HuR regulates gap junctional intercellular communication by controlling β-catenin levels and adherens junction integrity

Authors

  • Niloofar Ale-Agha,

    1. Institut für umweltmedizinische Forschung (IUF) an der Heinrich-Heine-Universität Düsseldorf, Düsseldorf, Germany
    Search for more papers by this author
  • Stefanie Galban,

    1. Institut für Biochemie und Molekularbiologie I, Heinrich-Heine-Universität Düsseldorf, Düsseldorf, Germany
    2. Laboratory of Cellular and Molecular Biology, National Institute on Aging, Intramural Research Program (NIA-IRP), National Institutes of Health, Baltimore, MD, USA
    Search for more papers by this author
  • Christiane Sobieroy,

    1. Institut für Biochemie und Molekularbiologie I, Heinrich-Heine-Universität Düsseldorf, Düsseldorf, Germany
    Search for more papers by this author
  • Kotb Abdelmohsen,

    1. Laboratory of Cellular and Molecular Biology, National Institute on Aging, Intramural Research Program (NIA-IRP), National Institutes of Health, Baltimore, MD, USA
    Search for more papers by this author
  • Myriam Gorospe,

    1. Laboratory of Cellular and Molecular Biology, National Institute on Aging, Intramural Research Program (NIA-IRP), National Institutes of Health, Baltimore, MD, USA
    Search for more papers by this author
  • Helmut Sies,

    1. Institut für umweltmedizinische Forschung (IUF) an der Heinrich-Heine-Universität Düsseldorf, Düsseldorf, Germany
    2. Institut für Biochemie und Molekularbiologie I, Heinrich-Heine-Universität Düsseldorf, Düsseldorf, Germany
    Search for more papers by this author
  • Lars-Oliver Klotz

    Corresponding author
    1. Institut für umweltmedizinische Forschung (IUF) an der Heinrich-Heine-Universität Düsseldorf, Düsseldorf, Germany
    2. Institut für Biochemie und Molekularbiologie I, Heinrich-Heine-Universität Düsseldorf, Düsseldorf, Germany
    • Institut für umweltmedizinische Forschung (IUF) an der Heinrich-Heine-Universität Düsseldorf, Auf'm Hennekamp 50, 40225 Düsseldorf, Germany
    Search for more papers by this author
    • fax: +49-211-3389-331.


  • Potential conflict of interest: Nothing to report.

Abstract

Gap junctional intercellular communication (GJIC) plays a critical role in the regulation of tissue homeostasis and carcinogenesis and is modulated by the levels, subcellular localization, and posttranslational modification of gap junction proteins, the connexins (Cx). Here, using oval cell-like rat liver epithelial cells, we demonstrate that the RNA-binding protein HuR promotes GJIC through two mechanisms. First, HuR silencing lowered the levels of Cx43 protein and Cx43 messenger RNA (mRNA), and decreased Cx43 mRNA half-life. This regulation was likely due to the direct stabilization of Cx43 mRNA by HuR, because HuR associated directly with Cx43 mRNA, a transcript that bears signature adenylate-uridylate-rich (AU-rich) and uridylate-rich (U-rich) sequences in its 3′-untranslated region. Second, HuR silencing reduced both half-life and the levels of β-catenin mRNA, also a target of HuR; accordingly, HuR silencing lowered the levels of whole-cell and membrane-associated β-catenin. Coimmunoprecipitation experiments showed a direct interaction between β-catenin and Cx43. Small interfering RNA (siRNA)-mediated depletion of β-catenin recapitulated the effects of decreasing HuR levels: it attenuated GJIC, decreased Cx43 levels, and redistributed Cx43 to the cytoplasm, suggesting that depletion of β-catenin in HuR-silenced cells contributed to lowering Cx43 levels at the membrane. Finally, HuR was demonstrated to support GJIC after exposure to a genotoxic agent, doxorubicin, or an inducer of differentiation processes, retinoic acid, thus pointing to a crucial role of HuR in the cellular response to stress and in physiological processes modulated by GJIC. Conclusion: HuR promotes gap junctional intercellular communication in rat liver epithelial cells through two related regulatory processes, by enhancing the expression of Cx43 and by increasing the expression of β-catenin, which, in turn, interacts with Cx43 and is required for proper positioning of Cx43 at the plasma membrane. (HEPATOLOGY 2009.)

