SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References
  7. Supporting Information

The liver is considered to be an immune-privileged organ that favors the induction of tolerance. The underlying mechanisms are not completely understood. Interestingly, liver transplants are spontaneously accepted in several animal models, but hepatocyte transplants are acutely rejected, suggesting that liver nonparenchymal cells may effectively protect the parenchymal cells from immune attack. We have shown the profound T cell inhibitory activity of hepatic stellate cells (HSCs). Thus, cotransplantation with HSCs effectively protects islet allografts from rejection in mice. In this study, using T cell receptor transgenic and gene knockout approaches, we provided definitive evidence that HSCs protected cotransplanted islet allografts by exerting comprehensive inhibitory effects on T cells, including apoptotic death in graft-infiltrating antigen-specific effector T cells and marked expansion of CD4+ Forkhead box protein (Foxp)3+ T regulatory (Treg) cells. All these effects required an intact interferon-γ (IFN-γ) signaling in HSCs, demonstrated by using HSCs isolated from IFN-γ receptor 1 knockout mice. B7-H1 expression on HSCs, a product molecule of IFN-γ signaling, was responsible for induction of T cells apoptosis, but had no effect on expansion of Treg cells, suggesting that undetermined effector molecules produced by IFN-γ signaling is involved in this process. Conclusion: Upon inflammatory stimulation, specific organ stromal cells (such as HSCs in the liver) demonstrate potent immune regulatory activity. Understanding of the mechanisms involved may lead to development of novel strategies for clinical applications in transplantation and autoimmune diseases. (HEPATOLOGY 2009.)

Hepatic tolerance has been recognized by spontaneous acceptance of liver transplants in several animal models1 and by induction of tolerance to antigens delivered through the portal vein.2 Compared with other organ transplants, human liver transplants manifest absence of hyperacute rejection and low incidence of chronic rejection.3 A certain percentage of liver transplantation patients have been weaned from immunosuppression without graft rejection.2 Interestingly, liver allografts are accepted, whereas hepatocyte transplants are acutely rejected,4 suggesting that liver nonparenchymal cells play a role in protecting parenchymal cells (hepatocytes) from immune injury. We have examined a variety of mouse liver nonparenchymal cells, and found that hepatic stellate cells (HSCs), abundant liver stromal cells known for storing retinoids and participating in fibrogenesis, have potent immune regulatory activity. HSCs can effectively protect islet allografts from rejection when they are cotransplanted.5, 6

Interferon-γ (IFN-γ) is an important proinflammatory cytokine mainly produced by T helper 1 cells and natural killer cells, mediating both innate and adaptive immune responses. Recent accumulating evidence suggests that IFN-γ is also critical for tolerance induction.7–12 Thus, IFN-γ stimulation is required for liver transplant tolerance, because liver allografts transplanted into wild-type (WT) mice achieve long-term survival, whereas no allografts survived beyond 14 days in IFN-γ−/− recipients or IFN-γ receptor (IFN-γR)−/− allografts in WT recipients.13 The underlying mechanisms are not completely understood.8

In this study, we demonstrated that islet allografts achieved long-term survival when HSCs were cotransplanted, which required IFN-γ stimulation to HSCs, because HSCs isolated from IFN-γR1 knockout (KO) mice were unable to provide the same degree of protection. Cotransplanted HSCs inhibited T cell responses through elimination of graft infiltrating effector T cells and expansion of CD4+ Forkhead box protein (Foxp)3+ T regulatory (Treg) cells. Both effects required IFN-γ stimulation. B7-H1, a downstream product of IFN-γ signaling, contributes to deletion of effector T cells, but has no effect on expansion of Treg cells, suggesting that another as-yet unidentified IFN-γ signaling product participates in this process.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References
  7. Supporting Information

Mice.

Male C57BL/6 (B6; H-2b), C3H (H-2k), BALB/c (H-2d), and IFN-γR1 KO (B6.129S7-Ifngr1tm1Agt/J) mice were purchased from the Jackson Laboratory (Bar Harbor, ME). B7-H1 KO mice were kindly provided by Dr. Lieping Chen (Johns Hopkins University Medical School, Baltimore, MD). 2C (H-2b) and DES (H-2k) T cell receptor (TCR) transgenic mice, expressed Ld and H-2Kb specific TCR transgene on CD8+ T cells, respectively. All mice were used under National Institutes of Health guidelines.

Preparation of HSCs.

HSCs were isolated from the mouse liver nonparenchymal cells as described.5 The liver was perfused through the portal vein with collagenase IV. The smashed cells were filtered through a nylon mesh. The HSCs were purified by Percoll density gradient centrifugation, and cultured in complete medium supplemented with 20% fetal bovine serum for 7 to 14 days unless otherwise indicated. The purity of HSCs ranged from 90% to 95% determined by desmin immunostaining.

Islet Transplantation.

Diabetes was induced in recipients with a single intraperitoneal injection of streptozotocin (180 mg/kg; Sigma-Aldrich, St. Louis, MO). Only the mice with blood glucose exceeding 350 mg/dL were used in experiments. Islets were isolated from donor pancreata by way of collagenase V digestion, and separated on a Ficoll gradient (Type 400, Sigma-Aldrich). The islets were purified by hand picking. Three hundred islets alone or mixed with 3 × 105 HSCs were aspirated into polyethylene tubing (PE-50), pelleted by gent centrifugation, and placed under renal capsule. Transplantation was considered successful when blood glucose returned to and remained normal (≤150 mg/dL) for 4 days after transplantation. The first day of two consecutive readings of blood glucose greater than ≥350 mg/dL was defined as the date of graft failure. No immunosuppressive agents were administered throughout the experiment.

Glucose Tolerance Test.

