SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References
  7. Supporting Information

We reported previously that mice overexpressing cytochrome P450 7a1 (Cyp7a1; Cyp7a1-tg mice) are protected against high fat diet–induced hypercholesterolemia, obesity, and insulin resistance. Here, we investigated the underlying mechanism of bile acid signaling in maintaining cholesterol homeostasis in Cyp7a1-tg mice. Cyp7a1-tg mice had two-fold higher Cyp7a1 activity and bile acid pool than did wild-type mice. Gallbladder bile acid composition changed from predominantly cholic acid (57%) in wild-type to chenodeoxycholic acid (54%) in Cyp7a1-tg mice. Cyp7a1-tg mice had higher biliary and fecal cholesterol and bile acid secretion rates than did wild-type mice. Surprisingly, hepatic de novo cholesterol synthesis was markedly induced in Cyp7a1-tg mice but intestine fractional cholesterol absorption in Cyp7a1-tg mice remained the same as wild-type mice despite the presence of increased intestine bile acids. Interestingly, hepatic but not intestinal expression of several cholesterol (adenosine triphosphate–binding cassette G5/G8 [ABCG5/G8], scavenger receptor class B, member 1) and bile acid (ABCB11) transporters were significantly induced in Cyp7a1-tg mice. Treatment of mouse or human hepatocytes with a farnesoid X receptor (FXR) agonist GW4064 or bile acids induced hepatic Abcg5/g8 expression. A functional FXR binding site was identified in the Abcg5 gene promoter. Study of tissue-specific Fxr knockout mice demonstrated that loss of the Fxr gene in the liver attenuated bile acid induction of hepatic Abcg5/g8 and gallbladder cholesterol content, suggesting a role of FXR in the regulation of cholesterol transport. Conclusion: This study revealed a new mechanism by which increased Cyp7a1 activity expands the hydrophobic bile acid pool, stimulating hepatic cholesterol synthesis and biliary cholesterol secretion without increasing intestinal cholesterol absorption. This study demonstrated that Cyp7a1 plays a critical role in maintaining cholesterol homeostasis and underscores the importance of bile acid signaling in regulating overall cholesterol homeostasis. (HEPATOLOGY 2011)

The liver is a major organ involved in de novo cholesterol synthesis and catabolism, biliary cholesterol secretion, and reverse cholesterol transport. Cholesterol homeostasis in the liver is maintained by balancing de novo cholesterol synthesis, uptake, and elimination. Biliary secretion of cholesterol, either in the form of free cholesterol or bile acids, is the only significant route for eliminating cholesterol in mammals.1 Cholesterol 7α-hydroxylase (cytochrome P450 7A1 [CYP7A1]) is the rate-limiting enzyme in the bile acid biosynthetic pathway in the liver and thus controls cholesterol and bile acid homeostasis. Deficiency of CYP7A1 in humans is associated with hypercholesterolemia and premature atherosclerosis.2 Bile acids are not limited to being physiological detergents that facilitate intestinal fat, sterols, and fat-soluble vitamin absorption and distribution but also act as signaling molecules that activate the farnesoid X receptor (FXR) and several cell signaling pathways to maintain lipid, glucose, and energy metabolism.1, 3

It has been reported that overexpression of CYP7A1 in mouse liver (Cyp7a1-tg mice) prevents lithogenic diet–induced atherosclerosis.4 We recently reported that Cyp7a1-tg mice are resistant to high-fat diet–induced obesity, insulin resistance and fatty liver, and maintained cholesterol, bile acid, and triglyceride homeostasis.5 The cholesterol-lowering effect of stimulation of bile acid synthesis has been attributed to increased conversion of cholesterol into bile acids and stimulation of low-density lipoprotein (LDL) receptor–mediated cholesterol uptake into the liver. Hepatic cholesterol is secreted into bile by a heterodimeric cholesterol efflux transporter, adenosine triphosphate–binding cassette G5/G8 (ABCG5/G8), in the canalicular membrane of hepatocytes.6, 7 In the intestine, ABCG5/G8 effluxes plant sterols and cholesterol to the lumen, preventing plant sterol absorption and limiting dietary cholesterol absorption. Mutations of the ABCG5 and/or ABCG8 genes cause sitosterolemia in humans.8 Mice lacking the Abcg5/g8 genes display markedly decreased biliary cholesterol secretion and increased intestinal fractional cholesterol absorption.9 The ABCG5 and ABCG8 genes are orientated in a head-to-head configuration with only a 140-nucleotide intergenic promoter separating the two genes.8 Current knowledge on transcriptional regulation of the ABCG5 and ABCG8 genes is limited. Cholesterol or cholic acid (CA) feeding induces Abcg5/g8 expression in wild-type, but not Fxr/ mice, which suggests Fxr-dependent transcriptional regulation of Abcg5/g8 expression.7 Liver orphan receptor (LXR) also is implicated in regulation of Abcg5/g8.10 However, a functional FXR or LXR binding site has not been identified in mouse Abcg5 or Abcg8 genes. It has been reported that ABCG5/G8-independent pathways also contribute to hepatobiliary cholesterol secretion.11, 12

