Inhibition of hepatitis C virus replication using adeno-associated virus vector delivery of an exogenous anti–hepatitis C virus microrna cluster

Authors

  • Xiao Yang,

    1. Division of Hematology and Center for Cellular and Molecular Therapeutics, Children's Hospital of Philadelphia, Philadelphia, PA
    Search for more papers by this author
  • Virginia Haurigot,

    1. Division of Hematology and Center for Cellular and Molecular Therapeutics, Children's Hospital of Philadelphia, Philadelphia, PA
    Search for more papers by this author
  • Shangzhen Zhou,

    1. Division of Hematology and Center for Cellular and Molecular Therapeutics, Children's Hospital of Philadelphia, Philadelphia, PA
    Search for more papers by this author
  • Guangxiang Luo,

    1. Department of Microbiology, Immunology, and Molecular Genetics, University of Kentucky College of Medicine, Lexington, KY
    Search for more papers by this author
  • Linda B Couto

    Corresponding author
    1. Division of Hematology and Center for Cellular and Molecular Therapeutics, Children's Hospital of Philadelphia, Philadelphia, PA
    • 5330 Colket Translational Research Center, 3501 Civic Center Boulevard, Philadelphia, PA 19104
    Search for more papers by this author
    • fax: 215-590-3660


  • Potential conflict of interest: Nothing to report.

Abstract

RNA interference (RNAi) is being evaluated as an alternative therapeutic strategy for hepatitis C virus (HCV) infection. The use of viral vectors encoding short hairpin RNAs (shRNAs) has been the most common strategy employed to provide sustained expression of RNAi effectors. However, overexpression and incomplete processing of shRNAs has led to saturation of the endogenous miRNA pathway, resulting in toxicity. The use of endogenous microRNAs (miRNAs) as scaffolds for short interfering (siRNAs) may avoid these problems, and miRNA clusters can be engineered to express multiple RNAi effectors, a feature that may prevent RNAi-resistant HCV mutant generation. We exploited the endogenous miRNA-17-92 cluster to generate a polycistronic primary miRNA that is processed into five mature miRNAs that target different regions of the HCV genome. All five anti-HCV miRNAs were active, achieving up to 97% inhibition of Renilla luciferase (RLuc) HCV reporter plasmids. Self-complementary recombinant adeno-associated virus (scAAV) vectors were chosen for therapeutic delivery of the miRNA cluster. Expression of the miRNAs from scAAV inhibited the replication of cell culture–propagated HCV (HCVcc) by 98%, and resulted in up to 93% gene silencing of RLuc-HCV reporter plasmids in mouse liver. No hepatocellular toxicity was observed at scAAV doses as high as 5 × 1011 vector genomes per mouse, a dose that is approximately five-fold higher than doses of scAAV-shRNA vectors that others have shown previously to be toxic in mouse liver. Conclusion: We have demonstrated that exogenous anti-HCV miRNAs induce gene silencing, and when expressed from scAAV vectors inhibit the replication of HCVcc without inducing toxicity. The combination of an AAV vector delivery system and exploitation of the endogenous RNAi pathway is a potentially viable alternative to current HCV treatment regimens. (HEPATOLOGY 2010.)

Hepatitis C virus (HCV) infection remains a major worldwide health care problem, because approximately 3% of the world population is chronically infected with this virus, which causes viral hepatitis and can lead to cirrhosis and hepatocellular carcinoma.1 HCV replicates in the cytoplasm by a virally encoded RNA-dependent RNA polymerase (nonstructural protein 5B [NS5B]), and like most RNA polymerases, NS5B has low fidelity and incorporates mutations into its genome at a rate of ∼10−4 base substitutions/nucleotide,2 generating ∼one mutation per round of replication. Thus, HCV shows extraordinary genetic diversity with six major genotypes, at least 50 subtypes, and millions of quasispecies. This feature of HCV has made vaccine and drug development extremely challenging. Although HCV infections are currently managed with a combination of pegylated interferon-α and ribavirin, this regimen is successful in achieving a sustained virological response in only approximately 50% of patients infected with HCV genotype 1. The goal of these studies was to design an alternative therapeutic strategy for treating HCV infection. We chose to combine the powerful gene silencing mechanism of RNA interference (RNAi)3 and viral vector-mediated gene transfer to accomplish this.