Following fasting overnight, mice were intraperitoneally injected with 50% dextrose solution at 2 g/kg. Blood glucose and insulin were measured before and after glucose injection at indicated times by way of glucosemeter and enzyme-linked immunosorbent assay kit (Linco Research, St. Charles, MO), respectively.

Flow Cytometric Analysis.

Anti-CD4, -CD8, -CD25, -CD44, -CD62L, and –IFN-γ monoclonal antibodies (mAbs) and annexin V detection kit were purchased from BD PharMingen (San Diego, CA). The DES TCR determinant was stained with anti-DES mAb. The appropriate isotype-matched irrelevant antibodies (Abs) were used as controls in all experiments. Flow cytometry analysis was performed on a FACSCalibur flow cytometer (BD Biosciences). For carboxyfluorescein diacetate succinimidyl ester (CFSE) labeling, cells (107/mL) wer incubated with 2.5 mol/L CFSE (Molecular Probes, Eugene, OR) for 8 minutes. For intracellular IFN-γ staining, cells were prefixed using 2% paraformadehyde, permeabilized by 0.1% saponin in 0.1% bovine serum albumin solution. Foxp3 was stained using fixation and permeabilization buffers in a Foxp3 kit (eBioscience, San Diego, CA).

Caspase Activity.

Thirty-microgram proteins isolated from cells were incubated with caspase-3–specific fluorescent substrate Ac-DEVD-AFC (20 μM) for 30 minutes and measured by a fluorescence spectrometer (Tecan, Hayward, CA) at 400 nm/505 nm.

Immunohistochemistry.

Cryostat sections were stained using anti-CD4, -CD8 (BD PharMingen), or -Foxp3 mAb (FJK-16s, eBioscience). The color was developed using avidin-biotin-alkaline phosphatase complex as the substrate. Insulin was identified using anti-insulin mAb (Santa Cruz Biotechnology, Santa Cruz, CA) and developed color using 3-amino-9-ethylcarbazole. Isotype-matched irrelevant Abs were used as controls. The slides were counterstained with Harris' hematoxylin. The immunofluorescence protocols were also used for CD4, CD8, and Foxp3 staining. Collagen was stained overnight by Sirius Red (saturated picric acid with 0.1% Sirius Red F3BA; Sigma-Aldrich).

Quantitative Real-Time Polymerase Chain Reaction.

Total RNA was extracted with TRIzol Reagent. Complementary DNA was synthesized with SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA). The primers were GACTGGCTTCATGTCCATTCAC/GTT GGG TTG TCA CAG CAT GGT for granzyme B and TGCCACTCGGTCAGAATGC/CGGCGGAGGGTAGTCACAT for perforin. The messenger RNAs were quantified using Applied Biosystems 7500 Fast PCR System in duplicate. The expression levels were normalized to 18S messenger RNA.

Statistical Analysis.

Graft survival between groups of transplanted animals was compared using the log-rank test. The statistical significance of parametric data was determined using the Student t test. P <0.05 was considered statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References
  7. Supporting Information

Expression of B7-H1 on HSCs in Response to IFN-γ Stimulation.

HSCs isolated from B6 mice were incubated with various concentrations of mouse IFN-γ (0.1-200 U/mL) for 24 hours. Expression of B7-H1 analyzed by way of flow cytometry was enhanced after treatment with IFN-γ at as low as 0.1 U/mL, reaching a maximum at 10 U/mL in a dose-dependent manner (Fig. 1A). To study time course, HSCs were exposed to IFN-γ (100 U/mL) for 3 to 48 hours. B7-H1 expression began to increase after 3-hour exposure and continued thereafter in a time-dependent manner, with maximal expression at 24 to 48 hours (Fig. 1B). IFN-γ specifically interacts with IFN-γR containing the IFN-γR1 binding chain and internal IFN-γR2 transducing chain.12 Expression of B7-H1 on HSCs isolated from IFN-γR1 KO mice showed no response to IFN-γ (Fig. 1C), indicating that B7-H1 expression depends on IFN-γ signaling. This was supported by the fact that B7-H1 response to IFN-γ-stimulation was almost entirely absent on HSCs from Stat1−/− mice (Fig. 1D), because Stat1 is a key transcription mediator for IFN-γ signaling.14 Expression of B7-H1 on IFN-γR1−/− HSCs was slightly increased by coculture with activated T cells (Fig. 1C), suggesting that activated T cells may produce other factors, participating in up-regulation of B7-H1. Different from activated HSCs, expression of B7-H1 on quiescent HSCs (culture for 2 days instead of 7-14 days) was only marginally up-regulated in response to IFN-γ (Supporting Fig. 1).

thumbnail image

Figure 1. Expression of B7-H1 on HSCs in response to IFN-γ stimulation. (A) HSCs isolated from B6 (H-2b) mice were exposed to graded concentrations of IFN-γ (0.1-200 U/mL) for 24 hours in vitro and stained with anti–B7-H1 mAb or (B) HSCs were incubated with IFN-γ (100 U/mL) for varying times (3-48 hours) and analyzed by way of flow cytometry. The filled areas represent isotype controls. (C) B7-H1 expression on HSCs is dependent on IFN-γ stimulation. HSCs isolated from WT or IFN-γR1 KO mice (both on B6 background) were exposed to IFN-γ (100 U/mL), or cultured with activated B6 T cells (precultured with irradiated BALB/c [H-2d] dendritic cells at a dendritic cell:T cell ratio of 1:20 for 2 days) at an HSC:T cell ratio of 1:20 for 48 hours, or (D) HSCs isolated from WT or Stat1 KO mice (B6 background) were exposed to IFN-γ (100 U/mL) for 48 hours. Cells were stained using anti–B7-H1 mAb and analyzed by way of flow cytometry, displayed as histograms. The nonfilled areas represent isotype controls. The data are representative of two separate experiments.

Download figure to PowerPoint

HSCs Deficient in IFN-γR1 or B7-H1 Expression Lose the Capacity to Protect Cotransplanted Islet Allografts.