We studied the mechanism of bile acid signaling in the regulation of cholesterol homeostasis in Cyp7a1-tg mice. We found that biliary and fecal cholesterol and bile acid secretion rates were increased, de novo cholesterol synthesis was also increased, but intestinal fractional cholesterol secretion rate was unchanged in Cyp7a1-tg mice. Bile acids stimulate biliary cholesterol secretion by FXR-mediated induction of ABCG5/G8 and scavenger receptor class B, member 1 (SR-B1) expression. This study suggests that an increased hydrophobic bile acid pool plays a critical role in the regulation of biliary free cholesterol secretion and maintenance of cholesterol and bile acid homeostasis.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References
  7. Supporting Information

Animals.

Cyp7a1 transgenic mice (Cyp7a1-tg) overexpressing a rat Cyp7a1 complementary DNA under the control of an apolipoprotein E3 (ApoE3) hepatic control region were originally generated by the late Dr. Roger A. Davis13 and were obtained from the Mammalian Mouse Regional Resource Center at the University of California Davis. The strain name is B6.Cg-Tg (APOE-Cyp7a1)1Rjd/Mmcd. Mice were further bred with wild-type C57BL/6J mice (The Jackson Laboratory, Bar Harbor, ME). Transgenic mice and wild-type littermates, between 6-8 generations with >90% C57BL/6J background, were used in this study. All mice were fed a standard chow diet, housed under a 12-hour light/dark cycle (6 am to 6 pm light), and sacrificed at 9 am after fasting for 16 hours. Liver-specific Fxr knockout mice (L-FXR-KO) and intestine-specific Fxr knockout mice (I-FXR-KO) were generated as previously described.14 Animal protocols were approved by the Institutional Animal Care and Use Committees at Northeastern Ohio University College of Medicine and the University of Kansas Medical Center.

Quantization of Cholesterol, Phospholipids, and Bile Acids.

Lipids were extracted from liver, gallbladder, and feces with chloroform/methanol (2:1, vol/vol), dried, and dissolved with 5% Triton X-100 in isopropanol. Cholesterol and phospholipids were quantified with a Cholesterol Assay Kit (Calbiochem, San Diego, CA) or a Phospholipid C Assay Kit (Wako Chemical USA, Inc., Richmond, VA). Gallbladder bile was diluted in 70% ethanol; liver, intestine, or fecal bile acids were extracted once each with 90% ethanol, 80% ethanol, and chloroform/methanol (2:1, vol/vol), vacuum dried, and redissolved in 70% ethanol. Bile acids in each tissue were determined with a Bile Acid Assay Kit (Genzyme Diagnostic, Framingham, MA).

Assay of Biliary Cholesterol, Bile Acid, and Phospholipid Secretion Rate.

Mice were fasted for 6 hours and anesthetized. The common bile duct and the cystic duct were ligated and common bile duct was cannulated with a 30-gauge needle attached to a PE-10 polyethylene tube (BD Biosciences Primary Care Diagnostics, Sparks, MD). Bile was collected for 60 minutes. Cholesterol, bile acid, and phospholipid contents in the collected bile were determined by respective assay kits.

Assay of Hepatic Cholesterol Synthesis Rate Measurement.

Mice were briefly fasted for 4 hours then intraperitoneally injected with 10 μCi [1-14C]-sodium acetate (PerkinElmer, Waltham, MA). Mice were sacrificed 30 minutes after injection, and ∼250 mg of liver was rinsed in ice-cold phosphate-buffered saline. Liver tissues were then saponified in 2.2 mL mixture of 50% KOH/95% ethanol (1:10, vol:vol) at 70°C overnight. [3H]Cholesterol (1 μCi) was added to the same tube as a recovery control. Sterols were extracted in 3 mL hexane, dried, and redissolved in 300 μL mixture of acetone:ethanol (1:1, vol:vol). Sterols were then precipitated with 1 mL of digitonin (0.5% in 95% ethanol) overnight at room temperature. The radioactivity of 3H and 14C in the precipitates was determined in a scintillation counter. The cholesterol synthesis rate was expressed as the amount of [1-14C]-acetate incorporated into sterols per minute per gram liver tissue.

