGAG
β-ActinTGGCATCCACGAAACTACCTACGGAGTACTTGCGCTCAG

Cxcl16 ELISA

Cxcl16 protein was detected by DuoSet ELISA (R&D Systems) according to the manufacturer's instructions. Results were expressed as the absolute concentration of Cxcl16 (pg/mL).

Immunohistochemistry

Frozen human liver sections were fixed, permeabilized, saturated, and processed for double immunofluorescent staining with primary antibody against Cxcl16 (R&D Systems) and cytokeratin-7 (CK-7; Dako, Carpinteria, CA). Alexa Fluor 568 and Alexa Fluor 488 (Molecular Probes, Carlsbad, CA) were used as secondary antibodies. Counterstaining with 4′,6-diamidino-2-phenylindole was employed to demonstrate nuclei.

Statistical Analysis

Results are expressed as the mean ± standard error of the mean. Comparisons between groups were performed with the Student t test, and significance was accepted at the 5% level, unless stated otherwise.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Paracrine Hh Signaling Between Ductular and Myofibroblastic Cells Induced Chemokine Gene Expression in Ductular Cells

Ductular-type cells and myofibroblastic cells typically localize together and accumulate in concert during chronic liver injury.2 Our previous studies of a transwell coculture system of cholangiocytes and MF-HSCs demonstrated that each of these cell types released soluble Hh ligands that promoted the proliferation and viability of the other type of cell.7, 11 To determine if MF-HSCs generated soluble factors that also influenced the immunomodulatory properties of cholangiocytes, a microarray analysis was conducted to compare genes expressed by cocultured cholangiocytes and monocultured cholangiocytes. Interestingly, some of the most highly induced genes in cholangiocytes regulated cytokine activity, inflammatory responses, chemotaxis, chemokines, and antigen presentation/processing (Fig. 1A and Table 2). Since the major objective of this study was to determine if (and how) Hh pathway activation in liver cells might regulate hepatic accumulation of inflammatory cells, subsequent attention was focused on differentially expressed chemokines.

thumbnail image

Figure 1. Paracrine signaling between myofibroblastic and ductular cells induced chemokine gene expression in ductular cells. (A) Chemokine-related probe analysis. Microarray analysis was performed in monoculture/coculture samples derived from three independent experiments. Each probe having an expression ratio (average expression in cocultures/average expression in monocultures) above 1.500 and below 0.666 was considered for the GO analysis and assigned to its GO families. Probes belonging to chemokine activity, chemokine receptor binding, and chemotaxis GO families are displayed as ratios of the expression in cocultured cholangiocytes versus monocultured cholangiocytes. (B) Two-percent agarose gel of representative amplicon products. QRT-PCR was performed in the murine cholangiocyte 603B line, rat NRC line, and primary rat cholangiocytes with species-specific primers. Amplicon products were separated by electrophoresis on a 2% agarose gel buffered with 0.5× trishydroxymethylaminomethane–borate–ethylene diamine tetraacetic acid and then visualized with the AlphaImager 3400 gel analysis system. Abbreviations: Ccl, chemokine (C-C) motif ligand; Cxcl, chemokine (C-X-C) motif ligand; GO, gene ontology; MCP-1, monocyte chemotactic protein-1; MIP3α, macrophage inflammatory protein-3α; NRC, normal rat cholangiocyte; QRT-PCR, quantitative reverse-transcriptase polymerase chain reaction.

Download figure to PowerPoint

Table 2. Significant Changes in Chemokine-Related GO Gene Sets
GO Family*Gene CountEASE Score
  • Gene probes having an expression ratio (cocultures/monocultures) above 1.500 (upper threshold) and below 0.666 (lower threshold) were considered for the GO analysis. Each gene probe was then assigned to its multiple GO families, and the significance (EASE score) was evaluated.

  • Abbreviations: EASE, Expression Analysis Systematic Explorer; GO, gene ontology; MHC, major histocompatibility complex.

  • *

    Chemokine-related GO families.

