The antiviral protein viperin inhibits hepatitis C virus replication via interaction with nonstructural protein 5A

Authors

  • Karla J. Helbig,

    1. Center for Cancer Biology, Hanson Center, Adelaide, South Australia, and School of Molecular and Biomedical Science, University of Adelaide, Adelaide, South Australia, Australia
    Search for more papers by this author
  • Nicholas S. Eyre,

    1. Center for Cancer Biology, Hanson Center, Adelaide, South Australia, and School of Molecular and Biomedical Science, University of Adelaide, Adelaide, South Australia, Australia
    Search for more papers by this author
  • Evelyn Yip,

    1. Center for Cancer Biology, Hanson Center, Adelaide, South Australia, and School of Molecular and Biomedical Science, University of Adelaide, Adelaide, South Australia, Australia
    Search for more papers by this author
  • Sumudu Narayana,

    1. Center for Cancer Biology, Hanson Center, Adelaide, South Australia, and School of Molecular and Biomedical Science, University of Adelaide, Adelaide, South Australia, Australia
    Search for more papers by this author
  • Kui Li,

    1. Department of Molecular Sciences, University of Tennessee Health Science Center, Memphis, TN
    Search for more papers by this author
  • Guillaume Fiches,

    1. Center for Cancer Biology, Hanson Center, Adelaide, South Australia, and School of Molecular and Biomedical Science, University of Adelaide, Adelaide, South Australia, Australia
    Search for more papers by this author
  • Erin M. McCartney,

    1. Center for Cancer Biology, Hanson Center, Adelaide, South Australia, and School of Molecular and Biomedical Science, University of Adelaide, Adelaide, South Australia, Australia
    Search for more papers by this author
  • Rohit K. Jangra,

    1. Center for Hepatitis Research, Institute for Human Infections and Immunity, University of Texas Medical Branch at Galveston, Galveston, TX
    2. Department of Microbiology, Mt. Sinai School of Medicine, New York, NY
    Search for more papers by this author
  • Stanley M. Lemon,

    1. Center for Hepatitis Research, Institute for Human Infections and Immunity, University of Texas Medical Branch at Galveston, Galveston, TX
    2. Division of Infectious Disease, Department of Medicine, Inflammatory Diseases Institute, Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, NC
    Search for more papers by this author
  • Michael R. Beard

    Corresponding author
    1. Center for Cancer Biology, Hanson Center, Adelaide, South Australia, and School of Molecular and Biomedical Science, University of Adelaide, Adelaide, South Australia, Australia
    • School of Molecular and Biomedical Science, The University of Adelaide, North Terrace, Adelaide 5005, Australia
    Search for more papers by this author
    • Fax: 08 8303 7532


  • Potential conflict of interest: Nothing to report.

  • This work was supported by the NH&MRC of Australia (to M.R.B and K.J.H) and the National Institutes of Health (Bethesda, MD) (U19-AI40035-14 and R21-AI081058-1 to S.M.L.; R01-AI069285 to K.L).

Abstract

The interferon-stimulated gene, viperin, has been shown to have antiviral activity against hepatitis C virus (HCV) in the context of the HCV replicon, although the molecular mechanisms responsible are not well understood. Here, we demonstrate that viperin plays an integral part in the ability of interferon to limit the replication of cell-culture–derived HCV (JFH-1) that accurately reflects the complete viral life cycle. Using confocal microscopy and fluorescence resonance energy transfer (FRET) analysis, we demonstrate that viperin localizes and interacts with HCV nonstructural protein 5A (NS5A) at the lipid-droplet (LD) interface. In addition, viperin also associates with NS5A and the proviral cellular factor, human vesicle-associated membrane protein-associated protein subtype A (VAP-A), at the HCV replication complex. The ability of viperin to limit HCV replication was dependent on residues within the C-terminus, as well as an N-terminal amphipathic helix. Removal of the amphipathic helix-redirected viperin from the cytosolic face of the endoplasmic reticulum and the LD to a homogenous cytoplasmic distribution, coinciding with a loss of antiviral effect. C-terminal viperin mutants still localized to the LD interface and replication complexes, but did not interact with NS5A proteins, as determined by FRET analysis. Conclusion: In conclusion, we propose that viperin interacts with NS5A and the host factor, VAP-A, to limit HCV replication at the replication complex. This highlights the complexity of the host control of viral replication by interferon-stimulated gene expression. (HEPATOLOGY 2011;)

Hepatitis C virus (HCV) is a leading cause of chronic hepatitis and liver-related morbidity worldwide. A significant proportion of infected individuals fail to develop an effective host antiviral response and develop a chronic infection, often resulting in a progressive liver disease, including cirrhosis and hepatocellular carcinoma.1 The current standard-of-care therapy for chronic hepatitis C (CHC) is a combination of pegylated interferon alpha (IFN-α) and ribavirin that results in sustained viral clearance in, at best, 50% of patients.

