IL28B genetic variation and treatment response in patients with hepatitis C virus genotype 3 infection

Authors


  • Potential conflict of interest: Nothing to report.

Abstract

Polymorphisms near the IL28B gene, which code for interferon (IFN)-λ3, predict response to pegylated interferon-α (PEG-IFN) and ribavirin treatment in hepatitis C virus (HCV) genotype 1 infected patients. Follow-up studies of the effect of IL28B gene in HCV non–genotype 1 infected patients have almost always used predominantly HCV genotype 2–infected or mixed genotype 2/3–infected cohorts with results partly conflicting with HCV genotype 1. We performed a retrospective analysis of 281 patients infected with HCV genotype 3 for association of response to therapy with IL28B polymorphisms. We found that the HCV genotype 1 responder genotypes at rs12979860 and rs8099917 did not associate with sustained virological response to PEG-IFN/ribavirin therapy. However, the responder genotypes of both SNPs showed association with rapid viral response measured at 4 weeks (rs12979860, P = 3 × 10−5; rs8099917, P = 3 × 10−4). In multivariate analysis, age (<40 years), baseline viral load (<4 × 105 IU/mL) and the responder genotypes of SNPs rs12979860 or rs8099917 remained significant independent predictors of rapid viral response to therapy. Furthermore, we show that IL28B polymorphisms are associated with relapse in patients who achieve rapid viral response to PEG-IFN/ribavirin therapy. The responder genotypes also showed association with markers of stage and activity of liver disease, namely high aspartate aminotransferase platelet ratio index (APRI, rs12979860, P = 0.018; rs8099917, not significant) and high alanine aminotransferase (ALT, rs12979860, P = 0.002; rs8099917, P = 0.001), in addition to a high baseline viral load (rs12979860, P = 1.4 × 10−5; rs8099917, P = 7.3 × 10−6). Conclusion: Polymorphisms near the IL28B gene show association with rapid viral response but not sustained viral response to PEG-IFN/ribavirin therapy in HCV genotype 3-infected patients. (HEPATOLOGY 2011;)

Hepatitis C virus (HCV) infection is one of the most important causes of chronic liver disease world-wide, potentially resulting in cirrhosis, hepatocellular carcinoma, and subsequently the need for liver transplantation.1, 2 The current mainstay for treatment of HCV is pegylated interferon-α (PEG-IFN) plus ribavirin3; approximately 50% of the patients will respond to 12 months of this treatment.4-6 Viral genotype is the most important predictor of response with only 40% of patients with genotype 1 responding to PEG-IFN/ribavirin treatment, compared to 90%, 80%, and 60% of patients with genotype 2, 3, and 4, respectively.6-8 Therapy with PEG-IFN/ribavirin is demanding on patients because of the duration of treatment and extensive side effects. The cost in economical terms is substantial. Therefore, several attempts have been made to individualize treatment aiming to reduce drug exposure to a minimum while maintaining treatment efficacy. Viral genotype, baseline viral load, age, ethnicity, stage of liver disease, and presence or absence of diabetes mellitus are established predictors of treatment response.3 Additional indicators of treatment response are used once therapy has commenced to further predict outcome, namely reduction in viral load, and in this respect treatment response is categorized as rapid viral response (RVR), early viral response (EVR), and nonresponse (NR). Based on this knowledge, treatment duration is modified to reduce drug exposure.3

Genetic variants in patients infected with HCV genotype 1 associated with likelihood of achieving sustained virological response (SVR) have been discovered through genome-wide association studies (GWAS).9-11 Of all the single-nucleotide polymorphisms (SNPs) studied, two SNPs, both located in the IL28B gene region, rs12979860 and rs8099917, seem to show the strongest association with treatment response and account for other associated SNPs in the same respective linkage disequilibrium blocks.9-11 Whereas association of these two SNPs with SVR in HCV genotype 1–infected patients was confirmed in three additional studies,12-14 in a European study, rs12979860 was also shown to be associated with SVR in a predominantly HCV genotype 2–infected patient population, especially in patients who do not achieve RVR.15