Gap junctional intercellular communication (GJIC) plays a critical role in the regulation of cellular proliferation, differentiation, and during carcinogenesis.1 Gap junctions are clusters of intercellular channels connecting the cytoplasms of two adjacent cells. The channels, composed of two connexin-hexamer hemichannels provided by each of the neighboring cells, allow for a controlled diffusion of compounds of low molecular mass (<1 kDa) between cells, including nutrients, signaling molecules, and ions.2, 3 In the liver, connexin (Cx) 32 and Cx26 are the major Cx expressed in hepatocytes, whereas Cx43 is expressed at high levels in bile duct epithelial cells, hepatic stellate cells, and oval cells,4, 5 the two latter cell types being capable of further differentiating into hepatocytes or epithelial cells.6–8 GJIC is controlled at different levels, including Cx gene expression, posttranslational modification, and subcellular distribution of Cx molecules as well as the stabilization or anchoring of gap junctional channels in the cell membrane.

Cx phosphorylation may serve as a means of modulating GJIC in immediate response to extracellular stimuli, such as growth factors9, 10 or stressful agents.11–13 In contrast, changes in Cx expression may serve long-term control of GJIC. In addition to reports on transcriptional regulation,14 there is evidence for posttranscriptional control of Cx expression that was found with murine Cx43 messenger RNA (mRNA).15 However, no RNA-binding protein mediating such effects has been identified so far. Similar to Cx43, the expression of membrane-bound adhesion proteins interacting with Cx43 and stabilizing gap junctional clusters in the membrane, such as the adherens junction-associated protein β-catenin, was hypothesized to be controlled by RNA-binding proteins: in colon carcinoma cells, β-catenin expression was described to be controlled by HuR,16 an mRNA stabilizing protein related to the Drosophila ELAV (embryonic lethal abnormal vision) family of proteins17 known to be modulated by mitogenic and stress-causing agents.18, 19

The present study examines whether Cx43-based GJIC is regulated by HuR both directly, e.g., by controlling Cx43 levels, or indirectly, e.g., by controlling gap junctional channel integrity. As model system, an oval cell-like rat liver epithelial cell line (WB-F344) was employed, which expresses high levels of Cx43 and is capable of differentiating into hepatocytes.6, 20 Oval cells are liver progenitor cells activated during liver regeneration stimulated by liver injury induced by drugs, viruses, or toxins.21 We identify HuR as an RNA-binding protein that controls GJIC at least in part by enhancing Cx43 levels. Interestingly, modulation of Cx43 function by HuR is also indirect, by way of β-catenin, suggesting that GJIC is controlled by interaction of Cx43 with adherens junction proteins and at the posttranscriptional level. We further demonstrate that HuR promotes GJIC in cells exposed to retinoic acid or to a genotoxic agent, doxorubicin. Our data establish novel links between HuR, Cx43, and β-catenin and may offer an explanation for changes of GJIC and Cx43 levels in differentiating cells and during carcinogenesis.

Abbreviations

ActD, actinomycin D; ARE, AU-rich element; Cx, connexin; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GJIC, gap junctional intercellular communication; IP, immunoprecipitation; RA, retinoic acid; RBP, RNA-binding protein; RT-PCR, reverse transcription polymerase chain reaction.

Materials and Methods

Cell Culture and Transfections.

WB-F344 rat liver epithelial cells22 with stem cell-like properties6 were a kind gift of Dr. James E. Trosko (Michigan State University, East Lansing, MI). Cells were maintained as described.10 For small interfering RNA (siRNA) transfections, cells were transferred to 3-cm dishes 1 day before transfection. Cells were transfected using Oligofectamine reagent (Invitrogen, La Jolla, CA) and siRNAs (Table 1) using standard procedures.