  • Absolute number of altered genes.

Cytokine activity130.033000
Inflammatory response100.042000
Taxis100.003000
Chemotaxis100.003000
Chemokine receptor binding90.000007
Chemokine activity90.000007
Antigen processing, endogenous antigen via MHC class I50.039000
Antigen presentation, endogenous antigen50.042000

Both microarray (Fig. 1A) and QRT-PCR (Fig. 2, black bars) analysis demonstrated that compared to monocultured cholangiocytes, cocultured cholangiocytes expressed 2-fold to almost 40-fold higher levels of mRNAs encoding chemokines for neutrophils [chemokine (C-C) motif ligand 20 (Ccl20)/macrophage inflammatory protein-3α (MIP3α), Cxcl1, Cxcl2, and Cxcl5],33 monocytes/macrophages [Ccl2/monocyte chemotactic protein-1 (MCP-1) and Ccl20/MIP3α],33, 34 and lymphocytes (Ccl20/MIP3α35–38 and Cxcl1133, 39), including NKT cells (Cxcl1640–42). To ensure that chemokine production was not a unique characteristic of the 603B cholangiocyte line, basal expression of chemokine mRNAs was also assessed in a second cholangiocyte line (NRC; Fig 1B) and in primary rat cholangiocytes (Fig. 1B). Effects of biliary injury on cholangiocyte chemokine production were then examined by a comparison of levels of chemokine mRNAs in freshly isolated primary cholangiocytes from rats that had undergone either sham surgery or BDL 1 week earlier. BDL significantly influenced cholangiocyte expression of all the chemokine mRNAs that had been induced in the coculture experiments (Fig. 2, white bars).

thumbnail image

Figure 2. Microarray data validation and comparison with freshly isolated cholangiocytes by QRT-PCR analysis. Chemokine gene mRNA levels were normalized to housekeeping gene expression in 603B mouse cholangiocytes or primary rat cholangiocytes. Data are displayed as the fold change in cocultured 603B cholangiocytes with respect to that in 603B monocultures (black bars) or in primary cholangiocytes isolated from 1-week BDL rats with respect to sham controls (white bars). Data are representative of three experiments and are shown as the mean ± standard error of the mean (*P < 0.05, **P < 0.005). Abbreviations: BDL, bile duct ligation; Ccl, chemokine (C-C) motif ligand; Cxcl, chemokine (C-X-C) motif ligand; MCP-1, monocyte chemotactic protein-1; MF, myofibroblast; MIP3α, macrophage inflammatory protein-3α; mRNA, messenger RNA; QRT-PCR, quantitative reverse-transcriptase polymerase chain reaction.

Download figure to PowerPoint

To determine if Hh ligands released from MF-HSCs mediated the induction of chemokine genes in neighboring cholangiocytes, the studies in cultured 603B cells were repeated with MF-HSC–conditioned medium containing either control IgG or Hh-neutralizing antibody. Chemokine gene expression was consistently inhibited by the addition of Hh-neutralizing antibody to MF-HSC–conditioned medium (Fig. 3A), and this proved that soluble Hh ligands mediated much of the stimulatory effects that MF-HSCs exerted on cholangiocyte chemokine expression.