The SNP rs12979860 is located 3 kb upstream of the IL28B gene, which codes for IFN-λ3 and strongly predicts response to HCV treatment in patients of European and African American origin infected with HCV genotype 1.9, 13 The rs8099917 SNP is located 8 kb downstream of the IL28B gene and 6 kb upstream of the IL28A gene, which codes for IFN-λ2. For this SNP, association to viral response to PEG-IFN/ribavirin treatment has been demonstrated in Australians of North European descent and in Japanese patients.10, 11 There also seems to be a relationship between SNPs near the IL28B gene and viral load9, 13 and also biomarkers associated with stage and activity of liver disease, namely patient alanine aminotransferase (ALT) and gamma glutamyltransferase levels.16, 17 The effect of these SNPs on regulation of the IFN-λ family, if any, is yet to be elucidated because the exact causal variant has not been determined. Interestingly, the distribution of these SNPs in different ethnicities can also explain part of the lower treatment success rate of African Americans in PEG-IFN/ribavirin therapy compared to Europeans and Asians, and the relatively high success rates in East Asians.9

The importance of SNPs near IL28B has been studied for treatment response to some extent in HCV genotype 2–infected patients in mixed cohorts.15 Data is scarce on HCV genotype 3–infected patients. The primary aim of the current study was therefore to assess the relationship between the IL28B genotype and viral response to PEG-IFN/ribavirin therapy in patients infected with HCV genotype 3. Secondary aims were to assess the relationship between the IL28B genotype and natural history of infection including immunity, activity, and development of liver fibrosis.

Abbreviations

ALT, alanine aminotransferase; APRI, aspartate aminotransferase platelet ratio index; HCV, hepatitis C virus; IFN, interferon; IU, international units; NR, nonresponse; PEG-IFN, pegylated interferon-α alpha; RVR, rapid viral response; SVR, sustained viral response.

Materials and Methods

HCV Patient Population.

Data and clinical samples from two clinical trials were pooled for the present study, a Scandinavian randomized controlled trial18 (RCT, n = 428) and a nonrandomized trial19 (n = 122). In both trials patients were included if they were HCV RNA–positive, treatment naive, and had HCV genotype 2 or 3 and raised ALT levels. Patients were excluded if they were known to have injected drugs or abused alcohol within the last 6 months, had poorly controlled psychiatric illness, decompensated cirrhosis, or were hepatitis B surface antigen (HBsAg) or anti-human immunodeficiency virus–positive. They were also excluded if they suffered from other significant concurrent medical conditions including chronic liver diseases of etiologies other than HCV infection. The regional ethical committees of the three countries approved the clinical studies, and all patients had given written informed consent. Patients were included in the current analysis if they were of Scandinavian origin, infected with HCV genotype 3, had been treated per protocol (>11 weeks of treatment with >80% of prescribed dose of both drugs, a follow-up sample was available to assess SVR), and had available stored plasma sample (n = 281, Fig. 1). Genomic DNA was extracted from 200 μL of frozen plasma samples using MagNA Pure LC Total Nucleic Acid Isolation Kit High Performance (Roche, Mannheim, Germany), DNA was eluted in 100 μL of elution buffer. Prior to initiating the study, we tested to see if there was sufficient amount of DNA extracted from plasma for genotyping without whole-genome amplification (WGA). WGA was found to be not necessary.

Figure 1.

Overview of HCV genotype 3–infected patients selected for analysis in the current study.

Control Population.

Norwegian healthy controls were selected from the Norwegian Bone Marrow registry. Genomic DNA from controls was extracted from peripheral blood and thereafter amplified using the Genomiphi kit (GE Healthcare Systems, Chalfont St. Giles, UK), giving high-molecular amplified DNA previously validated for genotyping.20

Treatment and Design.

Patients were treated with PEG-IFN-α-2b (PegIntron; Schering Plough, Kenilworth, NJ) 1,5 μg/kg subcutaneously once weekly and ribavirin (Rebetol; Schering Plough) 800-1400 mg/day based on body weight (<65 kg: 800 mg/day; 65-85 kg: 1000 mg/day; 86-105 kg: 1200 mg; and >105 kg: 1400 mg/day). In both trials, Patients were considered to have RVR if they were RNA-negative (<50 IU/mL) after 4 weeks of treatment. In the nonrandomized trial, all patients with RVR were treated for a total of 14 weeks, whereas in the RCT trial, patients with RVR were randomized to either 14 weeks or 24 weeks of total treatment. Patients without RVR were treated for 24 weeks in both trials. Patients were considered to have SVR if HCV RNA levels remained undetectable 24 weeks after completion of treatment. Qualitative HCV RNA analysis, viral load determination, and HCV genotyping for these patients have been described.18, 19

Fibrosis Assessment.