Table 1. Sequences of Primer Pairs and siRNAs Employed in the Study
TargetSequences 5′ → 3′GenBank Entry
PCR Primers
18S rRNAgccgctagaggtgaaattcttgX01117
 cattcttggcaaatgctttcg 
β-actingtcgtaccactggcattgtgNM_031144
 ctctcagctgtggtggtgaa 
β-catenin #1ggccagtggtggaccccaagcctNM_053357
 aggccccagtgcctgcatccca 
β-catenin #2acgctgcataatctcctgctNM_053357
 gagcttgctttcctgattgc 
Cx43 #1ggcgtgaggaaagtaccaaaX06656, NM_012567
 acagcgaaaggcagactgtt 
Cx43 #2aacagtctgcctttcgctgtX06656, NM_012567
 aaagcgagagacaccaagga 
Cx43 #3agcctgaactctcatttttccttX06656, NM_012567
 ccatgtctgggcacctct 
GAPDHgatcgtggaagggctaatgaNM_017008
 ggatgcagggatgatgttct 
HuRttcgggataaagttgcaggaXM_344063
 tttgcagtaacatagttcacaaagc 
p21agcaaagtatgccgtcgtctNM_080782
 ggcgcttggagtgatagaaa 
SDHAcgagatccgtgaaggaagagNM_130428
 gcccatgttgtaatgcacag 
siRNAs (supplier)
Ctrl #1 (Qiagen)uucuccgaacgugucacguuu 
Ctrl #2 (Dharmacon)ugguuuacaugucgacuaa 
HuR #1 (Qiagen)aagaggcaauuaccaguuucaXM_344063
HuR #2 (Dharmacon)caacaagucccacaaauaauuXM_344063
Cx43 (Smart Pool, Dharmacon)caacaaccuggcugcgaaa, ugauugaaaugucgaguua, cgugaagggaagaagcgau, uuacugagauucugcgauaNM_012567
β-catenin (Smart Pool, Dharmacon)gaucuuagcuuacggcaauuu, gggagaagcccuuggauauuu, aagcugaccucauggaguuuu, guagaaacagcccguuguauuNM_053357

Determination of GJIC.

GJIC was determined as described10 by microinjecting the fluorescent dye Lucifer Yellow CH (Sigma, St. Louis, MO; 10% [wt/vol] in 0.33 M LiCl) into selected cells. One minute after injection, fluorescent cells surrounding the cells loaded with the dye were counted and taken as a measure of GJIC. Ten individual cells were loaded with dye per dish and means of the numbers of fluorescent neighboring cells were calculated.23

Determination of RNA Stability, RT-PCR.

The stability of Cx43 mRNA in cells treated with HuR siRNA or control siRNA was assessed by blocking transcription by addition of actinomycin D (ActD; final concentration: 2-5 μg/mL) and following the decay of Cx43 mRNA levels over time. RNA was isolated at various times following addition of ActD. Reverse transcription (Omniscript, Qiagen, Hilden, Germany) was followed by amplification of specific complementary DNAs (cDNAs) using classical polymerase chain reaction (PCR) procedures or real-time PCR with primer pairs listed in Table 1.

Western Blotting, Immunoprecipitation, Immunocytochemistry.

All immunochemical assays were described earlier.24 For Western blotting, cells were lysed in 0.5% (wt/vol) sodium dodecyl sulfate and protein concentrations determined in a bicinchoninic acid (BCA)-based protein assay (Pierce/Thermo Scientific, Bonn, Germany). Samples were applied to sodium dodecyl sulfate-polyacrylamide gels of 10% (wt/vol) acrylamide, followed by electrophoresis, blotting, and immunodetections using the following antibodies: rabbit polyclonal anti-Cx43 (Sigma), mouse monoclonal anti-HuR (Santa Cruz Biotechnology, Santa Cruz, CA), rabbit polyclonal anti-β-catenin (Abcam, Cambridge, UK), mouse monoclonal anti-GAPDH (Chemicon, Temecula, CA), and horseradish peroxidase-coupled goat antimouse and goat antirabbit as secondary antibodies (Amersham Pharmacia Biotech, Piscataway, NJ).

For immunoprecipitations, cells were grown to 80%-90% confluence on 10-cm dishes. Lysates prepared on ice in (10 mM Tris-HCl, pH 7.4, 5 mM ethylene diamine tetraacetic acid [EDTA], 2 mM dithiothreitol [DTT], 1 mM phenylmethylsulfonyl fluoride [PMSF], 2 μg/mL leupeptin, 2 μg/mL pepstatin, 140 mM NaCl, 1% [vol/vol] Triton X-100) were briefly centrifuged and supernatants taken for further analysis. Anti-Cx43 or β-catenin antibodies or nonspecific rabbit IgG (BD Biosciences, San Jose, CA) were added to lysates (75 μg of total protein) and incubated at 4°C overnight. Immunocomplexes were collected using protein A or G-agarose (Roche, Nutley, NJ); agarose beads were washed five times with 0.1% SDS/1% Triton-X in PBS. Precipitated proteins were then solubilized in SDS-PAGE buffer and analyzed by SDS-PAGE and Western blotting.