RNAi is an evolutionarily conserved mechanism used to suppress gene expression,3 and it has generated enormous interest as a new therapeutic modality to treat diseases that result from overexpression or aberrant expression of genes. RNAi is mediated by a variety of small regulatory RNAs that differ in their biogenesis,3, 4 including short interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), and microRNAs (miRNAs). The products of these pathways induce gene silencing after one strand (guide or antisense strand) of the RNA duplex is loaded into the RNA-induced silencing complex, where Argonaut proteins guide the endonucleolytic cleavage or translational repression of cognate messenger RNAs.5 Many previous studies were performed to identify targets within the HCV genome that were susceptible to RNAi. Using cell lines containing autonomously replicating HCV replicons, many siRNAs and shRNAs targeting the 5′ untranslated region (UTR), the structural and the nonstructural regions of HCV, were shown to inhibit HCV replication.6 Most studies, with the exception of one which used lentivirus vectors,7 used cationic lipids or physical methods (i.e., electroporation) to deliver either siRNAs or plasmids expressing shRNAs. These delivery methods have been shown to be inefficient, toxic, or both to cells in culture, and are thus not suitable for in vivo applications.8 In addition, an in vivo study reported gene silencing of luciferase-HCV reporter plasmids after hydrodynamic tail vein (HDTV) injection of mice with plasmids expressing shRNAs.9 Again, although this study validated RNAi as a potential therapeutic modality, the delivery method employed is not appropriate for drug administration to humans. Currently, novel nonviral delivery formulations are being developed for in vivo delivery of siRNAs,8, 10 but at the present time, viral vector delivery is the most efficient means of gene transfer, and the only method that provides sustained expression of RNAi. Although adeno-associated virus (AAV) and lentivirus vectors themselves appear to be safe, robust and sustained expression of RNAi effectors from AAV vectors in the form of shRNAs resulted in serious toxicity in both mouse liver11 and brain,12, 13 and in some cases fatalities occurred.11 Toxicity correlated with shRNA expression levels and an abundance of unprocessed shRNA precursors, suggesting saturation of the endogenous miRNA pathway. In contrast, the use of exogenous miRNAs prevented this competition14 and eliminated the toxicity seen in mice.12, 13 Thus, maximal gene silencing can be achieved with miRNA-based RNAi effectors, without the accumulation of precursor and nonprocessed products that may disrupt endogenous miRNA biogenesis and lead to toxicity.

In this study, we chose to pursue the exogenous miRNA platform to design a therapeutic strategy for HCV. The endogenous miR-17-92 cluster15, 16 was modified by replacing the first five mature miRNAs of the cluster with inhibitory RNAs targeting HCV. All five miRNAs were effective in knocking down expression of Renilla luciferase (RLuc)-HCV reporter plasmids, both in vitro and in vivo, by up to 97%. AAV vectors were used for delivery of the exogenous polycistronic miRNA gene, and upon use of these vectors, approximately 98% inhibition of cell culture-propagated HCV (HCVcc) was observed. In addition, this vector resulted in gene silencing of RLuc-HCV reporters in mouse liver, with no signs of toxicity. Thus, this vector efficiently targets the HCV genome, causing inhibition of viral replication, and is a promising candidate for the treatment of HCV infection.

Abbreviations

AAV, adeno-associated virus; ALT, alanine aminotransferase; ApoE, apolipoprotein E; FFLuc, firefly luciferase; hAAT, human α1-antitrypsin; HCR, hepatic control region; HCV, hepatitis C virus; HCVcc, cell culture–propagated HCV; HDTV, hydrodynamic tail vein; Huh, human hepatoma; IgG, immunoglobulin G; miRNA, microRNA; NS5B, nonstructural protein 5B; QRT-PCR, quantitative real-time reverse transcription polymerase chain reaction; Rluc, Renilla luciferase; RNAi, RNA interference; sc, self-complementary; shRNA, short hairpin RNA; siRNA, short interfering RNA; vg, vector genomes; UTR, untranslated region.

Materials and Methods

DNA Constructs and AAV Vectors

A detailed description of all the DNA constructs used in these studies and the methods for production of AAV vectors can be found in the Supporting Methods.

In Vitro Gene Silencing Assays

Human hepatoma-7 (Huh-7) cells were seeded in 24-well plates at 4 × 104 cells/well. Approximately 48 hours later, the cells were cotransfected, using Arrest-in (Open Biosystems, Huntsville, AL) according to the manufacturer instructions, with an miRNA-expressing plasmid (125 ng) or pUC19 (125 ng) and an miRNA-specific RLuc-HCV reporter plasmid (125 ng) or the RLuc-HCV reporter that encodes all five HCV targets. Twenty-four hours after transfection, cells were washed with phosphate-buffered saline and lysed using Passive Lysis Buffer (Promega, Madison WI). Firefly luciferase (FFLuc) and RLuc activities were assessed using the Dual-Luciferase Assay system (Promega, Madison, WI). Luminescence readings were acquired using an automated Veritas luminometer (Turner Biosystems, Sunnyvale, CA).