BALB/c islet allografts were mixed with B6 HSCs and cotransplanted under the renal capsule of the streptozotocin-induced diabetic B6 recipients. Islet allografts transplanted alone, serving as controls, were rejected within 15 days, while cotransplantation with WT HSCs effectively protected islet allografts from rejection (Fig. 2A; P <0.05, islet versus islet + WT HSCs) with 60% grafts achieving long-term survival (>90 days). Removal of the kidney bearing the islet grafts were performed at various times (from day 90 to 170) in all animals maintaining long-term euglycemia, and resulted in a prompt recurrence of hyperglycemia (data not shown), indicating the euglycemia was maintained by the functioning subcapsular islet transplants. Fig. 2B shows photomicrographs of the revascularized islet grafts obtained 142 days after cotransplantation with HSCs. Insulin production is demonstrated by immunohistochemical staining with anti-insulin mAb. Glucose tolerance tests in three recipients with long-term surviving islet allografts showed normal response to glucose challenge, indicating that the islet allografts cotransplanted with HSCs maintain long-term function (Supporting Fig. 2). The collagen deposition was assessed in islet allografts alone or cotransplanted HSCs by way of Sirius Red staining. The presence of HSCs did not enhance collagen deposition at early stage (day 7) posttransplantation, compared with islet alone grafts, while Sirius Red material markedly increased in long-term surviving islet allografts, indicating a deposition of large amounts of collagens (Supporting Fig. 3).

thumbnail image

Figure 2. IFN-γ signaling and B7-H1 expression are required for HSCs to protect islet allografts. Three hundred freshly isolated islets from BALB/c (H-2d) mice were mixed with 5 × 105 HSCs from WT, B7-H1 KO, or IFN-γR1 KO mice (all on B6 [H-2b] background) and transplanted under renal capsule of streptozotocin-induced diabetic B6 recipients. Transplantation of islet allografts alone served as controls. No immunosuppressive reagents were administered. Survival of the islet allografts was determined by examination of the blood glucose levels. (A) Cotransplantation with HSCs effectively protected islet allografts from rejection (P <0.05, WT HSCs versus islet alone), which was dependent on expression of B7-H1 or IFN-γR1 (P <0.05, WT HSCs versus B7-H1 KO or IFN-γR KO HSCs). (B) The islet allografts were harvested from a mice receiving islet and HSC cotransplantation for 142 days. Left panel: vigorous revascularization was seen in islet allografts (white area). Right panel: the graft sections were stained with anti-insulin mAb (red).

Download figure to PowerPoint

To address the role of IFN-γ signaling and its product B7-H1 in immune regulatory activity of HSCs, islet allografts were cotransplanted with HSCs isolated from IFN-γR1−/− or B7-H1−/− (both on B6 background). HSCs deficient in either B7-H1 or IFN-γR1 largely lost their protective effect on islet allografts (Fig. 2A; both p <0.05 versus WT HSC group), indicating that the protection of islet allografts by cotransplanted HSCs requires IFN-γ stimulation, and that its downstream product, B7-H1, is a crucial effector molecule.

HSCs Cotransplantation Attenuates CD8+ T Cells in Islet Allografts.

In order to study the effect of HSCs on T cell responses, we harvested the islet grafts, spleens, and draining (kidney hilium) and irrelevant lymph nodes (LNs) from the recipients of islet allograft alone or cotransplantation at various postoperative days (PODs). Flow analysis of T cells isolated from these tissues showed that HSC cotransplantation had little effect on the percentages of CD4+ and CD8+ cells in all tested compartments on POD 7. However, by POD 14, the proportion of CD4+ T cells in HSC-cotransplanted islet grafts significantly increased, while the percentage of CD8+ T cells conversely decreased in HSC-cotransplanted groups. These changes were further enhanced in cotransplanted recipients with long-term surviving islet allografts (Fig. 3A). However, the actual number of CD4+ and CD8+ T cells within the allografts showed that HSC cotransplantation led to significant reduction of CD8+ T cell numbers in islet grafts on POD 7 and decreased continuously thereafter. CD4+ T cells in HSC-cotransplanted grafts were reduced on POD 7, compared with the islet-only group, but they were not further significantly decreased on POD 14 and long-term (Fig. 3B). These data suggest that HSC cotransplantation is associated with marked reduction of CD8+ T infiltrates in islet allografts but has little effect on the systemic CD8+ T cell pool.

thumbnail image

Figure 3. Cotransplantation of HSCs leads to reduction of CD8+ T cells in islet allografts. BALB/c (H-2d) islets mixed with 5 × 105 HSCs from B6 (H-2b) mice were transplanted under renal capsule of diabetic B6 recipients. Transplantation of BALB/c islet allografts alone served as control. Animals were sacrificed on POD 7, 14, and >90 (long-term). Lymphocytes isolated from the islet grafts, spleen, and irrelevant (I-) and draining (D-) LNs were triple-stained for CD3, CD4, and CD8 and analyzed by way of flow cytometry (n = 3 in each group). (A) Percentage of CD4+ and CD8+ cells in CD3+ population, expressed as the mean ± 1 standard deviation. (B) Absolute number of CD4+ and CD8+ cells in islet grafts were calculated based on flow analysis data, expressed as cell numbers/graft. (C,D) Cotransplantation of HSCs does not inhibit activation of CD8+ T cells. (C) Lymphocytes isolated from the grafts on POD 7 were stained with anti-CD62L, -CD44, or -IFN-γ mAbs and analyzed by way of flow cytometry gated on CD8+ cell populations; RNA was isolated from CD8+ T cells purified from the isolated lymphocytes. (D) Messenger RNA expression of granzyme B and perforin was examined by way of quantitative polymerase chain reaction.