Liver biopsies were only available from a subset of patients from the nonrandomized trial. Liver fibrosis was therefore assessed using the aspartate aminotransferase platelet ratio index (APRI).21 An APRI of >1.5 was classified as bridging fibrosis or cirrhosis (stage 3-4), and hepatocyte injury was assessed by ALT measurements.22

SNP Genotyping.

Eluted DNA (5 μL) was used for determination of genotype using an SDS 7900 HT qPCR thermocycler (Applied Biosystems, Foster City, CA). rs12979860 was genotyped using a custom made TaqMan assay with the following primers and probes: amplification primers TGCCTGTCGTGTACTGA ACCA and GAGCGCGGAGTGCAATTC and TaqMan probes VIC-TGGTTCGCGCCTTC-MGB and 6FAM-CTGGTTCACGCCTTC-MGB. The assay for rs12979860 was validated using Custom TaqMan SNP Genotyping Assay (Applied Biosystems; online service, primer and probe sequences not shown) of almost all samples. Further validation was also performed by amplifying DNA from some of the samples using primers CCTGGACGTGGATGGGTACT and GGCTC AGGGTCAATCACAGAA and sequencing with primer TCGTGCCTGTCGTGTACTGAA. rs8099917 was genotyped using a predesigned TaqMan SNP Genotyping Assay (Applied Biosystems; assay ID C__11710096_10). The genotyping assay was validated by amplifying DNA from several of the samples using primers TTGTCACTGTTCCTCCTTTTGTTTT and GGCCCTAACTGATACGCTATAATTAAA and sequencing with primer AATGCAAATGAGAGATAATGGTAAGACAT.

Statistical Analysis.

The Statistical Package for the Social Sciences (SPSS; version 16) was used for all analyses except for Hardy-Weinberg equilibrium calculations, for which http://ihg2.helmholtz-muenchen.de/cgi-bin/hw/hwa1.pl was used. Genotype distributions were compared using χ2 tests.

ALT was normalized by dividing female patients' measurements by 35 and male patients' measurements by 50 and was used as a continuous variable. Association with normalized ALT was determined using nonparametric Mann-Whitney U test or by the Student t test and log10-transformed values of normalized ALT. Similarly, association of genotype with continuous baseline viral load was determined using nonparametric Mann-Whitney U test or by Student t test and log10-transformed values for viral load. In multivariate analysis, log10(normalized ALT) was used. Binary logistic regression was used to control for variables based on the results from the univariate analyses, hypothesized relationships, and published literature. Binomial confidence intervals were calculated using http://statpages.org/confint.html.

Results

Patient Characteristics and Treatment Response.

The overall SVR to PEG-IFN/ribavirin therapy was high (80%) as expected in patients infected with HCV genotype 3 who completed the course of therapy. The 281 included patients had a median age of 38 years (range, 18-58) and 59% were male. In univariate analysis, determinants of sustained response to PEG-IFN/ribavirin were younger age (<40 years), absence of advanced fibrosis (APRI < 1.5), low baseline viral load (<4 × 105 IU/mL), and rapid viral response to PEG-IFN/ribavirin therapy (Table 1). In multivariate analysis, age, RVR, and absence of advanced fibrosis, but not baseline viral load, remained associated with higher odds of sustained viral response. Adjusted odds ratios (ORs) for independent variables that remained statistically significant are shown in Table 1.

Table 1. Characteristics of HCV Genotype 3–Infected Patients Treated with PEG-IFN/Ribavirin
CharacteristicsnSVROR (95% CI)Adjusted OR (95% CI)*
  • ALT values have been normalized according to gender (see Materials and Methods).

  • Abbreviations: ALT, alanine aminotransferase; APRI, aspartate aminotransferase platelet ratio index; CI, confidence interval; HCV, hepatitis C virus; IU, international unit; n.d., no data; OR, odds ratio; PEG-IFN, pegylated interferon; RVR, rapid viral response; SVR, sustained viral response.

  • *

    Adjusted for patient genotype, age, RVR, APRI, and baseline viral load.

  • Significant based on two-tailed Mann-Whitney U test.