In Vitro HCVcc Inhibition Assays

HCVcc was produced according to Cai et al.,17 and the physical and infectious titers were determined by quantitative real-time reverse transcription polymerase chain reaction (QRT-PCR) and according to Kato et al.,18 respectively. For inhibition experiments, Huh-7.5 cells (Apath, Brooklyn, NY) were plated in six-well plates at 2 × 105 cells/well. Twenty-four hours later, cells were infected with either scAAV2-HCV-miR-Cluster 1 or scAAV2–enhanced green fluorescent protein (eGFP), at one of three multiplicities of infection (MOIs; 1 × 104, 1 × 105, 1 × 106 vector genomes [vg]/cell), and incubated for 24 hours. At this time, the media was replaced and HCVcc was added (∼0.2 focus-forming unit [FFU]/cell) for 2 hours. The media was replaced and the cells were incubated for an additional 48 hours. Supernatants were collected from wells for viral RNA isolation and cells were lysed in TRIzol reagent (Invitrogen, Carlsbad, CA) for total cellular RNA purification. Cells from duplicate wells were prepared for western blot analyses.

HCV RNA Quantitation

HCV RNA was quantified by QRT-PCR19 using in vitro–transcribed JFH-1 (Japanese fulminant hepatitis 1) RNA as a standard.18

Northern Blot Analyses

A description of HCVcc RNA and miRNA analyses can be found in the Supporting Methods.

Western Blot Analyses

Total protein (18 μg) was separated on a 4%-10% Bis-Tris gel (Invitrogen, Carlsbad, CA) and transferred to a nitrocellulose membrane (Invitrogen, Carlsbad, CA), which was probed with two primary antibodies: anti-HCV Core antigen monoclonal antibody (Thermo, Rockford, IL) and rabbit anti-actin polyclonal antibody (Sigma, St. Louis, MO). The membrane was washed and then incubated with IRDye800CW-conjugated goat anti-mouse immunoglobulin G (IgG) and IRDye680-conjugated goat anti-rabbit IgG secondary antibodies (LI-COR Biosciences, Lincoln, NE). The Odyssey Infrared Imaging System (LI-COR Biosciences) was used for scanning and analysis.

Animal Procedures

All animal studies were conducted at the Children's Hospital of Philadelphia with approval from the Institutional Animal Care and Use Committee. Male BALB/c mice were purchased from Charles River Labs (Wilmington, MA). HDTV injections of mice were performed as described elsewhere20 by coinjecting an miRNA-expressing plasmid or pUC19 DNA with a RLuc-HCV fusion plasmid. To analyze the scAAV8-HCV-miR-Cluster 1 vector for gene silencing, 5 × 1011 vg of the vector was injected into the tail vein of BALB/c mice using low pressure. Control animals received scAAV8-eGFP vectors (5 × 1011 vg/mouse). Two weeks later, an HDTV injection of one of five RLuc-HCV reporter plasmids was performed. Two days following the HDTV injections, mice were sacrificed for dual luciferase analyses. For assessment of liver toxicity, four other cohorts of mice were injected with scAAV8-HCV-miR-Cluster 1 at one of four doses (5 × 108, 5 × 109, 5 × 1010, 5 × 1011 vg/mouse), and serum was analyzed for alanine aminotransferase (ALT) levels (TECO Diagnostics, Anaheim, CA) according to manufacturer instructions.

Biochemical Analysis of Mouse Liver

Lysates of the ground liver were prepared by adding 200 μL of Passive Lysis Buffer (Promega, Madison, WI) to ∼100 mg frozen ground liver. The luciferase activity in 10 μL of liver lysate was determined using the Dual Luciferase Assay (Promega, Madison, WI) on a Veritas luminometer (Turner Biosystems, Sunnyvale, CA).

Statistical Analysis

Two-tailed Student t tests were performed. P values < 0.05 were considered statistically significant.

Results

Construction of Polycistronic Anti-HCV miRNA Vector

To enhance the probability of creating functional miRNAs targeting the HCV genome, we surveyed the literature for siRNAs and shRNAs that had previously been shown to inhibit autonomously replicating HCV replicons by greater than 80%.6 Three of the five siRNAs chosen target the 5′ UTR of HCV (UTR1, UTR2, UTR3), and the two others target sequences in one structural (Core) and one nonstructural (NS5B) gene. We used the endogenous miR-17-92 cluster (Fig. 1A)15 to develop a multiplexed platform for inhibiting HCV, similar to one designed to inhibit HIV.16 A liver-specific promoter was used to ensure expression in hepatocytes. The HCV target sequences, their location in HCV 1b, the names of the miRNAs designed to cleave them, and the miRNAs they replace in the endogenous miR-17-92 cluster are shown in Table 1. Three HCV miRNA clusters were constructed: HCV-miR-Cluster 1 contains in order: miR-UTR1, miR-UTR2, miR-UTR3, miR-Core, and miR-NS5B (Fig. 1B); HCV-miR-Cluster 1 + Intron contains the same sequence of miRNAs and includes an intron (Fig. 1C); and HCV-miR-Cluster 2 contains in order: miR-UTR2, miR-UTR1, miR-UTR3, miR-Core, and miR-NS5B (Fig. 1D). In addition, plasmids expressing the individual miRNAs were constructed by removing four of five miRNAs from HCV-miR-Cluster 1.