Download figure to PowerPoint

To determine whether the HSC-induced reduction of CD8+ T cells was a result of impaired activation, expression of activation-related molecules CD44, CD62L, IFN-γ, granzyme B, and perforin in CD8+ T cells was examined using flow cytometry (protein) or quantitative polymerase chain reaction (messenger RNA). HSC cotransplantation did not suppress expression of CD44, CD62L, IFN-γ, granzyme B, and perforin in either islet grafts or draining LNs (Fig. 3C,D), suggesting that the reduction of CD8+ T cells is likely not a consequence of inhibiting activation.

HSC Cotransplantation Promotes Apoptosis in Specific CD8+ T Cells.

We used TCR transgenic markers to track the fate of allospecific CD8+ T cells. CFSE-labeled DES TCR transgenic T cells at 1.5 × 107(H-2k background, CD8+ T cells specifically recognize H-2b antigen) were adoptively transferred on POD 4 into C3H (H-2k) recipients after transplantation of allogeneic (B6, H-2b) islets with or without C3H HSCs. Lymphocytes were isolated 1 to 3 days after adoptive transfer, from islet allografts, spleen, draining and irrelevant LNs, and double-stained with DES clonotypic and anti–annexin V mAbs for flow analysis. Very few dividing DES+ cells were detected in the spleen and irrelevant LNs (data not shown), whereas dividing DES+ cells were clearly identified in draining LNs and islet allografts. Compared with islet allograft alone, cotransplantation with HSCs demonstrated little effect on DES+ cells in draining LNs, but the presence of HSCs was associated with marked reduction (≈50%) of DES+ cells in the allograft in both percentage and absolute number (Fig. 4A, upper and right panels). The reduction was seen predominantly in dividing DES+ cell population (Fig. 4A, upper left panel), indicating that HSCs induced deletion of activated specific CD8+ T cells. In contrast to the islet–only group, in which ≈90% of dividing DES+ cells were annexin Vlow, ≈45% dividing DES+ cells were annexin Vhigh in the islet grafts cotransplanted with HSCs (Fig. 4A, lower panel), suggesting that HSCs induced reduction of specific CD8+ T cells is a consequence of apoptotic death.

thumbnail image

Figure 4. HSCs induce specific CD8+ T cell apoptosis in islet grafts. Islets from B6 (H-2b) donors were mixed with HSCs from C3H (H-2k) mice, and transplanted into diabetic C3H recipients. Transplantation of islet allografts alone served as control. On POD 4, recipients were intravenously injected with 1.5 × 107 CFSE-labeled T cells from DES TCR transgenic mice (H-2k, CD8+ T cells specifically recognizing H-2Kb antigen). Two days later, lymphocytes were isolated from islet allografts and draining LNs and double-stained with anti-DES and anti–annexin V mAbs for flow analysis. (A) CFSE dilution analysis. The number represents the percentage of DES+ cells in each group. Dividing DES+ cells were identified in both draining LNs and islet grafts. Right panel: The absolute number of DES+ cells was calculated based on flow analyses. A marked reduction of DES+ cells was demonstrated in islet allografts that were cotransplanted with HSCs, but not in draining LNs. Lower panel: expression of annexin V was analyzed on dividing and nondividing DES+ cells in the islet allografts, respectively. HSC-induced reduction of DES+ cells is associated with enhanced apoptotic activity in a dividing cell population. (B) Cotransplanted HSCs exert local effect. Islet allografts and HSCs were cotransplanted in the left kidney; the same number of islet allografts without HSCs were transplanted in the right kidney. CFSE-labeled DES T cells were intravenously given on POD 4. Left panels: lymphocytes were isolated from islet allografts and draining LNs 2 days later and stained with anti-DES mAb for flow analysis and CFSE dilution analysis. Right panel: the absolute number of DES+ cells was calculated based on flow analysis. (C) HSCs induce apoptosis in activated specific CD8+ T cells in vitro. CFSE-labeled T cells at 2 × 106 and isolated from DES TCR transgenic mice were cultured with irradiated B6 spleen cells and at a ratio of 1:1 for 4 days. Irradiated HSCs from C3H mice (H-2k) were added at the beginning of the culture at an HSC:T cell ratio of 1:40, 1:20, or 1:10. Cells were double-stained with anti-DES and -annexin V mAbs for flow analysis gated on DES+ cell populations. Upper left panels: addition of HSCs was associated with reduction of dividing DES+ T cells in a dose-dependent manner. Right panel: the corresponding absolute number of dividing and nondividing DES+ cells in each group, based on flow analysis, expressed as the mean ± 1 standard deviation. Lower panels: analysis of annexin V expression in dividing cell populations. The data are representative of three experiments.

Download figure to PowerPoint

To determine whether the HSCs exerted a systemic effect, DES T cells were adoptively transferred into the recipients that were simultaneously transplanted islet allografts in both kidneys, whereas HSCs were cotransplanted only in the left kidney. Flow analysis revealed that dividing DES+ cells were markedly less in islet allografts in the kidney where HSCs were cotransplanted (Fig. 4B), indicating that the effect of cotransplanted HSCs is locally mediated.

To obtain direct evidence of HSCs inducing apoptosis in specific CD8+ T cells, graded numbers of HSCs from C3H mice were added into a culture of CFSE-labeled DES T cells whose activation was elicited by irradiated allogeneic (B6) spleen cells. The addition of HSCs was associated with a marked reduction of dividing DES T cells (both percentage and absolute numbers) with increase in expression of annexin V in a dose-dependent manner, indicating that HSCs induce apoptosis in activated CD8+ T cells (Fig. 4C). This was confirmed by the results of caspase activity analysis. The presence of HSCs enhanced T cell caspase-3 activity in a dose-dependent manner (Supporting Fig. 4).

IFN-γ/B7-H1 Axis Is Essential for HSC-Induced Deletion of Specific CD8+ T Cells.