Immunoprecipitation of RNA-protein complexes and analysis of coprecipitated RNA were performed as described.25, 26 Immunocytochemistry was performed as described24 using the above-mentioned antibodies and Alexa 546- or Alexa 488-coupled secondary antibodies. Cells were embedded with ProLong Gold/DAPI mounting medium (Invitrogen), followed by fluorescence microscopic analysis with an AXIOVERT 200 M microscope (Zeiss, Oberkochen, Germany) or a confocal laser scanning microscope (LSM510 META, Zeiss).

Results

HuR Binds to Cx43 mRNA and Controls Gap Junctional Communication.

Analysis of the mRNA sequence of rat Cx43 (GenBank entry X06656) for the presence of AU-rich elements (ARE) revealed an AU-rich region in the 3′-untranslated region (3′-UTR). The presence of this sequence in Cx43 mRNA of WB-F344 cells was verified by RT-PCR, cloning, and sequencing of a region of ≈300 base pairs (boxed region in Fig. 1A; data not shown). This AU-rich part of Cx43 mRNA contains several AREs (AU-rich elements), such as the AUUUA pentamer sequences and UUAUUUA(U/A)(U/A) nonamer regions, which generally confer altered stability.27, 28 Increases in the half-lives of mRNAs carrying such AREs may be achieved by interaction with stabilizing RNA-binding proteins such as HuR. To test for an interaction of Cx43 mRNA with HuR, HuR was immunoprecipitated from WB-F344 cell lysates, followed by extraction of coprecipitated RNA and analysis by RT-PCR. Primers specific for Cx43 yielded a positive signal, suggesting that Cx43 mRNA was bound to precipitated HuR (Fig. 1B). Detection of p21waf1 mRNA served as a positive control of HuR/target mRNA interaction.18 In contrast, neither Cx43 mRNA nor p21 mRNA were detected in precipitates collected with an unspecific antibody (IgG lanes). Another control was the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA, an abundant housekeeping transcript that was amplified comparably in both the IgG and HuR samples (although slightly higher in HuR IP samples); the detection of GAPDH mRNA is expected in ribonucleoprotein/RNA coprecipitation assays, and it serves as a measure of nonspecific binding of any cellular RNA to beads or antibodies and further serves to monitor the evenness in sample input (Fig. 1B).

Figure 1.

Modulation of GJIC by HuR. (A) Schematic representation of rat Cx43 mRNA and localization of AU-rich elements. (B) Binding of HuR to Cx43 mRNA. Immunoprecipitates from lysates of WB-F344 cells were prepared employing an anti-HuR antibody or a control IgG. Coprecipitated mRNAs were identified by RT-PCR. Data are representative of at least three independent experiments. (C) Analysis of GJIC by dye transfer analysis in WB-F344 cells 48 hours after transfection of HuR-specific or control siRNA. Data are means ± standard error of the mean (SEM) (n = 3). Pictures of cultures with Lucifer Yellow microinjected into the central cell were taken after diffusion of Lucifer Yellow to neighboring cells had occurred. (D) WB-F344 cells were transfected with control or Cx43-specific siRNA, followed by determination of GJIC after 48 hours. Data are means ± standard deviation (SD) (n = 3).

If HuR stabilized Cx43 mRNA, depletion of HuR would likely result in lower cellular levels of Cx43 and a loss in GJIC. In fact, cells depleted of HuR using an siRNA approach were significantly less capable of GJIC, as intercellular spreading of microinjected fluorescent Lucifer Yellow was lowered by ≈60% (Fig. 1C). This loss of GJIC is attributed almost entirely to changes in activity of Cx43 rather than any other Cx: depletion of Cx43 by siRNA diminished GJIC to 7% of control (Fig. 1D).

HuR Depletion Lowers Cx43 and Cx43 mRNA and Reduces Cx43 mRNA Stability.

Depletion of HuR was reflected in a reduction in Cx43 protein levels, as seen in Western blots detecting at least three distinct bands of Cx43 that are known to correspond to nonphosphorylated Cx43 and to two different phosphorylation stages of Cx43. Real-time, quantitative PCR (qPCR) analysis revealed a 50% decrease in Cx43 mRNA steady-state levels for cells depleted of HuR (Fig. 2A,B). The half-life of Cx43 mRNA was also affected by depletion of HuR, changing from >6 hours in the Ctrl group to ≈5 hours in the HuR siRNA group as measured by conventional RT-PCR analysis (Fig. 2C). The stability of a housekeeping transcript (GAPDH mRNA) was comparable between both control and HuR siRNA groups (Fig. 2C). Thus, whereas GAPDH mRNA stability was unaltered by depletion of HuR, Cx43 mRNA stability was drastically lowered in the absence of HuR, as verified by real-time qRT-PCR of mRNA levels remaining after addition of actinomycin D to cell cultures (Fig. 2D). In summary, HuR stabilizes Cx43 mRNA: depletion of HuR lowered Cx43 mRNA steady-state levels and stability, diminished Cx43 protein levels, and reduced GJIC.