Figure 1.

Schematic of the endogenous miR-17-92 primary miRNA cluster and the exogenous HCV-miRNA clusters. (A) Structure of endogenous miR-17-92 cluster. (B) Structure of HCV-miR-Cluster 1. (C) Structure of HCV-miR-Cluster 1 + Intron. (D) Structure of HCV-miR-Cluster 2. Numbers between pre-miRNAs represent nucleotides. ApoE, human apolipoprotein E hepatic control region; hAAT, human α1-antitrypsin promoter; pA, bovine growth hormone polyadenylation signal.

Table 1. Anti-HCV miRNAs Used in Studies
Anti-HCV miRNAHCV Target sequenceLocation in HCV 1bEndogenous miRNA Replaced
miR-UTR1CCAUAGUGGUCUGCGGAAC138-156miR-17, miR-18
miR-UTR2AAAGGCCUUGUGGUACUGCCU274-294miR-17, miR-18
miR-UTR3AGGUCUCGUAGACCGUGCA321-339miR-19A
miR-CoreAACCUCAAAGAAAAACCAAAC358-378miR-20
miR-NS5BGACACUGAGACACCAAUUGAC7983-8003miR-19B

In Vitro Activity of Anti-HCV miRNAs

A series of RLuc-HCV reporter plasmids were constructed by fusing HCV target sequences downstream of the RLuc gene in the plasmid psiCheck2. These were used to evaluate the ability of the miRNAs to cleave their target sequences. In addition, a reporter plasmid that contained all five HCV target sequences was constructed. Each plasmid also contained a FFLuc gene to normalize for transfection efficiency. When the miRNAs were expressed individually or from Cluster 1 or Cluster 1 + Intron, similar results were observed. That is, four of the five miRNAs were able to inhibit their cognate HCV sequence by 34%-84% (P < 0.01 relative to pUC19 controls; Fig. 2A,B). Only miR-UTR2 was unable to induce gene silencing (Fig. 2A,B).

Figure 2.

In vitro inhibition of RLuc-HCV reporter plasmids by miRNAs targeting HCV. Huh-7 cells were cotransfected with 125 μg of an RLuc-HCV reporter plasmid (UTR1, UTR2, UTR3, Core, NS5B, or all five targets) and 125 μg of a plasmid expressing one of five anti-HCV miRNAs (miR-UTR1, miR-UTR2, miR-UTR3, miR-Core, miR-NS5B), a plasmid expressing an HCV-miR-Cluster, or pUC19. Twenty-four hours after transfection, cell lysates were prepared and dual luciferase (FFLuc and RLuc) assays were performed. Normalized RLuc expression in cells cotransfected with pUC19 was set as 100% activity or 0% inhibition of the target, and the percent inhibition achieved by each miRNA was compared to the pUC19 control. Mean values of triplicate samples from at least three independent experiments (unless stated otherwise) are shown (± standard deviation [SD]). (A) Inhibitory activity of individually expressed anti-HCV miRNAs (miR-UTR1, miR-UTR2, miR-UTR3, miR-Core, miR-NS5B) against individual reporters or the reporter encoding all five targets. (B) Inhibitory activity of anti-HCV miRNAs when expressed from HCV-miR-Cluster 1 or HCV-miR-Cluster 1 + Intron against individual cognate targets or the reporter encoding all five targets (data for HCV-miR-Cluster 1 + Intron versus five targets are from triplicate transfections of one experiment). (C) Inhibitory activity of anti-HCV miRNAs when expressed from HCV-miR-Cluster 2 against individual cognate targets or the reporter encoding all five targets (data are from triplicate transfections of two independent experiments).

In HCV-miR-Cluster 1, miR-UTR2 was inserted into endogenous miR-18 (Fig. 1B). We hypothesized that the mature miRNA was not properly processed from the primary miRNA or precursor miRNA,4 due to its position within the cluster. Therefore, we constructed a second cluster (HCV-miR-Cluster 2), which contained the same five miRNAs but in a different order: miR-UTR2, miR-UTR1, miR-UTR3, miR-Core, and miR-NS5B (Fig. 1D). In this cluster, miR-UTR2 replaced endogenous miR-17 and miR-UTR1 replaced endogenous miR-18. In this orientation, miR-UTR2 was active, inhibiting its target by 72% ± 0.5% (P < 0.01) (Fig. 2C). In contrast, this change resulted in a loss of activity for miR-UTR1, suggesting that mature miRNAs are not processed correctly from the miR-18 scaffold, a finding confirmed by northern analysis (see below).