thumbnail image

Figure 3. Cholangiocyte chemokine gene induction is Hh-dependent. (A) QRT-PCR analysis of cholangiocytes cultured in MF-conditioned medium with or without Hh-neutralizing antibody. MF-HSC-8B was cultured for 6 days, and conditioned medium was collected. This MF-HSC–conditioned medium was then added to monocultures of cholangiocyte cell line 603B that had been cultured without serum for 18 hours. Cholangiocytes were incubated with MF-HSC–conditioned medium in the presence of Hh-neutralizing antibody 5E1 (gray bars) or control IgG (black bars; 10 μg/mL) for an additional 24 hours. 603B cells cultured in unconditioned medium (white bars) provided an additional control group. QRT-PCR was then performed to analyze the expression of chemokine-related genes that had been altered when the cholangiocytes were cocultured with MF-HSC line 8B. Data are representative of three independent experiments and are expressed as the mean ± standard error of the mean (*P < 0.05, **P < 0.005). (B) QRT-PCR analysis of whole liver tissue from BDL mice. Ptc-deficient (Ptc+/−) mice (black bars; n = 6) and their WT littermates (white bars; n = 6) underwent BDL and were analyzed for the same chemokines that were Hh-dependent in vitro. Data are shown as the mean ± standard error of the mean (*P < 0.05, **P < 0.005). Abbreviations: BDL, bile duct ligation; Ccl, chemokine (C-C) motif ligand; Cxcl, chemokine (C-X-C) motif ligand; Hh, Hedgehog; IgG, immunoglobulin G; MCP-1, monocyte chemotactic protein-1; MF, myofibroblast; MF-HSC, myofibroblastic hepatic stellate cell; MIP3α, macrophage inflammatory protein-3α; mRNA, messenger RNA; Ptc, patched; QRT-PCR, quantitative reverse-transcriptase polymerase chain reaction; WT, wild type.

Download figure to PowerPoint

Enhanced Induction of Chemokine mRNAs After BDL in Mice with Excessive Hh Pathway Activity

To determine the role of Hh signaling in chemokine production during liver injury, we next compared the expression of the same chemokine genes in Ptc+/− mice and their WT littermates 1 week after BDL. Mice with haplo insufficiency of Ptc have an impaired ability to turn off Hh pathway signaling because Ptc normally restrains the activity of Smoothened, the signaling competent Hh coreceptor.43 Hence, Ptc+/− mice are prone to develop diseases that result from excessive Hh pathway activity,17, 44, 45 and we reported previously that Ptc+/− mice developed worse liver fibrosis than WT mice after BDL,5, 7 a potent stimulus for activation of Hh signaling in the liver.6, 7 In the current study, Ptc+/− mice exhibited generally greater expression of the chemokines that were Hh-responsive in the cholangiocyte cell line, demonstrating significantly greater expression of six of the seven putative Hh-responsive chemokines than WT-BDL mice (Fig. 3B).

Hh-Dependent Paracrine Mechanism Stimulated Ductular Cells To Synthesize and Secrete Cxcl16, Which Chemoattracted NKT Cells

Next, we performed a more in-depth functional analysis of Cxcl16, one of the chemokines proven to be Hh-inducible in both cultured cholangiocytes and BDL liver (Fig. 3). Cxcl16 was selected for scrutiny because it is a chemokine for NKT cells, and a series of elegant studies had already demonstrated that NKT cells accumulate in PBC46 and proven that such NKT cell accumulation drives local production of interferon γ (IFN-γ), resulting in PBC-related bile duct injury.47 The amount of Cxcl16 soluble protein was examined by ELISA in supernatants of freshly isolated primary cholangiocytes (Fig. 4A,B) and in 603B cholangiocytes that were cultured alone or with MF-HSCs in the transwell coculture system (Fig. 4C,D). Primary cholangiocytes from BDL rats released almost 16 times more Cxcl16 than cholangiocytes from sham controls (Fig. 4A), and cocultured 603B cholangiocytes released about twice as much Cxcl16 protein as 603B monocultures (Fig. 4C). No Cxcl16 was detected in conditioned medium from monocultured MF-HSCs (data not shown). Hence, this Cxcl16 was produced by the cholangiocytes in the coculture. In both freshly isolated cholangiocytes and 603B cells, MF-HSC–derived Hh ligands were largely responsible for stimulating cholangiocyte production of Cxcl16 because Cxcl16 secretion was significantly inhibited by pretreatment of MF-HSC–conditioned medium with Hh-neutralizing antibody (but not control IgG; Fig. 4B,D). Hh-neutralizing antibodies also blocked cholangiocyte mRNA expression of Adam10 (a disintegrin and metallopeptidase 10),48, 49 an enzyme that is required to release membrane-associated Cxcl16 from cells that synthesize this chemokine (Fig. 4E).