Figure 2.

Depletion of HuR decreases Cx43 levels and Cx43 mRNA stability. (A) WB-F344 cells were treated with HuR-specific or control siRNA for 48 hours, followed by real-time RT-PCR analysis of HuR and Cx43 mRNA levels. Data were normalized against 18S ribosomal RNA (rRNA) levels and control treatments were set to 1. Data are means of two independent experiments. (B) Western blot analysis of Cx43 levels in WB-F344 cells treated with control or HuR-specific siRNA. Depletion of HuR and loading of gels were controlled for by Western analysis of HuR and GAPDH levels. Data are means ± SEM (n = 3). (C) WB-F344 cells were transfected with control or HuR-specific siRNA for 30 hours, followed by exposure to actinomycin D for the indicated periods of time, lysis of cells and analysis of Cx43 mRNA levels by conventional RT-PCR. Changes in mRNA levels were assessed by densitometric analysis of ethidium bromide-stained PCR product bands in agarose gels and normalized against GAPDH mRNA. Normalized Cx43 mRNA levels prior to addition of actinomycin D were set to 100%. Data are means of two to three independent experiments ± SEM. (D) Cells were treated with actinomycin D as in (C), followed by real-time quantitative RT-PCR analysis of Cx43 and GAPDH mRNA levels in cells treated with control or HuR-specific siRNA. Data were normalized to 18S rRNA levels and are means of two independent experiments.

HuR Depletion Affects Subcellular Distribution of Cx43.

Immunocytochemical analyses revealed that, under control conditions, most of the cellular Cx43 (red) was detected as spots lined up at the plasma membrane (Fig. 3A). On the contrary, HuR (green) was mostly nucleoplasmic, with a minor fraction detected in the cytoplasm, as reported.29 In cell cultures with silenced HuR (Fig. 3B,C) cells with insufficient depletion were detected in the culture dishes; such regions were selected for display in Fig. 3B, as the effect of HuR depletion on Cx43 subcellular distribution is most obvious in these areas. Depletion of HuR caused an extensive redistribution of Cx43 from the cell membrane to the cytoplasm, with aggregates found in the perinuclear region (Fig. 3B). Two different siRNAs targeting different regions of the HuR mRNA (HuR#1 and HuR#2) were employed, resulting in a similar phenotype. In support of the hypothesis that depletion of HuR causes subcellular redistribution of Cx43, Cx43 is found in the plasma membrane in cells insufficiently deprived of HuR in cultures treated with HuR-specific siRNA (i.e., cells with green nuclei; see arrow in Fig. 3B). We set out to study the molecular basis for Cx43 redistribution in HuR-silenced cells.

Figure 3.

Subcellular localization of Cx-43 in cells depleted of HuR. (A,B) WB-F344 cells were treated with control or one of two different HuR-specific siRNAs for 48 hours, followed by immunocytochemical analysis by confocal microscopy of Cx43 (red) and HuR (green) localization. Nuclei were stained with DAPI (blue). The arrow indicates a cell with insufficiently depleted HuR displaying Cx43 localization similar to control cell conditions. (C) Western analysis of HuR levels in cells treated with control or HuR-specific siRNAs. GAPDH levels were analyzed after treatment with control and HuR siRNA. Images are representative of at least three independent experiments

Depletion of HuR Causes Loss of β-Catenin.

Cx43 is known to interact with adherens junction proteins, including β-catenin.30 In line with previous reports on HuR interacting with β-catenin mRNA and regulating its expression,16 β-catenin was found to be significantly lowered in cells treated with HuR siRNA (Fig. 4A). Similarly, β-catenin mRNA levels were decreased in these cells (Fig. 4B). Moreover, HuR was found to interact with β-catenin mRNA, as the transcript was detected in HuR immunoprecipitation samples, but not in immunoprecipitates with an unspecific IgG (Fig. 4C). The interaction of HuR with β-actin mRNA, a known HuR target, was tested as a positive control.31 Furthermore, the half-life of β-catenin mRNA was drastically lowered in rat liver epithelial cells depleted of HuR (Fig. 4D).