In Vivo Activity of Anti-HCV miRNAs

Efficacy of an exogenous polycistronic miRNA has not been previously evaluated in vivo. We determined the efficacy of the five anti-HCV miRNAs in mouse liver by coinjecting the plasmids expressing the HCV-miR Clusters with the RLuc-HCV reporter plasmids via HDTV injection.20 Two days following the injection, mice were sacrificed, livers were harvested, and dual luciferase assays were performed on liver lysates. Control mice received injections of the same RLuc-HCV reporters and a pUC19 plasmid. Four of the five miRNAs expressed from HCV-miR-Cluster 1 + Intron were highly active in inhibiting their individual cognate reporters (Fig. 3A). Furthermore, using the RLuc reporter containing all five HCV targets, 94% ± 2% inhibition was observed (P < 0.01). Similar to what was found in Huh-7 cells, miR-UTR2 was completely inactive. In all cases, higher silencing activity by the four active miRNAs was observed in vivo, as compared to that seen in vitro. The higher activity was not due to nonspecific silencing as demonstrated by the failure of HCV-miR-Cluster 1 + Intron to inhibit a reporter lacking HCV sequences (psiCheck2) (Fig. 3A). The lack of inhibition of the RLuc-HCV UTR1 reporter by a plasmid expressing only HCV-miR-Core, also demonstrated that the higher levels of inhibition observed in vivo are not due to nonspecific targeting (data not shown).

Figure 3.

In vivo inhibition of RLuc-HCV reporter plasmids by miRNAs targeting HCV. HDTV injections of BALB/c mice were performed using 12 μg of plasmid HCV-miR-Cluster 1 + Intron, plasmid HCV-miR-Cluster 2, or pUC19, and 12 μg of one of the RLuc-HCV fusion reporter plasmids or psiCheck2 in a volume of 2 mL phosphate-buffered saline. Two days later, animals were sacrificed, livers harvested, and liver lysates were assayed for both FFLuc and RLuc activity. Normalized RLuc expression in the animals that received the pUC19 negative control plasmid was set as 100% activity or 0% inhibition of the target, and the percent inhibition achieved by each miRNA was compared to the pUC19 control. Cohorts of five mice were used for each reporter plasmid injected. Three independent liver lysates were prepared and analyzed from each mouse, and the results are reported as the mean and SD of these values. (A) Inhibitory activity of anti-HCV miRNAs when expressed from HCV-miR-Cluster 1 + Intron against individual reporter plasmids, the reporter encoding all five HCV targets (5 Targets), or a plasmid encoding no HCV targets (psiCheck2). (B) Inhibitory activity of anti-HCV miRNAs when expressed from HCV-miR-Cluster 2 against individual reporter plasmids, the reporter encoding all five HCV targets, or a plasmid encoding no HCV targets (psiCheck2).

As mentioned above, we constructed a second miRNA cluster (HCV-miR-Cluster 2) to evaluate the activity of miR-UTR2 when inserted into endogenous miR-17, rather than miR-18. This change in position resulted in a highly active miR-UTR2, capable of inhibiting its target by 97% ± 0.5% (P < 0.01 relative to pUC19 control) (Fig. 3B). The reciprocal placement of miR-UTR1 into endogenous miR-18 from miR-17 completely abolished its activity (Fig. 3B), again suggesting that mature miRNAs are not processed correctly from a pre-miR-18 scaffold. Similar to HCV-miR-Cluster 1, HCV-miR-Cluster 2 was also able to silence the HCV reporter containing all five targets by 92% ± 2.7% (P < 0.01 relative to pUC19 control) (Fig. 3B). Thus, two separate HCV-miR clusters are able to express four potent miRNAs that target HCV sequences, and mediate gene silencing in vivo.

The gene silencing results were corroborated by northern blot analyses, which demonstrated that the mature forms of the four active miRNAs expressed from HCV-miR-Cluster 1 or HCV-miR-Cluster 1 + Intron were produced in mouse liver (Fig. 4A,C-E). Very little precursor miRNAs, with predicted lengths of 70-87 nucleotides, were observed, demonstrating that efficient processing of miR-UTR1, miR-UTR3, miR-Core, and miR-NS5B from the precursor miRNA was achieved. Using synthetic siRNA standards, we estimated that approximately equal amounts (∼1 fmol) of the four active miRNAs were present in 25 μg of total liver RNA, suggesting that these four miRNAs were processed from the primary and precursor miRNA with similar efficiencies. In contrast, no mature miR-UTR2 was observed (Fig. 4B), consistent with the lack of inhibition of the RLuc-HCV UTR2 reporter plasmid that was observed in the dual luciferase assays. However, when the orientation of miR-UTR1 and miR-UTR2 was reversed in HCV-miR-Cluster 2, mature miR-UTR2 (Fig. 4F), but no mature miR-UTR1 was produced (Fig. 4G), consistent with the gene silencing data using this cluster.