Assay of Intestine Cholesterol Absorption.

Intestine cholesterol absorption was determined by a dual-isotope plasma ratio method.15 Briefly, mice were injected with 2.5 μCi [3H]cholesterol in Intralipid (Sigma, St Louis, MO) via tail vein, immediately followed by oral gavage of 1 μCi [14C]cholesterol in medium-chain triglycerides (MCT oil, Mead Johnson, Evansville, IN). Mice were returned to cage with free access to food and water. After 72 hours, blood samples were collected and the radioactivity of 14C and 3H were determined by scintillation counting. Intestine cholesterol absorption was determined as the ratio of 14C/3H in 1 mL of plasma.

Analysis of Bile Acid Composition.

Gallbladder bile was mixed with D4-labeled bile acids and hydrolyzed in 1 M KOH at 120°C overnight. Samples were extracted with diethyl ether. The water phase was acidified with 6 M HCl and extracted with diethyl ether. The samples were washed with water until neutral, evaporated and methylated with trimethyl silyldiazomethane, and derivatized using hexamethyl-disilazane and trimethylchlorosilane in pyridine. Samples were finally analyzed by gas chromatography–mass spectrometry (GC/MS).16

Other Methods.

The following standard methods are described in detail in the Supporting Methods: cell culture, RNA isolation, quantitative real-time polymerase chain reaction (PCR), western (protein) immunoblot, electrophoretic mobility shift assay (EMSA), chromatin immunoprecipitation (ChIP) assay, construction of Abcg5 reporters, mutagenesis, and transient transfection assay.

Statistical Analysis.

Results are expressed as mean ± standard error (SE). Statistical analysis was performed by Student t test. P < 0.05 is considered as statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References
  7. Supporting Information

Cyp7a1-tg Mice Have an Enlarged Bile Acid Pool and Hydrophobic Bile Acid Composition.

In this study, we further investigated the effects and mechanisms of CYP7A1 overexpression on hepatic cholesterol homeostasis in Cyp7a1-tg mice. Cyp7a1-tg mice had a ∼2-fold increase of CYP7A1 enzyme activity.1 As a result, bile acid synthesis and bile acid pool increased 2.5-fold (Fig. 1A) and fecal bile acid content increased 2.5-fold (Fig. 1B). A detailed analysis of bile acid composition in gallbladder bile using a sensitive GC/MS method showed that gallbladder bile acid composition changed from predominantly tauro-conjugated CA (58%) in wild-type mice to chenodeoxycholic acid (CDCA, 54%) in Cyp7a1-tg mice (Fig. 1C). In Cyp7a1-tg mice, the CA content was drastically decreased to 1.7%, but α-muricholic acid (α-MCA) content increased two-fold to 20% and β-MCA reduced to 7.4% in comparison with wild-type mice. Ursodeoxycholic acid (UDCA) markedly increased from 3.8% in wild-type to 15% in Cyp7a1-tg mice. This altered bile acid composition can be explained by bile acid inhibition of CYP8B1 and CA synthesis in Cyp7a1-tg mice.5 This may lead to significantly higher CDCA production. In mouse livers, excess CDCA is converted to MCAs by Cyp3a11-mediated 6-hydroxylation and epimerization of a hydroxyl group from the 7α-position to the 7β-position, or to UDCA by epimerization of a 7α-hydroxyl group to the 7β-position. CDCA is more hydrophobic than CA, and MCA and UDCA are highly hydrophilic. Thus, gallbladder bile in Cyp7a1-tg mice is more hydrophobic than that in wild-type mice.

thumbnail image

Figure 1. Cyp7a1-tg mice had increased bile acid pool and altered bile acid composition. (A) Total bile acid pool size was determined by adding bile acid contents in liver, gallbladder and intestine. Fecal bile acid contents are shown in (B). Results are expressed as mean ± SE, n = 4. An asterisk (*) indicates significant difference, P < 0.05, Cyp7a1-tg versus wild-type controls. (C) Gallbladder bile acid composition was determined in individual wild-type or Cyp7a1-tg mouse. Individual bile acids were determined by GC/MS method and expressed as the percentage of total bile acid pool. All data are statistically significantly different, Cyp7a1-tg versus wild-type, % mean ± standard error of the mean (SEM), P < 0.05, n = 4. All bile acids determined are tauro-conjugated: DCA, deoxycholic acid; UDCA, ursodeoxycholic acid; CDCA, chenodeoxycholic acid; α-MCA, α-muricholic acid; β-MCA, β-muricholic acid; CA, cholic acid; HCA, hyocholic acid.