Figure 4.

Loss of β-catenin after HuR depletion and binding of HuR to β-catenin mRNA. (A) WB-F344 cells were treated with control or HuR-specific siRNA for 48 hours, followed by immunocytochemical and Western analysis of subcellular localization and levels of β-catenin (red) and HuR (green). Nuclei were stained with DAPI (blue). Data are representative of three independent experiments. (B) Real-Time RT-PCR analysis of HuR and β-catenin mRNA levels in cells treated with control or HuR-specific siRNA. Data were normalized against 18S rRNA levels and control treatments were set to 1. Data are means of two independent experiments. (C) Binding of HuR to β-catenin mRNA. Immunoprecipitates from lysates of WB-F344 cells were prepared employing an anti-HuR antibody or control IgG. Coprecipitated mRNAs were identified by real-time RT-PCR. RNA levels were normalized against succinate dehydrogenase mRNA. As a positive control, levels of coprecipitated β-actin mRNA were analyzed. (D) Cells were transfected and exposed to actinomycin D as described in the legend to Figure 2C, followed by real-time qRT-PCR analysis of β-catenin mRNA levels in cells treated with control or HuR-specific siRNA. Data were normalized to 18S rRNA levels and are means of two independent experiments.

Lowering β-Catenin Levels Recapitulates HuR Depletion in Reducing Cx43 Levels and Attenuating GJIC.

We then tested whether a reduction in the interaction of β-catenin and Cx43, such as might occur after HuR silencing, could explain the redistribution of Cx43 and the loss of GJIC. In cells depleted of β-catenin, GJIC decreased by 59% (Fig. 5A). Moreover, depletion of β-catenin coincided with a loss of Cx43 (Fig. 5B) of ≈54% (48 hours), similar to that observed after HuR depletion (Fig. 2B). This loss was still detectable, albeit less pronounced, at later time points following siRNA treatment.

Figure 5.

Depletion of β-catenin decreases GJIC and levels of Cx43 in WB-F344 cells. (A) Cells were transfected with control or β-catenin-specific siRNA for 48 or 72 hours, followed by determination of GJIC. Data are means ± SEM of three (48 hours) or means of two (72 hours) independent experiments. (B) Western analysis of β-catenin and Cx-43 levels in WB-F344 cells treated with β-catenin-specific siRNA for 48 or 72 hours. Cx43 protein levels as determined by densitometric analyses were related to GAPDH levels. Cx43/GAPDH ratios are given as means ± SEM (n = 3), with the 48 hours control set to 100. (C) Physical interaction of β-catenin and Cx43 as demonstrated by coimmunoprecipitation. Western blotting analysis of immunoprecipitates prepared from WB-F344 cell lysates (75 μg of total protein) employing anti-β-catenin or anti-Cx43 antibodies or a nonspecific rabbit IgG as negative control. Cell lysate (20 μg of protein) was analyzed as input control.

In coimmunoprecipitation experiments, a physical interaction of β-catenin and Cx43 was demonstrated to occur: β-catenin was detected in Cx43 immunoprecipitates and, vice versa, Cx43 detected in β-catenin immunoprecipitates, whereas no signals were detected in immunoprecipitates employing an unspecific antibody (Fig. 5C). In support of an interaction between Cx43 and β-catenin, extensive colocalization of these proteins was detected by immunocytochemistry (see merged pictures in Fig. 6A).

Figure 6.

Depletion of β-catenin alters the subcellular distribution of Cx43. (A) WB-F344 cells were treated with control or β-catenin-specific siRNA for 48 hours. Subcellular localization of β-catenin (red) and Cx43 (green) were analyzed by immunostaining and fluorescent microscopy. Nuclei were stained with DAPI (blue). Images are representative of results from three independent experiments. (B) Schematic summary of the suggested role of HuR in control of GJIC: HuR, by stabilizing Cx43 (a) and β-catenin mRNA (b) supports Cx43 and β-catenin protein accumulation. Cx43 transport to the cell membrane (c) is supported by β-catenin (d). Once in the membrane, Cx43 may contribute to formation of functional Cx hexamer hemichannels (e). See text for further details.