To examine whether IFN-γ signaling and expression of B7-H1 were required for HSC-mediated apoptosis of CD8+ T cells in the islet allografts, cotransplanted HSCs were isolated from IFN-γR1−/− or B7-H1−/− mice. HSCs from WT mice served as controls (n = 3 in each group). The lymphocytes were isolated from the islet allografts on POD 7 and 14 and stained with anti-CD8 mAb for flow cytometry analysis. Comparison of CD8+ T cell number in the islet grafts revealed that IFN-γR1−/− or B7-H1−/− HSCs induced significantly less reduction of CD8+ T cells on either POD 7 or 14 (Fig. 5A; both P <0.05 versus WT), and the numbers were similar to levels seen in the islet allografts alone (POD 7), suggesting that an intact IFN-γ signaling and expression of B7-H1 are essential for HSC-induced deletion of CD8+ T cells. Because all islet allografts transplanted alone were rejected before POD 14, corresponding values on POD 14 could not be obtained for comparison (Fig. 5A).

thumbnail image

Figure 5. Elimination of graft CD8+ T cells is dependent on expression of IFN-γ receptor and B7-H1 on cotransplanted HSCs. Islets from BALB/c (H-2d) donors were mixed with HSCs from B7-H1−/− or IFN-γR1−/− (both on B6 [H-2b] background) mice (HSCs from WT B6 mice were used for comparison), and transplanted into diabetic B6 recipients. Transplantation of BALB/c islets alone served as a control (n = 3 in each group). (A) CD8+ T cells in islet allografts. Animals were sacrificed on POD 7 and 14, and the islet allografts were sectioned and staining with anti-CD8 mAb for immunohistochemical analyses. A total of 10 high-power fields were randomly selected in each graft for CD8+ cells enumeration. The data are expressed as the mean cell number/graft ± 1 standard deviation. Islet allografts transplanted alone were rejected before POD 14, therefore the related data were absent. (B,C) Use of TCR transgenic T cell adoptive transfer. On POD 3, recipients were intravenously given 1.5 × 107 CFSE-labeled T cells from 2C TCR transgenic mice (H-2b). Three days later, lymphocytes were isolated from islet allografts and stained with anti-CD8 mAb for flow analysis. The CFSE+CD8+ cells were identified as Ld-specific CD8 T cells. Upper panels: CFSE dilution analysis; the numbers are the percentage of CFSE+CD8+ cells in the whole cell population. Lower panels: CFSE dilution analysis gated on CFSE+CD8+ cells, expressed as histograms. The numbers are the percentage of dividing cells in specific CD8 T cells.

Download figure to PowerPoint

The HSC-induced deletion of CD8+ T cells in islet grafts was re-examined using TCR transgenic mice. BALB/c islets were cotransplanted with HSCs from B7-H1−/− or IFN-γR1−/− mice (both B6 background) into B6 diabetic recipients. 2C mice (B6 background, recognizing MHC Ld antigen) were used as a source of allospecific CD8+ T cells for adoptive transfer. Because flow analysis revealed that 90% of CD3+ cells in 2C mice were CD8+, among which 99% were positive for clonotypic 1B2 mAb staining (data not shown), we simply defined CD3+CD8+CFSE+ as allospecific CD8+ T cells. As expected, cotransplanted WT HSCs induced marked reduction of allospecific CD8+ T cells in islet allografts, which mainly occurred in dividing cell population. The HSCs associated reduction of allospecific CD8+ T cells was partially inhibited when cotransplanted HSCs were deficient in B7-H1 (Fig. 5B), suggesting that B7-H1 is required for elimination of activated allospecific CD8+ T cells. When HSCs were deficient in IFN-γR1, the HSC-associated reduction of specific CD8+ T cells was almost totally inhibited compared with the islet-only group (Fig. 5C), indicating that elimination of activated specific CD8+ T cells is dependent on IFN-γ signaling in HSCs.

HSC Cotransplantation Markedly Expands CD4+FoxP3+ Treg Cells.

CD4+FoxP3+ Treg cells are essential for the induction and maintenance of peripheral tolerance.11 To examine the effect of HSC cotransplantation on Treg cell activity, lymphocytes from islet allografts, spleens, blood, and draining and irrelevant LNs were isolated on POD 7, 14, and >90 (long-term) for identification of CD4+FoxP3+ cells by way of either flow cytometry or immunohistochemical analysis. Normal mice (no transplantation) and islet allograft alone mice served for comparison. As shown in Fig. 6A, on day 7 after islet transplantation alone, the incidence of Foxp3+ cells in the CD4+ population was increased in all tested compartments, compared with normal mice, reflecting a collateral expansion of Treg cells during the allo-response, as described.12 HSCs cotransplantation markedly enhanced the proportion of FoxP3+ cells in all tested compartments with highest in the islet grafts (>40%), peaking at POD 7 and 14. In the recipients bearing long-term surviving islet allografts, Foxp3+ cells substantially declined in the allograft, spleen, and peripheral blood, but maintained high in LNs (Fig. 6A), consistent with the characteristics of induced Treg cells, which are thought to be generated in LNs.15, 16 These change patterns were confirmed by calculating the absolute number of CD4+FoxP3+ cells in the allografts (Fig. 6B, left panel) and draining LNs (data not shown). Compared with islet alone, CD4+FoxP3+ cells in HSC-cotransplanted grafts were significantly elevated on POD 7, and returned back to control levels by POD 14. However, in the long-term surviving allografts, CD4+FoxP3+ cells actually declined to the levels lower than controls (Fig. 6B, left panel). This was validated using in situ immunohistochemical double-staining of islet allografts with anti-CD4 and anti-Foxp3 mAbs (Fig. 6B, right panels), supporting the conclusions based on flow analysis. In contrast to what seen in the grafts, the absolute number of CD4+FoxP3+ cells in the draining LNs remained high in graft long-term survivors based on flow analysis (Fig. 6C; P <0.05 versus any other group). These data indicate that, in long-graft-survival recipients, many Treg cells remained in LNs, the immunological significance of which needs to be further elucidated.