Male166129 (78%)1.6 (0.8-2.9)
Female11597 (84%)  
<40 years170152 (89%)4.2 (2.3-7.9)3.6 (1.7-7.5)
>40 years11174 (67%)  
RVR201177 (88%)4.7 (2.5-8.7)3.2 (1.6-6.6)
Non-RVR8049 (61%)  
APRI > 1.56445 (70%)2.3 (1.2-4.4)2.2 (1.1-4.6)
APRI ≤ 1.5205173 (84%)  
n.d.12   
Baseline viral load <4 × 105 IU/mL9887 (89%)2.5 (1.2-5.2)1.7 (0.8-3.8)
Baseline viral load >4 × 105 IU/mL170129 (76%)  
n.d.11   
Normalized ALT (IU/L)277Median (range) = 2.6 (0.4-13.7)P = 0.82
n.d.4   

Association of Host Genotype With Treatment Response.

Patients were stratified according to recently identified SNPs near the IL28B gene: rs12979860 and rs8099917. We found no significant difference in SVR to PEG-IFN/ribavirin if patients had the earlier reported responder genotype CC, compared to CT/TT at the rs12979860 locus or if they had the earlier reported responder genotype TT, compared to GT/GG at the rs8099917 locus (Table 2). However, patients with CC at rs12979860 had a lower rate of SVR compared to patients with TT (77% versus 96%, P = 0.038).

Table 2. Genotype Distribution and Association of rs12979860 and rs8099917 With Response to PEG-IFN/Ribavirin Therapy in HCV Genotype 3–Infected Patients
rs12979860CCCTTTCT/TTOR (95% CI)*
  • Abbreviations: CI, confidence interval; HCV, hepatitis C virus; OR, odds ratio; PEG-IFN, pegylated interferon; RVR, rapid viral response; SVR, sustained viral response.

  • *

    Calculated from CC versus CT/TT.

  • Calculated from TT versus TG/GG.

SVR99 (77%)105 (81%)22 (96%)127 (84%)1.5 (0.9-2.8)
RVR108 (84%)80 (62%)13 (56%)93 (61%)3.3 (1.9-5.8)
rs8099917TTTGGGTG/GGOR (95% CI)
SVR161 (80%)59 (81%)6 (86%)65 (81%)1.1 (0.6-2.1)
RVR156 (78%)42 (57.5%)3 (43%)45 (56%)2.7 (1.6-4.7)

In contrast to an absence of association with SVR, patients with CC genotype of rs12979860 or TT genotype of rs8099917 were more likely to have RVR than those with CT/TT or TG/GG, respectively (Table 2; rs12979860, 84% versus 61%, OR = 3.3, 95%CI = 1.9-5.8, P = 3 × 10−5; rs8099917, 78% versus 56%, OR = 2.7, 95%CI = 1.6-4.7, P = 3.4 × 10−4). In multiple regression analysis with correction for other variables that were significantly associated with RVR (age and baseline viral load), both SNPs remained significantly associated with RVR (Table 3).

Table 3. Association of Patient Characteristics With RVR to PEG-IFN/Ribavirin Therapy
 OR (95%CI)Adjusted OR (95%CI)*
  • Abbreviations: ALT, alanine aminotransferase; APRI, aspartate aminotransferase platelet ratio index; CI, confidence interval; IU, international unit; OR, odds ratio; PEG-IFN, pegylated interferon; RVR, rapid viral response; SVR, sustained viral response.

  • *

    Adjusted for patient genotype, age, and baseline viral load.

rs12979860 (CC versus CT/TT)1.5(1.2-1.8)1.8 (1.5-2.3)
Age (<40 years)3.8 (2.2-6.6)4.3 (2.4-8.1)
Viral load (<4 × 105 IU/mL)2.9 (1.6-5.5)4.9 (2.4-10.2)
APRINot significant
Normalized ALTNot significant
rs8099917 (TT versus TG/GG)1.4 (1.2-1.7)1.9 (1.4-2.4)
Age (<40 years)3.8 (2.2-6.6)4.4 (2.4-8.1)
Viral load (<4 × 105 IU/mL)2.9 (1.6-5.5)5.0 (2.3-10.7)
APRINot significant
Normalized ALTNot significant