The subcellular redistribution and cytoplasmic accumulation of Cx43 that was induced by depletion of HuR (Fig. 3) was also seen in cells depleted of β-catenin (Fig. 6A). Both the extent of β-catenin/Cx43 colocalization (merged pictures in Fig. 6A) and the levels of both β-catenin and Cx43 (left panel in Fig. 6A) were significantly lowered by depletion of β-catenin. In summary, the effects induced by HuR depletion, i.e., loss of GJIC, redistribution of Cx43 and downregulation of Cx43 levels, were mimicked by depletion of β-catenin, the expression of which is controlled by HuR and which interacts with Cx43 (see Fig. 6B).

Role of HuR in the Modulation of GJIC During Exposure to Doxorubicin or Retinoic Acid.

As the abundance and activity of HuR are affected both by genotoxic agents and during differentiation,19, 32 we set out to test for the consequences of HuR depletion for the modulation of GJIC by doxorubicin, a DNA intercalator and topoisomerase inhibitor,33 and by a stimulator of cellular differentiation processes, retinoic acid.

High concentrations of doxorubicin (>25 μM) cause a loss of GJIC in WB-F344 cells.12 In line with these observations, lower doses of doxorubicin (1 μM) did not affect GJIC, even after 24 hours of exposure (Fig. 7A). These same conditions of doxorubicin treatment, however, caused a highly significant loss in GJIC in cells depleted of HuR in addition to the loss elicited by HuR depletion per se (Fig. 7A). These findings imply that HuR stabilizes Cx43-dependent GJIC and protects against doxorubicin-induced loss of GJIC.

Figure 7.

Doxorubicin and RA modulate GJIC: role of HuR. WB-F344 cells were transfected with control or HuR-specific siRNA, followed by exposure to doxorubicin (A; 1 μM for 24 hours) or all-trans-RA (B; 1 or 10 μM for 24 and 48 hours) and determination of GJIC. Data are given as means ± SD (n = 3). Analysis of variance (ANOVA) with Student-Newman-Keuls posttest was used for the determination of statistical significance between treatment groups. P < 0.05 was selected as the level of significance. Treatment groups are significantly different from each other if no labeling letter (a to e) is shared between groups.

GJIC was previously described to be modulated by exposure of cells to all-trans retinoic acid (RA).34, 35 Here, a biphasic response to RA was observed in WB-F344 cells, with lower concentrations (1 μM) enhancing and higher concentrations (10 μM) strongly attenuating GJIC after exposure for 24 or 48 hours (Fig. 7B). In the absence of HuR, RA (1 μM)-induced elevation of GJIC is less pronounced and no longer significant after 48 hours of incubation with RA. Again, HuR appears to support GJIC by promoting low-dose RA-induced elevation of GJIC.

Discussion

HuR Is a Novel Modulator of GJIC.

HuR was reported to stabilize mRNAs encoding crucial regulators of cellular proliferation, differentiation, and stress response, such as p21waf, p53, cyclins, and SIRT1.18, 19 A strong correlation between the abundance of HuR and cancer has been established and the posttranscriptional modulatory effects of HuR on the expression of a variety of target genes were suggested to affect carcinogenesis.36

The present study documents a role for HuR in controlling GJIC. GJIC has been recognized as a modulator of carcinogenesis. Trosko and Ruch1 indicated that this may occur at different levels: GJIC is low or even absent in many tumor cells, and deficiency in certain Cx renders cells prone to carcinogenic changes. For example, various genotoxic agents such as ultraviolet radiation and oxidative stress11, 37 or tumor promoters and carcinogens decrease GJIC, either by suppressing Cx expression, by impairing intracellular Cx trafficking, or by inducing posttranslational modifications such as phosphorylation, causing a decreased gap junction channel conductance (for review, see Ref.38).

Although Cx43 is the major Cx in WB-F344 cells, these cells also express Cx26 and, depending on culture conditions and degree of differentiation, Cx32.39, 40 The changes in GJIC observed in the present study were almost entirely changes in Cx43-dependent GJIC, as siRNA-based knockdown of Cx43 lowered GJIC in WB-F344 cells to ≈7% of control (Fig. 1D).