thumbnail image

Figure 4. Hh-dependent paracrine signaling caused ductular cells to secrete the NKT chemokine Cxcl16 and chemoattracted NKT cells in vitro. (A) Cxcl16 soluble protein analysis in primary cholangiocytes. Primary cholangiocytes were freshly isolated from sham or BDL rats. Supernatants were collected after 6 hours of incubation and analyzed for Cxcl16 by ELISA. (B) Effect of Hh ligand neutralization on Cxcl16 protein release by primary cholangiocytes. Freshly isolated cholangiocytes from normal rats were treated for 6 hours with either unconditioned medium (white bars) or 6-day MF-conditioned medium in the presence of Hh ligand neutralizing antibody 5E1 (gray bars) or control IgG (black bars; 10 μg/mL). Cxcl16 protein released into the supernatants was assessed by ELISA. (C) Cxcl16 soluble protein analysis in 603B cholangiocyte monocultures/cocultures. Conditioned medium was collected from 6-day monocultures or cocultures, and Cxcl16 protein production was quantified by ELISA. (D) Effect of Hh ligand neutralization on Cxcl16 protein release by 603B cholangiocytes. Six-day MF-conditioned medium was collected and added to monocultures of cholangiocytes in the presence of Hh-neutralizing antibody (5E1; gray bars) or control IgG (black bars; 10 μg/mL). 603B cells cultured with unconditioned medium (white bars) were used as controls. Supernatants were assessed by ELISA for Cxcl16 soluble protein levels, and cell pellets were analyzed by QRT-PCR for Adam10 gene expression. (E,F) NKT cell migration assay. Cholangiocytes were cultured in the absence and presence of MF-HSCs. After 6 days, transwell filter inserts containing MF-HSCs were removed. Cholangiocyte monocultures/cocultures were pretreated for 1 hour with antibody-neutralizing Cxcl16 or irrelevant IgG (5 μg/mL). NKT cells were then added to the system with 5-μm-pore inserts, and their migration was monitored for 2 hours. Data are representative of three independent experiments and are displayed as the mean ± standard error of the mean (*P < 0.05, **P < 0.005). Abbreviations: Adam10, a disintegrin and metallopeptidase 10; BDL, bile duct ligation; Cxcl, chemokine (C-X-C) motif ligand; ELISA, enzyme-linked immunosorbent assay; Hh, Hedgehog; IgG, immunoglobulin G; MF, myofibroblast; MF-HSC, myofibroblastic hepatic stellate cell; NKT, natural killer T; QRT-PCR, quantitative reverse-transcriptase polymerase chain reaction.

Download figure to PowerPoint

To examine the biological activity of cholangiocyte-derived Cxcl16, murine iNKT cells were then added to the upper well of transwell systems that contained cholangiocytes (which had been grown for 6 days in a monoculture or a coculture with MF-HSCs) in the bottom chamber. NKT cell migration was monitored for 2 hours in the absence or presence of anti-Cxcl16 antibody. Monocultured cholangiocytes evoked some NKT cell migration, but significantly more NKT cells migrated towards the cocultured cholangiocytes. In both cases, anti-Cxcl16 blocked migration, and this proved that the NKT cells were chemoattracted by cholangiocyte-derived Cxcl16 (Fig. 4F). Together with the data displayed in Fig. 3, these results identify an Hh-dependent, paracrine mechanism by which MF-HSCs stimulate cholangiocytes to synthesize and secrete Cxcl16, which then chemoattracts NKT cells to the Cxcl16-producing ductular cells.