Download figure to PowerPoint

Cyp7a1-tg Mice Had Higher Biliary and Fecal Cholesterol and Bile Acid Secretion, Increased De Novo Cholesterol Synthesis, but Normal Intestine Fractional Absorption of Cholesterol.

Interestingly, despite increased cholesterol catabolism in the liver, Cyp7a1-tg mice still had approximately 2.5-fold higher biliary and fecal cholesterol content than wild-type mice (Fig. 2A,B). Hepatic total cholesterol levels were unaltered (Fig. 2C), but plasma cholesterol was decreased in Cyp7a1-tg mice (Fig. 2D). Biliary cholesterol and bile acid secretion rates were two-fold and four-fold higher, respectively, in Cyp7a1-tg mice than that in wild-type mice (Fig. 3A,B). Biliary phospholipid secretion had a tendency to increase but did not reach statistical significance (Fig. 3C). To determine the source of cholesterol, we assayed de novo cholesterol synthesis in Cyp7a1-tg mice. An increased bile acid pool should inhibit de novo cholesterol synthesis as observed in bile acid feeding experiments. However, hepatic de novo cholesterol synthesis rate was markedly increased by ∼11-fold (Fig. 3D), consistent with approximately seven-fold induction of 3-hydroxy-3-methyl-glutaryl coenzyme A reductase (HmgCoAR) expression in Cyp7a1-tg mouse livers (Table 1). An increased bile acid pool normally should stimulate intestine fractional absorption of cholesterol. Surprisingly, we found that intestine fractional cholesterol absorption was similar between Cyp7a1-tg mice and wild-type mice (Fig. 3E). These results suggest that Cyp7a1-tg mice have increased hepatic de novo cholesterol synthesis. Excess cholesterol is metabolized to bile acids, which are efficiently secreted into bile. Thus, the increased fecal cholesterol excretion in Cyp7a1-tg mice more likely resulted from increased biliary secretion of cholesterol rather than decreased intestine cholesterol absorption. Furthermore, plasma total cholesterol was decreased by 60% in Cyp7a1-tg mice, suggesting that increased hepatic cholesterol uptake may also contribute to hepatic cholesterol input.

thumbnail image

Figure 2. Cyp7a1-tg mice had higher gallbladder and fecal cholesterol contents. Gallbladder, fecal, liver and plasma cholesterol content was determined with an assay kit as described under Materials and Methods. Results are expressed as mean ± SE. n = 4-6. An asterisk (*) indicates significant difference, P < 0.05, Cyp7a1-tg versus wild-type controls.

Download figure to PowerPoint

thumbnail image

Figure 3. Cyp7a1-tg mice had higher biliary cholesterol and bile acid secretion and increased hepatic cholesterol synthesis, but unaltered intestine cholesterol absorption. Bile was collected from 6 hours fasted mice for 1 hour via common bile duct cannulation. Biliary cholesterol secretion (A), biliary bile acid secretion (B), biliary phospholipid secretion (C), hepatic de novo cholesterol synthesis (D), and intestine cholesterol absorption (E) were determined as described under Materials and Methods. Results are expressed as mean ± SE, n = 3-4. An asterisk (*) indicates significant difference, P < 0.05, Cyp7a1-tg versus wild-type controls.

Download figure to PowerPoint

Table 1. Hepatic and Intestine mRNA Expression of Cholesterol and Bile Acid Transporters in Cyp7a1-tg Versus Wild-Type Mice
 Wild-TypeCyp7a1-Tg
  • Male wild-type and Cyp7a1-tg mice of 12 weeks old, 5 to 8 mice/group, were used in this experiment. Results shown are mean ± SEM.

  • *

    Significant difference, P < 0.05, Cyp7a1-tg versus wild-type mice. Asbt, apical sodium-dependent bile salt transporter; Bsep, bile salt export protein; Fgf15, fibroblast growth factor 15; HmgCoAR, 3-hydroxy-3-methyl-glutaryl coenzyme A reductase; Ldlr, low-density lipoprotein receptor; Mdr2, multidrug resistance protein 2; Npc1l1, Niemann-Pick–like 1 protein; Ntcp, Na+-dependent taurocholate cotransport peptide; Shp, small heterodimer partner.