Figure 4.

Northern blot analyses of miRNA transcripts in murine liver RNA. Mice were injected with a plasmid expressing HCV-miR-Cluster 1 (A-E), HCV-miR-Cluster 1 + Intron (A-G), HCV-miR-Cluster 2 (F-G), or pUC19. Synthetic siRNAs were used as probe-specific positive controls: 0.4, 2.0, 10.0, and 50.0 fmol (D only). A γ-P32-labeled Decade RNA molecular weight marker (Ambion, Austin, TX) was included (M). The miRNA transcripts were detected using γ-P32-labeled oligonucleotide probes specific for the antisense strand (miRNA guide strand): (A) miR-UTR1 probe: (5′-CCATAGTGGTCTGCGGAAC-3′); (B) miR-UTR2 probe: (5′-AAAGGCCTTGTGGTACTGCCT-3′); (C) miR-UTR3 probe: (5′-AGGTCTCGTAGACCGTGCA-3′); (D) miR-Core probe: (5′-AACCTCAAAGAAAAACCAAAC-3′); (E) miR-NS5B probe: (5′-GACACTGAGACACCAATTGAC-3′); (F) miR-UTR2 probe: (5′-AAAGGCCTTGTGGTACTGCCT-3′); (G) miR-UTR1 probe: (5′-CCATAGTGGTCTGCGGAAC-3′). Blots were stripped and reprobed with a U6 shRNA probe: (5′-TATGGAACGCTTCACGAATTTGC-3′) to confirm equal sample loading.

Inhibition of HCVcc Replication Using AAV Vectors Expressing HCV-miRNA-Cluster 1

With the ultimate goal of developing a safe and effective treatment for HCV infection, we used recombinant AAV vectors as delivery vehicles for HCV-miRNA-Cluster 1. These vectors are currently being evaluated for safety in multiple gene therapy clinical trials, and thus far, no evidence of any serious safety issues have been seen,21 although careful evaluation of anti-AAV immune responses have not always been systematically performed.22 A self-complementary (sc) AAV2 vector expressing HCV-miR-Cluster 1 (scAAV2-HCV-miR-Cluster 1) was produced because these vectors lead to higher transduction levels than traditional single-stranded AAV vectors.23 A control vector that expresses the enhanced GFP protein (scAAV2-eGFP) was also produced. To evaluate the inhibitory potential of the anti-HCV miRNAs on HCVcc replication, Huh-7.5 cells were treated with scAAV2-HCV-miR-Cluster 1 or scAAV2-eGFP at one of three doses, and 24 hours later, HCVcc was added. Using 104, 105, and 106 vg/cell of scAAV2-HCV-miR-Cluster 1, the amount of HCVcc in the supernatants decreased in a dose-dependent manner, resulting in 65%, 83%, and 88% inhibition of HCVcc replication, respectively (Fig. 5A). The decrease in HCVcc RNA levels found in the supernatants correlated with a 57%-93% decrease in the presence of intracellular genomic HCVcc RNA, as measured by northern blot (Fig. 5B). These results were confirmed using QRT-PCR to quantify intracellular HCVcc RNA (data not shown). Finally, HCVcc core protein also declined by 69%-98% as the dose of scAAV2-HCV-miR-Cluster 1 increased (Fig. 5C). Thus, four independent methods demonstrated that scAAV2-HCV-miR-Cluster 1 has the ability to inhibit bona fide HCVcc replication by up to 98%.

Figure 5.

AAV vectors expressing HCV-miRNA-Cluster 1 inhibits HCVcc replication. Huh-7.5 cells were plated at 2 × 105 cells/well in a six-well plate. Twenty-four hours later, cells were infected with either scAAV2-HCV-miR-Cluster 1 or the control vector scAAV2-eGFP at one of three MOIs (1 × 104, 1 × 105, 1 × 106 vg/cell), and incubated for 24 hours. At this time, the media was replaced and HCVcc was added (∼0.2 FFU/cell) and allowed to infect cells for 2 hours. The media was replaced and cells were incubated for an additional 48 hours. A total of 4 independent experiments were performed, and representative data from one experiment are shown. Controls included wells of Huh-7.5 cells that were not transduced by AAV vectors, but were either treated with HCVcc alone or with HCVcc plus interferon-α (100 U/mL), or were uninfected. (A) Supernatants were collected and viral RNA was quantified by QRT-PCR. Percent inhibition was determined by comparing the number of HCVcc copies in wells infected with the scAAV2-HCV-miR-Cluster 1 divided by the number of HCVcc copies in wells infected with the scAAV2-eGFP vector. (B) Cellular RNA was purified and 1 μg total RNA was analyzed by northern blot using an α-P32-labeled 9.6-kB fragment of plasmid pJFH-1 as a probe. The membrane was exposed to film and to a phosphor screen for quantification of band intensities. (C) Cells were washed, lysed, and 18 μg of total protein was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and western blot, using a combination of two primary antibodies (mouse anti-HCV core antibody and rabbit anti-actin antibody). IRDye 800CW-conjugated goat anti-mouse IgG and IRDye 680-conjugated goat anti-rabbit IgG were used as secondary antibodies. Protein bands were visualized by using an Odyssey Infrared Imaging System.