thumbnail image

Figure 6. Cotransplantation with HSCs markedly expands Foxp3+ Treg cells, which is dependent on IFN-γ signaling in HSCs. BALB/c (H-2d) islets mixed with B6 (H-2b) HSCs were transplanted under renal capsule of diabetic B6 recipients. Transplantation of islet allografts alone and without transplantation (none) served as controls. Animals were sacrificed on POD 7, 14, or >90 (long-term, LT). Lymphocytes isolated from the islet grafts, blood, spleen, and irrelevant (I-) and draining (D-) LNs were triple-stained for CD4, CD25, and Foxp3 and analyzed by way of flow cytometry (n = 3 in each group). (A) HSC cotransplantation markedly expands CD4+Foxp3+ cells. Expression of CD25 and Foxp3 was analyzed gated on CD4+ cells, and the numbers are percentages. (B) The absolute numbers of CD4+Foxp3+ cells in islet allografts were counted by way of flow cytometric and immunohistochemical analysis. A total of 10 high-power fields were randomly selected in each graft. Right lower panels: double-staining of CD4 (red) and Foxp3 (green). (C) The numbers of CD4+Foxp3+ cells in the draining LNs were counted by flow cytometric analysis. CD4+FoxP3+ cells in the draining LNs remained high in graft long-term survivors (P <0.05 versus any other group). (D) Adoptive transfer of CD4+CD25+ cells prolongs survival of islet allografts. Lymphocytes were isolated from B6 recipients of BALB/c islets and B6 HSCs for 2 weeks, and CD4+CD25+ T cells were enriched using a MACS regulatory T cell isolation kit (Miltenyi Biotec) with purity >90%. CD4+CD25+ cells at 5 × 105 were intravenously injected into diabetic B6 mice 1 day before receiving BALB/c islet allografts. Injection of same number of bulk spleen cells from normal B6 mice served as control. Upper panel: blood was withdrawn at the indicated time points posttransplantation. The incidence of Foxp3+ cells were analyzed by way of flow cytometry and expressed as a percentage of the CD4+cell population. Lower panel: impact of adoptive transfer of CD4+CD25+ cells on survival of islet allografts. (E) Expansion of CD4+Foxp3+ T cells is dependent on expression of IFN-γ receptor on HSCs. Islets from BALB/c mice mixed with 5 × 105 HSCs from WT, IFN-γR1−/− or B7-H1−/− (all on B6 background) mice were transplanted to diabetic B6 recipients. Animals were sacrificed on POD 7 and 14. Lymphocytes isolated from the islet grafts, spleen, and irrelevant (I-) and draining (D-) LNs were triple-stained for CD4, CD25, and Foxp3 and analyzed by way of flow cytometry. The numbers are percentages in CD4+ cell population.

Download figure to PowerPoint

The in vivo function of the generated CD4+FoxP3+ T cells was examined by way of transfer of magnetic bead-purified CD4+CD25+T cells from long-graft-surviving animals (the purity ranged from 93 to 95%; 90% of these CD4+CD25+ cells were Foxp3+) into diabetic mice 1 day before islet transplantation. The transfer of isolated CD4+CD25+ cells markedly enhanced CD4+Foxp3+ cell levels in peripheral blood similar to the recipients of islet and HSC cotransplantation (Fig. 6D, upper panel), and significantly prolonged survival of islet allografts compared with controls (Fig. 6D, lower panel; P <0.05), indicating that these expanded CD4+FoxP3+ cells are Treg cells.

IFN-γ Signaling Is Required for HSCs to Induce Foxp3+ Treg Cells but Not B7-H1.

To elucidate the molecular mechanism of HSC-induced CD4+FoxP3+ cell expansion, HSCs from IFN-γR−/− or B7-H1−/− mice were cotransplanted with islet allografts. HSCs from WT mice were used as controls. Lymphocytes from islet allografts, spleens, and draining and irrelevant LNs were isolated on POD 7, 14, and >90 (long-term) for identification of CD4+FoxP3+ cells by way of flow cytometric analysis. Compared with WT HSC controls, IFN-γR−/− HSCs induced markedly less CD4+Foxp3+ cells in all tested compartments, suggesting that induction of Treg cells is dependent on IFN-γ signaling in the cotransplanted HSCs. In addition, animals cotransplanted with B7-H1−/− HSCs generated similar levels of CD4+Foxp3+ cells in all tested areas compared with WT HSC controls POD 14 (Fig. 6E), indicating that B7-H1 expressed on cotransplanted HSCs is not responsible for induction of Treg cells. These data demonstrate that IFN-γ signaling in cotransplanted HSCs is required for inducing Treg cells but is unlikely to be mediated by B7-H1. Unidentified downstream products of IFN-γ signaling in HSCs may participate in the induction of CD4+Foxp3+ Treg cells.