Given the association of the rs12979860 and rs8099917 polymorphisms with RVR but not SVR, we explored for possibility of relapse among patients who had RVR. Out of 108 HCV patients with the rs12979860 CC genotype who had RVR in response to PEG-IFN/ribavirin therapy, 21 (19%) relapsed and did not achieve SVR. This was significantly higher than in 93 patients with CT/TT genotype, among whom three (3%) relapsed (P = 4.1 × 10−4; Table 4). None of the 13 patients with TT genotype had relapsed, implying a possible additive effect, although the numbers are too few to be certain. A similar trend was seen with the rs8099917 SNP, in which relapse was higher in patients with TT genotype compared to GT/GG (14% versus 4%, respectively, P = 0.078). In binary logistic regression, rs12979860 and age, but not rs8099917, baseline viral load, APRI, and normalized ALT, remained significantly associated with relapse of patients who had cleared virus after 4 weeks or 24 weeks of treatment (Table 4).

Table 4. Association of Patient Characteristics for Relapse in Patients Who Had Shown Viral Clearance at 4 Weeks (Columns 2 and 3) and at 24 Weeks (Columns 4 and 5)
 OR (95%CI)Adjusted OR (95%CI)*OR (95%CI)Adjusted OR (95%CI)*
  • Abbreviations: ALT, alanine aminotransferase; APRI, aspartate aminotransferase platelet ratio index; CI, confidence interval; IU, international unit; OR, odds ratio.

  • *

    Adjusted for patient genotype and age.

rs12979860 (CC versus CT/TT)1.9 (1.3-2.9)1.8 (1.2-2.8)1.3 (1.0-1.6)1.3 (1.0-1.6)
Age (<40 years)4.7 (2.0-11.6)3.9 (1.6-10.0)5.2 (2.5-11.1)5.3 (2.5-11.2)
Viral load (<4 × 105 IU/mL)Not significantNot significant
APRINot significantNot significant
Normalized ALTNot significantNot significant
rs8099917 (TT versus TG/GG)Not significantNot significant
Age (<40 years)4.7 (2.0-11.6)5.2 (2.5-11.1)
Viral load (<4 × 105 IU/mL)Not significantNot significant
APRINot significantNot significant
Normalized ALTNot significantNot significant

In the two treatment trials that provided patients for this study, patients with RVR were allocated to either 14 or 24 weeks of treatment with PEG-IFN/ribavirin. Accordingly, we explored the relationship between the IL28B genotype and relapse by treatment duration. Among patients with the rs12979860 CC genotype who had achieved RVR and were treated for 14 weeks, 20% (13/64) relapsed, which was significantly not different to 16% (7/43) of patients with RVR who were treated for 24 weeks (OR = 1.6, 95%CI = 0.6-4.5).

Association of Host Genotype With Stage and Activity of Liver Disease.

We found that pretreatment viral load and ALT in patients infected with genotype 3 were higher in patients carrying the CC genotype of rs12979860 compared to patients carrying CT or TT (Fig. 2). Similarly, patients carrying TT at rs8099917 had higher baseline viral load and higher normalized ALT, compared to patients carrying TG. There were too few patients with the GG genotype of rs8099917 who had been evaluated for baseline viral load and ALT for statistical analysis. Patients with the CC genotype at rs12979860 also had a significantly higher probability of having APRI > 1.5 (OR = 2.0, 95%CI = 1.1-3.5), indicative of cirrhosis or bridging fibrosis. This association was not present with the TT genotype at rs8099917 (OR = 1.3, 95%CI = 0.7-2.5).

Figure 2.

Box and whisker plots and association of (A) baseline viral load and (B) normalized ALT according to host genotype, in HCV genotype 3–infected patients.

IL28B Polymorphism Frequency in Healthy Controls.

Overall, the genotype distribution in a healthy control and ethnically-matched population at the rs12979860 loci (CC 48%, CT 39%, TT 13%) and rs8099917 loci (TT 68%, TG 30%, GG 2%) were almost identical to the HCV genotype 3–infected cohort (Table 5). The genotype distribution at both SNPs were in Hardy-Weinberg equilibrium in the healthy control and the chronically HCV–infected cohorts (P > 0.01). Taken together, comparison of the healthy population and HCV genotype 3–infected population does not indicate any evidence of a role for these two SNPs in natural clearance of HCV genotype 3 infection.