Hepatic mRNA expression
Abcg51 ± 0.182.64 ± 0.17*
Abcg81 ± 0.211.67 ± 0.21*
Sr-b11 ± 0.191.9 ± 0.11*
Ldlr1 ± 0.142.02 ± 0.22*
HmgCoAR1 ± 0.286.9 ± 2.5*
Bsep1 ± 0.081.75 ± 0.11*
Mdr21 ± 0.111.02 ± 0.1
Ntcp1 ± 0.210.97 ± 0.22
Intestine mRNA expression
Abcg51 ± 0.241.07 ± 0.28
Abcg81 ± 0.120.9 ± 0.26
Npc1l11 ± 0.190.7 ± 0.12
Sr-b11 ± 0.051 ± 0.35
Asbt1 ± 0.70.64 ± 0.48
Shp1 ± 0.288.96 ± 2.6*
Fgf151 ± 0.3924.4 ± 8.33*

Cyp7a1-tg Mice Had Higher Expression of Hepatic Cholesterol and Bile Acid Transporters.

To investigate the mechanism of increased biliary bile acid and cholesterol secretion in Cyp7a1-tg mice, we first analyzed messenger RNA (mRNA) expression of bile acid and cholesterol transporters in the liver and intestine. Cyp7a1-tg mice had significantly higher Abcg5 (2.7-fold) and Abcg8 (1.7-fold) mRNA expression in the liver, but not in the intestine (Table 1). Hepatic Abcg5/g8 protein levels were higher in Cyp7a1-tg mice than their wild-type littermates, whereas intestine Abcg5/g8 protein expression showed no difference (Fig. 4A). Expression of Sr-b1 mRNA increased 1.9-fold in Cyp7a1-tg mouse livers, but not in the intestine (Table 1). Expression of bile salt export pump (Bsep or Abcb11), a major biliary bile acid efflux transporter was significantly increased (1.7-fold) in Cyp7a1-tg mice (Table 1). Expression of liver sinusoidal Na+-dependent taurocholate cotransport peptide (Ntcp), which reabsorbs bile salts from sinusoidal blood, did not change in Cyp7a1-tg mice. Expression of a hepatic phospholipid flipase (Abcb4) or multidrug resistance protein 2 (Mdr2), which is required for efficient biliary cholesterol secretion, did not change (Table 1). This is consistent with the observance of no significant increase of biliary phospholipid secretion in Cyp7a1-tg mice (Fig. 3C). In the intestine, mRNA expression levels of Niemann-Pick–like 1 protein (Npc1l1), which is an intestine cholesterol absorption transporter, and apical sodium-dependent bile salt transporter (Asbt), which reabsorbs bile salts from the lumen, were not changed in Cyp7a1-tg mice (Table 1). Expression levels of the FXR-induced fibroblast growth factor 15 (Fgf15) and Shp were drastically induced in Cyp7a1-tg mice, as a result of increased intestinal bile acids (Table 1). These results indicate that bile acids may coordinately regulate biliary bile acids and cholesterol secretion. Induction of hepatic, but not intestinal cholesterol and bile acid transporters may result in increased biliary cholesterol and bile acid secretion with subsequent fecal elimination in Cyp7a1-tg mice.

thumbnail image

Figure 4. Cyp7a1-tg mice had higher expression of hepatic ABCG5 and ABCG8. (A) Wild-type and Cyp7a1-tg mice on chow diet were fasted overnight and ABCG5 and ABCG8 protein levels in the liver and the intestine were determined by western blot. The protein expression in individual Cyp7a1-tg mouse and its respective littermate control was compared. (B) Hepatocytes were isolated from wild-type mouse livers and treated with 25 μM of CDCA or CA, or 2 μM GW4064 for 24 hours, and mRNA expression was determined by real-time PCR. Results are expressed as mean ± SE. An asterisk (*) indicates significant difference, P < 0.05, Cyp7a1-tg versus nontreated controls. (C,D) Primary human hepatocytes (obtained from Liver Tissue and Cell Distribution System, NIDDK, NIH, Dr. Stephen Strom, University of Pittsburgh, PA) (n = 3) were treated with 25 μM CDCA or CA, 10 μM DCA or LCA, 2 μM GW4064, 1 μM TO901317 or 20 μg/mL cholesterol for 24 hours. mRNA expression (C) or protein levels (D) was determined by real-time PCR or western blot, respectively. Results are expressed as mean ± SE. An asterisk (*) indicates significant difference, P < 0.05, Cyp7a1-tg versus untreated controls.

Download figure to PowerPoint

Bile Acids Induce Abcg5/g8 Via a Functional FXR Response Element in the Abcg5/g8 Genes.