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References
  7. Supporting Information

We have demonstrated that cotransplantation with HSCs leads to long-term survival of islet allografts without the requirement for immunosuppressive therapy.17 Further elucidation of the mechanisms of this finding may substantially improve clinical cellular transplantation. Thus, the current limitation of requiring chronic administration of immunosuppression associated with severe complications may be overcome. Only by reducing the need for such agents will cellular transplantation be widely accepted.18 The present study showed that cotransplanted HSCs exerted extensive immunomodulatory effects, including elimination of activated specific CD8+ T cells and marked expansion of Treg cells. Both effects were dependent on IFN-γ stimulation. Although the mechanisms are largely unknown, it has been revealed that IFN-γ is required for the depletion of alloreactive T cells and induction of tolerance.10 The underlying mechanisms remain unclear.8, 19 We showed that IFN-γ induced apoptosis of specific activated T cells was mediated by B7-H1 on HSCs. This is in agreement with previous reports that B7-H1 expressed on cancer cells leads to increased apoptosis of activated T cells,20 and B7-H1 maintains long-term acceptance of the corneal allografts by inducing apoptosis of effector T cells.21

Treg cells play a key role in controlling immune responses, but the involved mechanisms are not completely understood.22 The data in this study demonstrated that transplantation of islet allografts alone slightly increased the incidence of CD4+Foxp3+ T cells, reflecting a collateral expansion of Treg cells in allo-response. Cotransplanted HSCs dramatically increased Foxp3+ Treg cells to about 40% in all tested compartments. They were markedly attenuated in long-term surviving islet allografts, which correlated with reduction of immune effector cells at the local site, whereas Treg cells remained high in the LNs, indicating that the Treg cells are generated and maintained in the LNs, consistent with previous reports.23 It is however, unlikely that these Treg cells are directly induced by cotransplanted HSCs, because there is no evidence that cotransplanted HSCs are able to migrate to the draining LNs. In addition, in a recent study, we showed that coculture of HSCs with CD4+ T cells in vitro only marginally increased CD4+Foxp3+ cells, and that neutralization of transforming growth factor β (TGF-β) by addition of blocking Ab does not affect the marginal increase in Treg cells, suggesting that the TGF-β produced by activated HSCs is not crucial in induction of Treg cells in this experimental model.24 We postulate that cotransplanted HSCs may influence the development of the antigen-presenting cells when they process the alloantigens in the islet grafts. These modulated antigen-presenting cells migrate to the draining LNs and induce Treg cells.25 It would be intriguing to determine whether these modulated antigen-presenting cells produce TGF-β and other Treg-inducing factors, as well as their role in the induction of Treg cells. Adoptive transfer of these Treg cells prolonged survival of transplanted islets, but it was not as effective as the protection of islets by HSC cotransplantation. In addition, the protective effect of HSCs appeared to be local. These data suggest that HSC-induced deletion of the activated effector T cells is critical in the protection of cotransplanted islet allografts. This is in agreement with a recent study demonstrating that Treg cells play a role in tolerance induced by costimulation blockade, but deletion of reactive T cells is a major mechanism.26 Induction of Treg cells by cotransplanted HSCs was dependent on IFN-γ stimulation; it is, however, not mediated by B7-H1, suggesting that an undetermined product of IFN-γ signaling in HSCs is responsible for the induction of Treg cells. Quiescent HSCs (culture for 2 days) poorly responded to IFN-γ stimulation for B7-H1 expression (Supporting Fig. 1), and cotransplantation of quiescent HSCs with islet allografts did not markedly expand Treg cells (Supporting Fig. 5). This may partially explain the failure of quiescent HSCs to prolong islet allograft survival.17 The data of the present study suggest that the collagen encapsulation seems not to affect the islet graft function at least up to 142 days after transplantation (Supporting Fig. 2). We will follow up its effect on longer-term outcome of the graft function.

It is not surprising that the liver, an immune-privileged organ,27 contains cells with immunomodulatory properties. The liver encounters various antigens from the gastrointestinal tract, such as food-derived antigens and bacterial products, which would impose a state of constant immune activation in the liver unless it is controlled by regulatory activities. We have previously shown that the liver induces apoptosis of activated T cells during allo-responses.28 The liver appears to have inherent mechanisms to modulate immune response. The liver may not be the only tissue/organ containing the immunosuppressive tissue cells. Thus, cotransplantation with Sertoli cells in the testis, another immune-privileged site, could also protect islet allografts from rejection, but with approximately 10 times less potency than HSCs in terms of cell numbers required for effectiveness, suggesting involvement of different mechanisms.29 This phenomenon has been observed in non–immune-privileged organs. Resident mesenchymal stem cells show immunomodulatory properties in a variety of tissues,30 suggesting that tissue-based immunomodulation is a widespread property of many tissues, but to differing degrees.31 This study provides a model as to how the immune response is regulated in peripheral tissues, which is triggered by inflammatory response, and mediated by specific tissue immunomodulatory cells, such as HSCs, to exert differential effects on regulatory and effector T cells.