Table 5. IL28B Polymorphism Frequencies in a Healthy Population and HCV Genotype 3–Infected Patients
 Control population (n = 369)HCV Genotype 3–Infected (n = 281)OR (95% CI)
  • Abbreviations: CI, confidence interval; HCV, hepatitis C virus; n.d., no data; OR, odds ratio.

  • *

    Calculated from CC versus CT/TT.

  • Calculated from TT versus TG/GG.

rs12979860 CC179 (48%)129 (46%)1.1 (0.8-1.5)*
rs12979860 CT143 (39%)129 (46%) 
rs12979860 TT47 (13%)23 (8%) 
rs8099917 TT250 (68%)201 (71.5%)0.9 (0.6-1.2)
rs8099917 TG111 (30%)73 (26%) 
rs8099917 GG6 (2%)7 (2.5%) 
n.d.2  

Discussion

The SNPs near the IL28B gene on chromosome 19 coding for IFN-λ3 recently reported to be associated with treatment response in HCV have excited clinicians and scientists alike, they have a potential to better identify patients with HCV genotype 1 infection who are likely to benefit from PEG-IFN/ribavirin therapy, and they may reveal mechanisms associated with viral clearance and immunity. In Europe, HCV genotype 2 and 3 can be as prevalent as HCV genotype 1 and although the treatment response for HCV genotype 2 and 3–infected patients are much better, many patients do not achieve a sustained response after a full course of PEG-IFN/ribavirin therapy. Recent studies of predominantly HCV genotype 2–infected European patients show that the CC genotype at rs12979860 can predict SVR, but this is largely driven by patients who do not achieve RVR.15 In studies of HCV genotype 2–infected Asian patients, the rs8099917 TT genotype was not associated with SVR.23 Rauch al.12 have also shown no effect of rs8099917 in HCV genotype 2/3–infected patients in a smaller cohort. Similarly, Montes-Cano et al.16 show an absence of association of rs12979860 with SVR in HCV genotype 2/3–infected patients. In HCV genotype 1–infected patients, the rs12979860 CC genotype shows association with a high baseline viral load, natural clearance of the virus, and RVR to PEG-IFN/ribavirin therapy in addition to SVR.9, 13, 24 Paradoxically, high baseline viral load has been repeatedly shown to be associated with a poorer SVR. A model that explains the paradoxical effect or association of this genotype with high viral load and better therapeutic response is yet to be suggested.

Although our data is taken from two populations of HCV genotype 2–infected and genotype 3–infected patients, we were interested in HCV genotype 3–infected patients for two reasons. First, we had sufficient number of samples and data from HCV genotype 3–infected patients for statistical analysis, unlike other studies of HCV genotype 2 and 3 studies, in which genotype 2 was predominant.15, 25 Second, the SVR rate among HCV genotype 2–infected patients was high (93%, n = 70), significantly higher than HCV genotype 3–infected patients (80%, P = 0.0055) and the number of patients without SVR was too low for meaningful analysis.

We found that in HCV genotype 3–infected patients, the CC genotype at rs12979860 compared to CT/TT, and the TT genotype at rs8099917 compared to TG/GG, are associated with high baseline viral load and RVR, but not SVR. This suggests that HCV genotype 3 patients with the so-called host-responder genotypes are more likely to relapse after an early response. Our analysis of patients who had cleared virus to undetectable levels at 4 weeks or 24 weeks showed that this is in fact the case (Table 4). Similarly, Stätermayer et al.25 have reported associations of rs12979860 CC genotype and rs8099917 TT genotype with RVR but not SVR in patients with HCV genotype 2/3 infection, implying that the CC genotype may be associated with relapse in their population too. Studies of rs8099917 in Asian patients infected with HCV genotype 2 has shown a clear association between TT genotype and RVR.23