Hh-Associated Induction of Cxcl16 Production by Ductular Cells in PBC Patients with NKT Cell–Mediated Bile Duct Injury

PBC is characterized by chronic nonsuppurative cholangitis, which eventually destroys intralobular bile ducts, causing ductopenia and biliary-type fibrosis. It is not entirely clear why portal tracts accumulate iNKT cells in PBC patients and murine models of PBC, but it is known that the iNKT cells produce IFN-γ and contribute to bile duct injury because both IFN-γ and bile duct injury are prevented in PBC-prone mice that are genetically deficient in iNKT cells.46, 47 Previously, we reported that Hh pathway activity is increased in the livers of PBC patients, and this results in the induction of Hh-target genes in many of the ductular-type cells.5, 8 Here we examined liver samples from 13 patients with PBC and 7 control healthy livers. QRT-PCR analysis showed that the glioma-associated oncogene homolog 2 (Gli2) mRNA level was virtually undetectable in control livers, while it was significantly induced in samples from PBC patients (P < 0.05 for PBC patients versus controls); Gli2 induction was also accompanied by a 70% down-regulation of the Hh pathway inhibitor (Hh interacting protein) in PBC samples (P < 0.05; data not shown), and this confirmed our previous report that the Hh pathway is activated in patients with PBC.5, 8

Cxcl16 is an Hh-regulated gene in cholangiocytes (Fig. 3). To clarify whether or not the reactive Cxcl16-producing cholangiocytes reside in the same CK-7(+) compartment that has been shown to be Hh-responsive,5, 50 we performed hepatic double immunofluorescent staining to localize Cxcl16 expression in adults with PBC. Cxcl16 expression colocalized with that of CK-7, a marker of immature ductular cells (Fig. 5A-D). Hepatic expression of Cxcl16 mRNA and IFN-γ was also significantly greater in PBC patients than in controls without chronic liver disease (Fig. 5E,F). These findings complement and extend results obtained by the study of Ptc+/− (Fig. 3B), strengthening support for the concept that activation of the Hh pathway during biliary injury induces immune responses, including recruitment of NKT cells, that amplify cholestatic liver damage.

thumbnail image

Figure 5. Cxcl16 localizes in Hh-responsive immature epithelial cells in PBC. (A-D) Double immunofluorescent staining. (A) Cxcl16 and (B) CK-7 (C,D) colocalized in representative sections from a PBC liver. (C) NL costaining failed to demonstrate CK-7/Cxcl16 double positive cells (NL insert). In all merged images, blue DAPI staining demonstrates cell nuclei. (A-C) Original magnification, ×40. (D) Magnified section of the area indicated in panel C. (E,F) QRT-PCR analysis of whole liver tissue from 13 patients with PBC and 7 control healthy livers (NL): (E) Cxcl16 and (F) IFN-γ. Data are expressed as the mean ± standard error of the mean (*P < 0.05 versus NL). Abbreviations: CK-7, cytokeratin-7; Cxcl, chemokine (C-X-C) motif ligand; DAPI, 4′,6-diamidino-2-phenylindole; Hh, Hedgehog; IFN-γ, interferon γ; mRNA, messenger RNA; NL, normal liver; PBC, primary biliary cirrhosis; QRT-PCR, quantitative reverse-transcriptase polymerase chain reaction.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The healthy liver is an immune organ harboring large numbers of resident macrophages, dendritic cells, and various types of lymphocytes. During many types of chronic liver injury, populations of immune cells expand, and some of these cells clearly contribute to liver damage by exerting direct cytotoxicity, generating reactive oxygen and/or reactive nitrogen species, and/or releasing hepatotoxic cytokines, such as IFN-γ. Several processes appear to be involved in expanding and activating immune cells in the liver, including the presentation of foreign antigens (or altered self-epitopes) by various types of resident liver cells, the release of factors from dying liver cells, and the hepatic induction of various chemokines and other factors that promote adhesion and viability of different types of immune cells. The present study identifies a unifying mechanism that may help to initiate and coordinate these diverse responses, namely injury-related activation of the Hh pathway.