To test if increased hepatic Abcg5/g8 expression in Cyp7a1-tg mice could be due to bile acid activation of FXR, we treated mouse hepatocytes with bile acids or a specific FXR agonist GW4064 and analyzed Abcg5/g8 mRNA expression levels. As shown in Fig. 4B, CDCA, CA and GW4064 treatment all significantly induced Abcg5/g8 mRNA expression levels in mouse hepatocytes. CDCA induction of Abcg5/g8 was stronger than CA, which is consistent with CDCA being a more efficacious FXR ligand. Furthermore, treating primary human hepatocytes with CDCA, CA, and GW4064 also induced ABCG5/G8 mRNA (Fig. 4C) and protein expression (Fig. 4D), suggesting that FXR induction of ABCG5/G8 is conserved in human hepatocytes. To our surprise, an LXR agonist TO901317 or cholesterol did not induce ABCG5/G8 mRNA in human hepatocytes (Fig. 4C), in contrast to a previous report that LXR induce mouse Abcg5 and Abcg8 mRNA expression.10 These data suggest that LXR may differentially regulate ABCG5 and ABCG8 expression in mouse and human hepatocytes.

To further elucidate the molecular mechanism of FXR regulation of Abcg5/g8 gene expression, we performed Abcg5 promoter/luciferase (luc) reporter assays in HepG2 cells. We found that the Abcg5 reporter activities of the reporter plasmids −2041-luc, −1420-luc, −1160-luc, and −918-luc were strongly induced by GW4064 treatment. Reporter activities of shorter constructs −679-luc and −431-luc were not affected. These assays defined a functional FXR response element (FXRE) located between nucleotides −680 and −918 on the Abcg5 promoter (Fig. 5A). Analysis of nucleotide sequences in this region identified an inverted repeat with one-base spacing (IR1) located between nucleotides −682 to −669 on the Abcg5 promoter (or +309 and +322 of abcg8 in intron 1), which is a typical FXRE (Fig. 5A). EMSA showed that FXR/RXRα heterodimer bound to this putative FXRE, and that binding was abolished by excess of unlabeled probes containing the known FXRE from small heterodimer partner (SHP), or fatty acid synthase (FAS) genes, or by antibody supershift assay using an antibody against FXR (Fig. 5B). We then performed ChIP assays using mouse liver and intestine nuclei. ChIP assays showed that FXR occupied the Abcg5/g8 promoter in the mouse liver (Fig. 5C), but not in mouse intestine (Fig. 5D). A positive control showed that FXR occupied the Shp gene promoter in both mouse liver and mouse intestine (Fig. 5C,D). These results demonstrated that FXR directly bound to the FXRE located in the promoter of Abcg5 (intron 1 of Abcg8 gene) in mouse livers and mediated bile acid induction of both abcg5 and abcg8 gene transcription.

thumbnail image

Figure 5. Mouse Abcg5 promoter and Abcg8 intron 1 has a FXR response element (FXRE) that is functional in the liver, but not intestine. (A) Upper panel: various mouse abcg5 promoter/reporter plasmids were cotransfected with FXR and RXRα expression plasmids into HepG2 cells. Cells were then treated with vehicle (DMSO) or GW4064 (2 μM) for 24 hours and luciderase activity was determined and normalized to β-gal activity. Assays were performed in triplicates and expressed as mean ± SD. An asterisk (*) indicates significant difference, P < 0.05, Cyp7a1-tg versus vehicle treated controls. Lower panel: an illustration of the mouse Abcg5 and Abcg8 gene structure, construction of Abcg5 promoter reporter plasmids and localization a putative FXRE sequence in Abcg5 promoter or Abcg8 intron 1. (B) EMSA assay of FXR/RXR binding to [32P]-labeled mouse FXRE probes from Abcg5/g8, Shp, and Fas genes. Mut, mutant ABCG5 FXRE. NS, nonspecific bands. Probes used are: G5/8-FXRE: GGGACAGTCA CATGGGTCAACGCTCTGTGATG, mutant G5/8-FXRE: GGGACAGTCA CATGGCTCGAGGCTCTGTGATG, FAS-FXRE: GGCGGCGGGGGTCAACGCCCGCACTT, SHP-FXRE: GGCAGCCTGGGTTAATGACCCTG TTTA. (C,D) In vivo quantitative ChIP assay of FXR occupancy on Abcg5/g8 gene. Nuclei were isolated from individual mouse liver (left panel) and intestine (right panel) for ChIP assay with an FXR antibody as described in Supporting Materials and Methods. FXR binding to SHP promoter was used as a positive control.

Download figure to PowerPoint

Loss of Fxr in the Liver Decreased Biliary Cholesterol and Attenuated Bile Acid Induction of Abcg5 and Abcg8 Gene Expression in Mice.