AAV Vectors Expressing HCV-miRNA-Cluster 1 Are Safe and Effective In Vivo

The combined data described above demonstrate that plasmids expressing the anti-HCV miRNAs are capable of HCV gene silencing both in vitro and in vivo, and that AAV vectors expressing this cluster inhibit HCVcc replication in vitro. We were next interested in determining if the AAV vector system could efficiently deliver the miRNA cluster to liver and mediate gene silencing of RLuc-HCV reporter plasmids. BALB/c mice were injected via the tail vein with 5 × 1011 vg of scAAV8-HCV-miR-Cluster 1 or scAAV8-eGFP, and 2 weeks later an HDTV injection of one of the five RLuc-HCV reporter plasmids was performed. Mice were sacrificed 2 days later, and liver lysates were analyzed for dual luciferase activity. As shown in Fig. 6, 73% (P < 0.01) inhibition of the RLuc-HCV UTR1 reporter was observed; similarly, 67% (P < 0.01), 93% (P < 0.01), and 80% (P < 0.01) inhibition of the RLuc-HCV-UTR3, Core, and NS5B reporters was observed, respectively. Consistent with the in vitro and in vivo data using plasmids to express the cluster, no inhibition of the RLuc-HCV UTR2 reporter was observed. These data demonstrate that AAV vectors can efficiently deliver miRNAs to the liver, and four of the five miRNAs expressed from Cluster 1 are effective inhibitors of HCV.

Figure 6.

AAV vectors expressing HCV-miRNA-Cluster 1 mediate HCV gene silencing in vivo. Male BALB/c mice (6-8 weeks old) were injected with 5 × 1011 vg of scAAV8-HCV-miR-Cluster 1 via the tail vein. Two weeks later, separate cohorts of mice (n = 5) were injected with one of five RLuc-HCV reporter plasmids using the HDTV procedure. Control mice were injected with scAAV8-eGFP and one of the five reporter plasmids. Mice were sacrificed 2 days later and liver lysates were analyzed for dual luciferase activity. Normalized RLuc expression in mice infected with scAAV8-eGFP and transfected with a RLuc-HCV reporter plasmid was set as 100% activity or 0% inhibition of the target. Percent inhibition achieved by each miRNA was determined by comparing normalized RLuc activity in the mice injected with scAAV8-HCV-miR-Cluster 1 to animals injected with the scAAV8-eGFP vector. Three independent liver lysates were prepared and analyzed for each liver, and the results are reported as the mean ± SD of these values for each cohort.

To evaluate the scAAV8-HCV-miR-Cluster 1 for hepatocellular toxicity, cohorts of mice were injected with one of four doses of the vector (5 × 108, 5 × 109, 5 × 1010, 5 × 1011 vg/mouse), and ALT levels were measured at multiple time points over the course of 10 weeks. No elevations in ALT were observed at any time, even at the highest dose of vector, which is approximately five-fold higher than the dose of scAAV-shRNA vectors that resulted in hepatic toxicity.11 Thus, the use of a polycistronic miRNA scaffold to express anti-HCV RNAi effectors appears to be safer than using shRNAs to mediate RNAi.13

Discussion

In this study, we exploited the endogenous RNAi mechanism to design a novel treatment for HCV infection, because the current therapy is not equally effective against all HCV genotypes and has numerous side effects.1 In designing this alternative strategy, we took advantage of the results gleaned from previous attempts to inhibit HCV using RNAi. In particular, we relied on the literature to identify HCV target sequences, and incorporated validated siRNA and shRNA sequences6 into the endogenous miR-17-92 cluster. The use of a polycistronic miRNA to express five RNAi effectors that target different regions of HCV increases the likelihood of inhibiting the virus. In addition, four of the five RNAi effectors target conserved regions of all six HCV genotypes, providing broader applicability to this approach than drugs currently in use and those in development. We used miRNAs, rather than shRNAs, to mediate RNAi to avoid interference with the endogenous miRNA pathway.12-14 The mature miRNAs were designed to mimic the secondary structure of their endogenous counterparts and to have low internal stability at their 5′ ends, because these characteristics have been associated with preferential incorporation of the guide strand into the RNA-induced silencing complex,24, 25 a feature that will minimize off-target effects. The use of a liver-specific promoter to express the miRNAs ensured expression in hepatocytes, which will also minimize potential off-target effects. In addition to safety, the genomic organization of polycistronic miRNAs is amenable to simultaneous expression of multiple miRNAs, which has the potential to prevent the emergence of escape mutants, a problem that plagues all traditional and direct-acting anti-HCV drugs,26 as well as RNAi-based technologies.27 This concept was validated using just two siRNAs, which limited HCV escape mutant evolution.27 In addition, computer modeling predicted that if each RNAi effector is 75% effective in cleaving its target, three effectors will be sufficient to prevent escape mutant generation, assuming efficient gene transfer.28 When the probability of target cleavage decreased to 70%, four RNAi effectors were required. Thus, although not yet tested, the combination of five potent anti-HCV miRNAs should dramatically decrease the evolution of escape mutants. To achieve efficient gene transfer, we chose AAV vectors, because this delivery system has already been used in the clinic to mediate gene transfer to numerous tissues, including liver. In our studies, it allowed for safe and efficient gene delivery and sustained expression of the RNAi effectors, a feature that may result in complete clearance of HCV over time.