There are both clear similarities and differences between HCV genotype 1–infected and HCV genotype 3–infected patients who carry the CC genotype of rs12979860 in response to PEG-IFN/ribavirin therapy. Whereas the CC genotype is found more frequently in HCV genotype 1–infected patients who achieve SVR compared to those who relapse,13 we find this genotype more often in patients who relapse compared to patients who achieve SVR (Fig. 3). This difference in distribution of the CC genotype of rs12979860 remains significant if relapse is calculated not just from reduction of HCV RNA to undetectable levels at week 4, but also in patients with undetectable HCV RNA levels at 24 weeks (data not shown). The other noteworthy difference is the association of the rs12979860 CC genotype in natural clearance of HCV genotype 1 virus, which we could not detect in HCV genotype 3–infected patients. The association that is common to HCV genotype 1–infected and HCV genotype 3–infected patients is the responder genotype at rs12979860 and rs8099917 being associated with high baseline viral load. Mangia et al.15 show a similar trend in their predominantly HCV genotype 2–infected patients of high baseline viral load in rs12979860 CC genotype patients. Similarly, Yu et al.23 show an association of the rs8099917 TT genotype with baseline viral load in HCV genotype 2–infected patients.

Figure 3.

Frequency of the CC genotype of rs12979860 and the TT genotype of rs8099917 in HCV genotype 3–infected patients according to outcomes after treatment with PEG-IFN/ribavirin.

In our analysis of HCV genotype 3–infected patients, both rs12979860 and rs8099917 showed association with stage and activity of liver disease, namely high ALT activity and high APRI. Whereas ALT values reflect the degree of hepatocyte destruction, APRI, the relationship between serum aspartate aminotransferase levels (AST) and platelet count is a validated and reliable serum marker of stage of liver fibrosis. We indeed found both rs12979860 and rs8099917 to be associated with higher AST and lower platelet count (data not shown). A limitation of our study is the absence of liver fibrosis staging data based on biopsy that would reflect more directly, the effect of rs12979860 and rs8099917 on the natural history of HCV genotype 3 infections. Our findings are in line with findings in a predominantly HCV genotype 1–infected patient population, in which the rs12979860 responder genotype was shown to be associated with higher ALT but lower gamma glutamyl transferase levels.16 Similarly, Abe et al.17 has shown association of the rs8099917 responder genotype with lower gamma glutamyl transferase but paradoxically higher inflammatory activity in the liver.

In our patient population, the frequency of the C allele of rs12979860 was 69%, slightly higher than that reported in Americans of North European descent9, 13 and similar to that reported in a Spanish cohort of HCV-infected patients.16 The distribution of rs12979860 and rs8099917 genotypes were similar to an ethnically-matched control population, indirectly implying an absence of effect on natural clearance of HCV genotype 3. This is in contrast to the effect found in HCV genotype 1–infected cohorts and may explain why the CC genotype of rs12979860 is found more frequently in HCV genotype 2/3–infected patients compared to HCV genotype 1–infected patients.13 Furthermore, absence of association of SVR with the CC genotype of rs12979860 and differential distribution of CC genotype in HCV genotype 3–infected patients compared to HCV genotype 1–infected patients do not explain why IFN-based therapies are more effective in HCV genotype 3–infected patients compared to HCV genotype 1. Studies of Mangia et al.15 and Thomas et al.24 show a possible role of IL28B in natural clearance of HCV genotype 2 from infected patients, implying that the lack of an apparent effect on natural clearance might be specific to HCV genotype 3.

Mathematical modeling of PEG-IFN/ribavirin therapy has pointed to the biphasic and/or triphasic nature of therapy with ribavirin exerting its mutagenic effect in preventing viral rebound after a rapid initial drop in HCV RNA in response to PEG-IFN. Yet rs12979860 seems to be associated with natural clearance of HCV genotype 1 virus, high baseline viral load prior to therapy (presumably in patients who have not achieved natural clearance), an early response to therapy, and finally two opposite courses in the final stages, sustained response in HCV genotype 1–infected patients and relapse in HCV genotype 3–infected patients. The opposing effects of polymorphisms near the IL28B gene warrant further investigation with regard to their effect on natural immune response to HCV infection and to their effects on HCV after PEG-IFN/ribavirin therapy. However, it does limit the utility of using these polymorphisms as indicators for treatment in HCV-genotype 1–infected patients. In HCV genotype 3–infected patients, rs12979860 and rs8099917 major genotypes may identify patients who are likely to relapse after RVR for prolonged therapy or for adjunct therapy.

Acknowledgements

We thank the Norwegian Bone Marrow Donor Registry and Dr. Benedicte A. for making the control material available. We also thank the KBC and North-C study groups, as well as Schering Plough for their financial support that covered administrative costs for the two investigator initiated studies.

Ancillary