To further investigate the role of hepatic FXR in mediating bile acid regulation of biliary and fecal cholesterol content, we fed wild-type, liver-specific Fxr knockout (L-FXR-KO) and intestine-specific Fxr knockout (I-FXR-KO) mice either a chow diet or a chow diet supplemented with 0.5% CA for 1 week. Deletion of the Fxr gene in the liver or the intestine did not significantly alter hepatic cholesterol content (Fig. 6A). CA feeding significantly increased biliary cholesterol content by three-fold in wild-type, two-fold in I-FXR-KO mice, and approximately 0.3-fold in L-FXR-KO mice (Fig. 6B) suggesting that FXR-independent bile acid signaling may be also involved in biliary cholesterol secretion. CA feeding also resulted in a small but significant increase in biliary phospholipid levels in all three genotypes. This suggests that a bile acid effect on biliary phospholipid content may be independent of FXR (Fig. 6C).

thumbnail image

Figure 6. Hepatic and gallbladder lipid content in tissue-specific Fxr knockout mice. Wild-type, liver-specific Fxr knockout mice (L-FXR-KO) and intestine-specific Fxr knockout mice (I-FXR-KO) were fed either a chow diet or a chow diet supplemented with 0.5% cholic acid (CA) for 1 week. (A) Hepatic cholesterol content. (B) Gallbladder cholesterol content and (C) Gallbladder phospholipid content were determined. Results are expressed as mean ± SE. n = 3-5, An asterisk (*) indicates significant difference, P < 0.05, cholic acid fed versus chow fed controls. A double asterisk (**) indicates significant difference between two different groups of mice, P < 0.05. NS, not significant.

Download figure to PowerPoint

Gene expression analysis showed that CA feeding significantly induced ABCG5 and ABCG8 mRNA expression in the livers of wild-type mice and I-FXR-KO mice, but not in the livers of L-FXR-KO mice (Fig. 7A). In contrast, CA feeding had no effect on the mRNA expression of intestine ABCG5 and ABCG8 in mice of all three genotypes (Fig. 7B). These results further confirmed the role of liver FXR in mediating the bile acid induction of ABCG5/G8 expression in the liver. CA strongly repressed CYP7A1 mRNA expression in wild-type mice as expected, but surprisingly had a much weaker effect in L-FXR-KO mice (Fig. 7C), even though loss of liver Fxr abolished CA induction of hepatic SHP, whereas loss of intestine Fxr completely abolished intestine FGF15 induction (Fig. 7D,E). The attenuated repression of CYP7A1 by CA in L-FXR-KO mice may be due to abolished SHP induction in the liver. Taken together, these results suggest that redundant pathways mediate bile acid repression of the Cyp7a1 gene.

thumbnail image

Figure 7. . Loss of liver Fxr abolished cholic acid induction of ABCG5 and ABCG8 in mouse livers. Wild-type, liver-specific Fxr knockout mice (L-FXR-KO) and intestine-specific Fxr knockout mice (I-FXR-KO) were fed either a chow diet or a chow diet supplemented with 0.5% cholic acid (CA) for 1 week. Hepatic and intestine mRNA expressions were determined by real-time PCR. Results are expressed as mean ± SE. n = 3-5, An asterisk (*) indicates statistical significance, P < 0.05, cholic acid–fed versus chow-fed controls. A double asterisk (**) indicates significant difference between two groups of mice, P < 0.05.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References
  7. Supporting Information

This study demonstrated that induction of CYP7A1 had profound effects on hepatic cholesterol synthesis, uptake, catabolism, and secretion, but hepatic cholesterol homeostasis is maintained to prevent hypercholesterolemia. Increased CYP7A1 expression promotes biliary and fecal cholesterol secretion without affecting intestine cholesterol absorption in Cyp7a1-tg mice. Induction of CYP7A1 increases CDCA in the bile acid pool, which is the most efficacious ligand of FXR that induces expression of hepatic, but not the intestinal cholesterol transporters ABCG5/ABCG8 and SR-B1, and the hepatic bile acid efflux transporter BSEP. Thus, bile acid synthesis is directly linked to biliary bile acid and cholesterol secretion, but not intestinal cholesterol absorption. In a previous study, lowering circulating cholesterol levels in Cyp7a1-tg mice was attributed to compensatory up-regulation of LDL-mediated uptake of cholesterol, which is converted to bile acids in the liver.4 Because a significant fraction of cholesterol is excreted via feces, the increased biliary cholesterol secretion may be another important mechanism for Cyp7a1-tg mice to eliminate excessive cholesterol and prevent cholesterol accumulation in serum and hepatocytes. The higher ABCG5 and ABCG8 mRNA and protein expression in the liver and higher biliary cholesterol secretion rate, with unchanged cholesterol absorption in the intestine provide direct evidence that bile acids promote biliary cholesterol secretion and contribute to higher fecal cholesterol loss in Cyp7a1-tg mice.