Proof-of-concept was demonstrated using RLuc reporter plasmids, because four of five miRNAs in two different HCV-miRNA clusters had good activity, with some miRNAs achieving almost complete gene silencing of their target sequence. One miRNA in each cluster was inactive due to its placement in the endogenous miR-18 scaffold, and this correlated with the lack of the mature miRNA species in mouse liver. It is not clear why this scaffold did not support the generation of an active miRNA. The miRNAs that are arranged in clusters and expressed from a single promoter often exhibit similar expression patterns. However, clustered miRNAs may accumulate differentially in vivo as a result of posttranscriptional processing or stability,29 and endogenous miR-18 appears to be expressed at lower levels than the other miRNAs in the liver.30 Thus, it might not be possible to engineer this miRNA scaffold to achieve high-level expression of mature exogenous miRNAs in the liver, and the use of the last miRNA in the cluster (i.e., miR-92), as an exogenous miRNA scaffold, may be a better choice.

We chose AAV vectors to evaluate the ability of the miRNA cluster to inhibit replication of HCVcc in Huh-7.5 cells. It should be noted that the level of HCVcc RNA observed in these cells is much higher (∼50-fold)31 than that seen in chronically infected human hepatocytes. Thus, this represents a stringent system for evaluating the efficacy of the miRNA cluster. At the highest dose of scAAV2-HCV-miR-Cluster 1, nearly 100% inhibition of HCVcc replication was observed, as demonstrated using four independent methods. The data indicate that the HCV sequence can be targeted by at least one of the five anti-HCV miRNAs, and future studies will be designed to determine the contribution of each anti-HCV miRNA in inhibiting HCVcc and the mechanism of action (i.e., target cleavage or cleavage-independent repression).

When expressed from plasmids, we estimated that the amount of the four active miRNAs expressed in liver from HCV-miR-Cluster 1 + Intron is ∼1.0 fmol (or 6 × 108 miRNAs) in 25 μg total liver RNA. Using the hepatocellularity number that has been reported for mice of 1.38 × 108 cells/g liver tissue,32 we calculated that ∼155 miRNAs were expressed per cell. Because we expect only ∼20%-40% of the hepatocytes to be transfected using the HDTV procedure,20 we estimated that the transduced hepatocytes expressed ∼400-800 miRNAs/cell. Although ∼56% of hepatocytes in chronically infected individuals harbors HCV genomic RNA at any time, HCV replication occurs in only a subset (∼14%) of them, and replication occurs at a low level (∼33 genomic RNA molecules/infected hepatocyte).33 Thus, based on our estimates, it should be possible to achieve therapeutic quantities of miRNAs. In addition, in a gene therapy setting, where AAV vectors may be present in the liver for months to years, we expect sustained expression of miRNAs, which over time may completely suppress the cellular viral load. Even if previously infected hepatocytes do not benefit from AAV vectors, uninfected cells may be protected from a new infection, and this alone would represent a new and potentially effective stand-alone or adjunct approach to HCV infection management.

In summary, we have demonstrated that exogenous anti-HCV miRNAs induce gene silencing, and when expressed from AAV vectors, they inhibit the replication of HCVcc. To our knowledge, this is the first demonstration of the activity of an exogenous polycistronic miRNA cluster against HCVcc and against reporter plasmids in vivo. The combination of the AAV vector delivery system and exploitation of the endogenous RNAi pathway represents a new therapeutic platform and a potentially viable alternative to the current HCV treatment regimen, and thus warrants further evaluation in animal models of HCV, such as human hepatocyte xenograft models and HCV-infected chimpanzees.

Acknowledgment: We thank Dr. Steel (Drexel University College of Medicine, Philadelphia, PA) for generously providing the Huh-7 cell line, and Drs. Margaritis, Mingozzi, and Podsakoff (Children's Hospital of Philadelphia, Philadelphia, PA) for critical reading of the manuscript.

Ancillary