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References
  7. Supporting Information
  • 1
    Qian S, Thai NL, Lu L, Fung JJ, Thomson AW. Liver transplant tolerance: mechanistic insights from animal models, with particular reference to the mouse. Transplantation Reviews 1997; 11: 151164.
  • 2
    Weiler-Normann C, Rehermann B. The liver as an immunological organ. J Gastroent Hepatol 2004; 19(Suppl): S279S283.
  • 3
    Reding R, Davies HFS. Revisiting liver transplant immunology: from the concept of immune engagement to the dualistic pathway paradigm. Liver Transplant 2004; 10: 10811086.
  • 4
    Bumgardner GL Neininger M, Li J, Xia D, Parker-Thornburg J, Furgson RM, et al. A functional model of hepatocyte transplantation for in vivo immunologic studies. Transplant 1998; 65: 5361.
  • 5
    Yu M-C, Chen C-H, Liang, X, Wang L, Gandhi CR, Fung JJ, et al. Inhibition of T cell responses by hepatic stellate cells via B7–H1 mediated T cell apoptosis. HEPATOLOGY 2004; 40: 13121321.
  • 6
    Wood KJ, Sawitzki B. Interferon γ: a critical role in the function of induced regulatory T cells in vivo. Trends Immunol 2006; 27: 183187.
  • 7
    Asavaroengchai WH, Wang S, Wang L, Bronson R, Sykes M, Yang YG. An essential role for IFN-γ in regulation of alloreactive CD8 T cells following allogeneic hematopoietic cell transplantation. Biol Blood Marrow Transplant 2007; 13: 4655.
  • 8
    Refaeli Y, Van Parijs L, Alexander SI, Abbas AK. IFN-γ is required for activation-induced death of T lymphocytes. J Exp Med 2000; 196: 9991005.
  • 9
    Foulds KE, Rotte MJ, Paley MA, Singh BD, Douek C, Hill BJ, et al. IFN-γ mediates the death of Th1 cells in a paracrine Manner. J Immunol 2008; 180: 842849.
  • 10
    Yu X-Z, Albert MH, Martin PJ, Anasetti C. CD28 ligation induces transplantation tolerance by IFN-γ-dependent depletion of T cells that recognize alloantigens. J Clin Invest 2004; 113: 16241630.
  • 11
    Vignali DAA, Collison LW, Workman CJ. How regulatory T cells work. Nat Rev 2008; 8: 523532.
  • 12
    Mele TS, Kneteman NM, Zhu LF, Ramassar V, Urmson J, Halloran B, et al. IFN-γ is an absolute requirement for spontaneous acceptance of liver allografts. Am J Transplant 2003; 3: 942951.
  • 13
    Mele TS, Kneteman NM, Zhu LF, Ramassar V, Urmson J, Halloran B, et al. IFN-γ is an absolute requirement for spontaneous acceptance of liver allografts. Am J Transplant 2003; 3: 942951.
  • 14
    Platanias LC. Mechanisms of type-I-and type-II-interferon-mediated signaling. Nat Rev Immunol 2005; 5: 375386.
  • 15
    Zheng SG, Wang J, Wang P, Gray JD, Horwitz DA. IL-2 is essential for TGF-β to convert naive CD4+ Cells. J Immunol 2007; 178: 20182027.
  • 16
    Davidson TS, Dipaolo RJ, Andersson J. IL-2 is essential for TGF-β-mediated induction of Foxp3+ T regulatory cells. J Immunol 2007; 178: 40224026.
  • 17
    Chen C-H, Kuo L-M, Chang Y, Wu W, Goldbach C, Ross MA, et al. In vivo immune modulatory activity of mouse hepatic stellate cells in mice. HEPATOLOGY 2006; 44: 11711181.
  • 18
    Ricordi C, Strom TB. Clinical islet transplantation: advances and immunological challenges Nat Rev Immunol 2004; 4: 259268.
  • 19
    Sun Y, Lin X, Chen HM, Wu Q, Subudhi SK, Chen L, et al. Administration of agonistic anti-4-1BB monoclonal antibody leads to the amelioration of experimental autoimmune encephalomyelitis. J Immunol 2002; 168: 14571465.
  • 20
    Dong H, Strome SE, Salomao DR, Tamura H, Hirano F, Flies DR, et al. Tumor-associated B7–H1 promotes T-cell apoptosis: a potential mechanism of immune evasion. Nat Med 2002; 8: 793800.
  • 21
    Hori J, Wang M, Miyashita M, Tanemoto K, Takahashi H, Takemori T, et al. B7–H1-induced apoptosis as a mechanism of immune privilege of corneal allografts. J Immunol 2006; 177: 59285935.
  • 22
    Kelchtermans H, De Klerck B, Mitera T, Van Balen M, Bullens D, Billiau A, et al. Defective CD4+CD25+ regulatory T cell function in collagen-induced arthritis: an important factor in pathogenesis, counter-regulated by endogenous IFN-γ. Arthritis Res Ther 2005; 7: R402R415.
  • 23
    Jaeckel E, Kretschmer K, Apostolou I, von Boehmer H. Instruction of Treg commitment in peripheral T cells is suited to reverse autoimmunity. Semin Immunol 2006; 18: 8992.
  • 24
    Jiang G, Yang HR, Wang L, Wildey GM, Fung J, Qian S, et al. Hepatic stellate cells preferentially expand allogeneic CD4+CD25+FoxP3+ regulatory T cells in an IL-2 dependent manner. Transplant 2008; 86: 14921502.
  • 25
    Sakaguchi S, Yamagichi T, Nomura T, Ono M. Regulatory T cells and immune tolerance. Cell 2008; 133: 775787.
  • 26
    Verbinnen B, Billiau AD, Vermeiren J, Galicia G, Bullens DMA, Boon L, et al. Contribution of regulatory T cells and effector T cell deletion in tolerance induction by costimulation blockade. J Immunol 2008; 181: 10341042.
  • 27
    Crispe IN, Giannandrea M, Klein I, Sampson JB, Wuensch S, Cellular and molecular mechanisms of liver tolerance Immunol Rev 2006; 213: 101118.
  • 28
    Qian S, Lu L, Li Y, Fu F, Li W, Starzl TE, et al. Apoptosis within spontaneously accepted mouse liver allografts: evidence for deletion of cytotoxic T cells and implications for tolerance induction. J Immunol 1997; 158: 46544661.
  • 29
    Korbutt GS, Suarez-Pinzon WL, Power RF, Rajotte RV, Rabinovitch A. Testicular Sertoli cells exert both protective and destructive effects on syngeneic islet grafts in non-obese diabetic mice. Diabetologia 2000; 43: 474480.
  • 30
    Antonio U, Lorenzo M, Vito P. Immunoregulatory function of mesenchymal stem cells. Eur J Immunol 2006; 36: 25662573.
  • 31
    Waldman H. Regulation and privilege in transplantation. Curr Opin Organ Transplant 2007; 12: 340344.

Supporting Information

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References
  7. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
HEP_23202_sm_SupFig1.tif224KSupplemental Figure 1
HEP_23202_sm_SupFig2.tif100KSupplemental Figure 2
HEP_23202_sm_SupFig3.tif921KSupplemental Figure 3
HEP_23202_sm_SupFig4.tif86KSupplemental Figure 4
HEP_23202_sm_SupFig5.tif254KSupplemental Figure 5

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.