Two of the major cell types that are involved in adult liver repair, myofibroblastic stellate cells and ductular cells, produce and respond to Hh ligands.5–8, 11, 50 Here we have demonstrated that Hh ligands dramatically up-regulate ductular cell expression of genes that promote antigen presentation and processing, inflammatory responses, and chemotaxis of neutrophils, monocytes/macrophages, B cells, T cells, NKT cells, and dendritic cells. A more in-depth evaluation of one of these Hh-regulated gene products, Cxcl16, provides evidence that these gene expression changes are likely to have functional relevance. Hh-dependent induction of Cxcl16 resulted in NKT cell chemotaxis towards cholangiocytes in vitro. Moreover, Hh-related induction of Cxcl16 was demonstrated in both bile duct–ligated rats and humans with PBC, and NKT cells play a pivotal pathogenic role in these types of biliary injuries.

In both BDL mice51 and humans with PBC,46 bile duct destruction involves NKT cell–mediated increases in IFN-γ because inhibiting IFN-γ production is protective. Both BDL and PBC promote biliary fibrosis and may ultimately result in biliary-type cirrhosis.2 The mechanisms that couple chronic biliary injury to fibrosis are not fully understood, however. Indeed, IFN-γ (the putative mediator of cholangiocyte death) has significant antifibrotic actions. Hence, other factors must be involved.

Several lines of evidence suggest that the Hh pathway modulates the sequelae of cholangiocyte death. Hh ligands promote the expansion of both liver myofibroblastic cells and progenitor cell populations.6, 7, 10, 11, 52 The former occurs, at least in part, via Hh-mediated induction of the epithelial-to-mesenchymal transition in ductular-type progenitor cells.5 Hence, sustained Hh pathway activation, which occurs during chronic biliary injury, diverts progenitors away from bile duct cell replacement and promotes their differentiation into myofibroblastic cells. Myofibroblastic liver cells produce Hh ligands,7, 11 and the latter help to maintain their myofibroblastic phenotype by up-regulating Snail and inducing mesenchymal gene expression while repressing expression of bone morphogenic protein-7, E-cadherin, and other factors that support epithelial differentiation (S. S. Choi, unpublished data, 2009). Therefore, eventual ductopenia and biliary-type fibrosis are the predicted outcomes of persistent Hh pathway activation during conditions that cause repeated death of mature biliary epithelial cells. Other Hh-regulated factors may fuel this process. For example, Hh-mediated induction of β2-microglubulin might amplify cholangiocyte presentation of altered self-antigens, while increased expression of Hh-regulated T and B cell chemokines may recruit cytotoxic lymphocytes into the liver and/or stimulate local production of antibodies that trigger further bile duct injury. Similarly, Hh-related increases in Ccl2/MCP1 might enhance hepatic recruitment of bone marrow–derived fibrocytes and myofibroblast transdifferentiation of portal fibroblasts,53 worsening liver fibrosis.

Although the current study focused on Hh signaling during chronic cholestatic liver damage, Hh pathway activation has been demonstrated in other types of adult liver diseases, including nonalcoholic and alcoholic fatty liver diseases,52 cholangiocarcinoma,54 and hepatocellular carcinoma.10, 55 Hepatic accumulation of inflammatory cells, myofibroblasts, liver progenitors, and fibrosis may also occur in each of these conditions. The results of the present study provide a compelling rationale for investigating the causes and consequences of Hh pathway activation in these other disorders. Such work may identify novel biomarkers and therapeutic targets that could improve the outcomes of an array of chronic diseases for which, at present, there are few effective treatments.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The authors thank W. C. Stone for his administrative support, and they are grateful to J. Venter, R. Mancinelli, and M. Marzioni for their outstanding technical support and advice. The authors thank Y. Ueno (Tohoku University, Sendai, Japan) and G. Gores (Mayo Clinic, Rochester, MN) for the gift of the murine cholangiocyte cell line 603B, N. LaRusso (Mayo Clinic, Rochester, MN) for providing the NRC line, M. Rojkind for sharing the myofibroblast cell line MF-HSC-8B, and A. Bendelac (University of Chicago, Chicago, IL) for the gift of the murine iNKT hybridoma cell line. The 5E1 antibody, developed by Thomas M. Jessel, was obtained from the Developmental Studies Hybridoma Bank of the University of Iowa (Iowa City, IA).

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References