Despite increased hepatic cholesterol synthesis, liver cholesterol homeostasis in Cyp7a1-tg mice is maintained. Our results suggest a new mechanism that increased CYP7A1 activity may stimulate de novo cholesterol synthesis and secretion without affecting intestine cholesterol absorption. It is well known that serum cholesterol in mice consists of mainly high-density lipoprotein-cholesterol. Thus, induction of LDL receptor–mediated cholesterol uptake, as previously suggested,13 may not fully explain lower plasma cholesterol in Cyp7a1-tg mice. Instead, bile acid induction of hepatic SR-B1 could contribute to both increased hepatic HDL-mediated cholesterol uptake by hepatocytes and biliary cholesterol secretion in Cyp7a1-tg mice.17 SR-B1 in the intestine is not induced in Cyp7a1-tg mice, consistent with a report that SR-B1 is not required for intestinal cholesterol absorption.17 Bile acid induction of SR-B1 in the liver may be mediated by FXR, but the FXRE has not been identified. A recent study suggests that bile acid induces SR-B1 by an indirect mechanism.18

Intestine fractional cholesterol absorption serves as the first barrier to limit the amount of cholesterol being absorbed and could have a significant effect on biliary cholesterol content. However, our results suggest that increased fecal cholesterol content in Cyp7a1-tg mice is not likely a result of decreased intestinal cholesterol absorption. In the intestine, bile acids form mixed micelles with cholesterol and phospholipids to facilitate absorption of cholesterol and fats. Mice deficient in Cyp7a1 showed a markedly reduced intestinal cholesterol absorption and significantly higher fecal cholesterol content due to bile acid deficiency.19 Cholate has the lowest critical micelle concentration among bile acids, and thus is the most effective in facilitating intestinal cholesterol absorption. Cyp8b1 knockout mice are defective in CA synthesis and have reduced intestinal cholesterol absorption despite a slightly increased bile acid pool.20 These studies collectively suggest that both bile acid pool size and CA content are important determinants of intestinal cholesterol absorption. In Cyp7a1-tg mice, CDCA became the predominant bile acid and CA was very low. However, Cyp7a1-tg mice did not show reduced fractional absorption of cholesterol in the absence of CA. This may be explained by an enlarged bile acid pool that compensates for the loss of CA. In Cyp7a1-tg mice, intestine expression levels of ABCG5/G8, NPC1L1, and SR-B1 were unaltered, which ruled out the possibility that bile acids could affect intestine cholesterol absorption by regulating these lipid transporters.17, 21

A previous report shows that LXR induces expression of both CYP7A1 and Abcg5/g8 in mice.10 However, LXR does not induce human CYP7A1 expression.22 It was unexpected that a potent LXR agonist TO901317 or cholesterol treatment failed to induce ABCG5 and ABCG8 in primary human hepatocytes. However, this is consistent with a previous observation that feeding a high-cholesterol diet to human ABCG5 and ABCG8 transgenic mice induces mouse Abcg5/g8, but not human ABCG5/G8 mRNA expression in the liver.23 Based on these results, we suggest that LXR may differentially regulate Abcg5/g8 in mice and humans. In mice, cholesterol activates LXR to induce CYP7A1 and ABCG5/ABCG8 to stimulate cholesterol catabolism and biliary cholesterol secretion, and thus prevents hepatic cholesterol accumulation. The lack of such LXR-mediated mechanisms in human livers suggests that bile acid–activated FXR signaling may play a predominant role in control of hepatic cholesterol homeostasis in humans.

In this study, we demonstrated that FXR/RXR directly bind to a functional FXRE only in the liver. Tissue-specific FXR binding of the Abcg5/g8 gene in this study is consistent with our genome-wide gene profiling study that found ∼11% of FXR target genes overlap in the liver and in the intestine.24 This suggests that tissue-specific regulation of gene expression by FXR is not limited to abcg5/g8 but may also many other FXR target genes. Combinatorial actions of different transcription factors and coregulators, as well as histone modification and epigenetic regulation may determine tissue-and gene-specific gene transcription.

In summary, we showed that induction of CYP7A1 expression and expansion of a hydrophobic bile acid pool stimulate cholesterol conversion into bile acids, de novo cholesterol synthesis, and biliary free cholesterol secretion, without increasing intestinal cholesterol absorption. This study underscores the importance of bile acid signaling in maintaining cholesterol homeostasis and preventing hypercholesterolemia.

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References
  7. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. References
  7. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
HEP_24107_sm_suppinfo.doc41KSupporting Information

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.