Interestingly, it is HuR depletion, rather than overexpression, that causes a loss in GJIC (Fig. 1C). Although this may seem contradictory in view of the aforementioned hypothesized procarcinogenic roles of abundant HuR and of an impaired GJIC, it should be noted that the general statement that HuR levels are enhanced in tumor versus normal tissue does not apply to all tissues analyzed so far; for example, cytoplasmic HuR levels in human hepatocellular carcinoma samples tended to be lower than in nontumor (cirrhotic) samples.16 Moreover, the effects observed after depletion of HuR by siRNA not necessarily require the absence of HuR protein but may also be due to the absence of HuR activity. Modulation of HuR RNA binding activity may be achieved by posttranslational modification, most prominently phosphorylation. Although phosphorylation of HuR by the cell cycle regulating kinase Cdk141 results in a predominantly nuclear localization, phosphorylation by PKC isoforms coincided with its translocation to the cytoplasm.32 Furthermore, checkpoint kinase Chk2-dependent phosphorylation in the RNA binding regions of HuR causes a loss of interaction between HuR and SIRT1 mRNA.26 Interestingly, whereas Chk2 is generally regarded a tumor suppressor, the latter mechanism would provide a potential link between an initiation event, i.e., DNA damage, and a loss of GJIC: DNA damage-induced stimulation of Chk2-dependent HuR phosphorylation reduces interaction with target mRNA, resulting in a decreased GJIC. Such a response is indeed observed in the present study, provided HuR levels are well below basal levels: in cells largely depleted of HuR by siRNA, doxorubicin causes a loss of GJIC (Fig. 7A). A reason for this effect being observed only under conditions of HuR deficiency could be that it is a route of minor importance that would normally be overruled by abundant HuR. Whether or not this effect indeed relies on residual HuR surviving siRNA-based depletion of HuR (see Fig. 3B) and on DNA damage-induced modulation of HuR activity remains to be established.

Modulation of GJIC by HuR Through Cx43/β-Catenin Interaction.

In addition to HuR directly controlling Cx43 levels by stabilizing Cx43 mRNA, Cx43 levels also appear to be controlled by HuR in an indirect fashion, by way of β-catenin. β-Catenin contributes to cell-cell adhesion by interacting with cadherins and by establishing physical interaction of adhesion proteins with the actin cytoskeleton. Intact cell adhesion complexes appear to be required for proper assembly of Cx to form functional gap junctional intercellular channels.42, 43 The physical interaction of β-catenin and Cx43 was demonstrated in this work (Fig. 5C) and elsewhere.44 Hence, depletion of β-catenin is likely to result in a loss of GJIC. In addition to β-catenin controlling Cx43 expression levels44 and proper positioning of Cx43 hemichannels in the plasma membrane, β-catenin was recently demonstrated to also govern transition of Cx43 from the microtubular transport machinery to the plasma membrane30: hence, accumulation of Cx43 in the cytoplasm under conditions of depletion of HuR (Fig. 3) or β-catenin (Fig. 6) most likely reflects an insufficient transport of Cx43 to the plasma membrane rather than internalization of improperly positioned Cx43.

Cx and β-Catenin in Oval Cells.

Oval cells are liver progenitor cells activated during liver regeneration stimulated by liver injury.21 β-Catenin expression is enhanced following stimulation of oval cell differentiation.45 Similarly, Cx levels are altered during differentiation to hepatocytes: whereas Cx43 is the major Cx in hepatic stellate or oval cells, hepatocytes express Cx32 at high levels and carry almost no Cx43.5 It is presently unknown if HuR levels and/or function are affected by oval cell activation and whether HuR affects the differentiation of oval cells. However, our present study suggests that changes in GJIC that are known to occur during differentiation and to affect its progress are affected by HuR levels: RA-induced changes in GJIC were modulated by HuR depletion (Fig. 7B).

Conclusion.

It is demonstrated here for the first time that the RNA-binding protein HuR controls GJIC by two molecular mechanisms. First, HuR interacts with Cx43 mRNA, enhances its stability, and elevates Cx43 protein levels. Second, HuR interacts with and stabilizes β-catenin mRNA, enhancing β-catenin abundance; β-catenin, in turn, helps to maintain Cx43 levels and localize Cx43 properly on the plasma membrane, thereby ensuring the integrity of GJIC. These data are summarized in Fig. 6B. Our results provide a novel link between HuR, Cx43, β-catenin as well as GJIC and may set a basis for further understanding of changes in GJIC in differentiating liver cells or during hepatocarcinogenesis.

Acknowledgements

We thank Elisabeth Sauerbier for excellent technical assistance and Professors Andre Menke and Klaudia Giehl, University of Ulm, Germany, for helpful discussion and Dr. Verena Keitel, University of Düsseldorf, for help with confocal microscopy.

Ancillary