Viral infection of mammalian cells results in the activation of a number of viral recognition pathways triggered by replication intermediates and/or viral proteins that ultimately induce innate defenses to limit viral replication.2-4 Pivotal to this antiviral response is the induction of IFN. The type I IFNs (IFN-α and β) are essential for immune defenses against viruses and, after binding to the type I IFN receptor, induce the expression of hundreds of interferon-stimulated genes (ISGs), many of which act to limit viral replication. Although a number of these ISGs have well-characterized antiviral activity (i.e., myxovirus resistance-A [MxA], protein kinase R [PKR], and 2′,5′-oligoadenylate synthetase [2′,5′-OAS]), the complete spectrum of antiviral ISGs and their mechanisms of action remain to be elucidated.3

The ISGs responsible for controlling HCV replication in response to IFN (either endogenously induced or therapeutically given) remain ill defined, although a picture of the ISGs capable of controlling HCV replication is emerging. The ISG 2,5-OAS has been shown to inhibit HCV replication through the RNAse L pathway,5 whereas IFN-α mediated suppression of HCV replication in vitro is independent of MxA.6 A number of less well-characterized ISGs have also been demonstrated to inhibit HCV replication; studies have demonstrated that ISG6-16 can enhance the anti-HCV activity of IFN-α,7 whereas ISG56 has direct anti-HCV activity through its ability to suppress HCV internal ribosome entry site (IRES) translation.8 More recently, PKR and the 3′- to 5′-exonuclease, ISG20, have been demonstrated to inhibit HCV replication.9, 10 Clearly, anti-HCV ISG effectors remain to be discovered and characterized.

Viperin is an evolutionarily conserved type I ISG, previously demonstrated by our laboratory and others to have antiviral properties against HCV in vitro,9, 11 and a number of other viruses, including human cytomegalovirus, influenza, alphaviruses, human immunodeficiency virus, and dengue, as reviewed elsewhere.12 However, the mechanism by which viperin exerts its anti-HCV effect is unknown. Viperin localizes to both the endoplasmic reticulum (ER) and lipid droplets (LDs), and considering the LD is central to the HCV life cycle, it has been hypothesized that viperin inhibits HCV replication at this location.12, 13 In this study, we show that viperin suppresses the replication of cell-culture–derived infectious HCV, and demonstrate, for the first time, that viperin interacts with nonstructural protein 5A (NS5A) at the LD interface and within the replication complex (RC). Furthermore, we also show that viperin colocalizes with the known proviral cellular factor, human vesicle-associated membrane protein-associated protein subtype A (VAP-A) within the HCV RC, strongly suggesting that viperin exerts its effect at the level of HCV RNA replication.

Abbreviations

ADRP, adipocyte differentiation-related protein; CHC, chronic hepatitis C; cDNA, complementary DNA; dsRNA, double-stranded RNA; ER, endoplasmic reticulum; FDPS, farnesyl diphosphate synthase; FRET, fluorescence resonance energy transfer; GFP, green fluorescent protein; HCV, hepatitis C virus; IFN, interferon; Ig, immunoglobulin; IRES, internal ribosome entry site; ISG, interferon-stimulated gene; LD, lipid droplet; MOI, multiplicity of infection; mRNA, messenger RNA; MxA, myxovirus resistance-A; NS5A, nonstructural protein 5A; 2′5′-OAS, 2′,5′-oligoadenylate synthetase; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; PKR, protein kinase R; RC, replication complex; RIG-I, retinoic-acid&inducible gene; RNAi, RNA interference; RT, room temperature; SAM, S-adenosyl methionine; SEM, standard error of the mean; shRNA, short-hairpin RNA; VAP-A, human vesicle-associated membrane protein-associated protein subtype A; VSV-G, vesicular stomatitis virus glycoprotein; WT, wild type.

Materials and Methods

Cell Lines.

The human hepatoma cell lines, Huh-7, Huh-7.5 (Charles Rice, Rockefeller University, New York, NY), NNeoC5B, and NNeo3-5B,14 were maintained as previously described.15 Huh-7 cells stably expressing viperin short-hairpin RNA (shRNA) were generated using a five-clone shRNA set in pLKO.1 purchased from Open Biosystems (Thermo Scientific, Auburn, AL). These constructs, including a shRNA control, were cotransfected with the packaging vectors, psPAX2 and pMD2.G, into 293T cells to generate vesicular stomatitis virus glycoprotein (VSV-G)-pseudotyped lentiviral particles. Supernatants containing virus were pooled 48 and 72 hours after transfection, 0.45-μm-filtered, and placed on Huh-7 cells at a ratio of 1:5 with standard culture media and 8 μg/mL of polybrene. Polyclonal cell populations were selected with 3 μg/mL of puromycin. Knockdown of viperin expression was confirmed by treatment of selected polyclonal cell lines with 10 and 50 U/mL of IFN-α, and real-time polymerase chain reaction (PCR) was utilized to assess the up-regulation of viperin, compared to the control shRNA cell line.

Viruses and Antibodies.

Infectious genotype 2a JFH-1 HCV was prepared as previously described.16, 17 The HCV monoclonal NS5A antibody (9E10) was a kind gift from Charles Rice. The mouse monoclonal HCV core (C7-50) antibody was purchased form Abcam (Cambridge, MA). Mouse monoclonal anti-FLAG, rabbit polyclonal anti-FLAG, and goat anti-GFP (green fluorescent protein) biotinylated antibodies were respectively obtained form Sigma-Aldrich (St. Louis, MO) and Rockland (Gilbertsville, PA). Rabbit polyclonal viperin antibodies were generated as previously described.18 Bodipy 493/503 (Invitrogen, Carlsbad, CA) was prepared as a stock solution of 1 mg/mL in ethanol.

Plasmids and Transfections.

Human farnesyl diphosphate synthase (FDPS) was amplified from human liver complementary DNA (cDNA) and cloned into pLNCX2 between Not I and Xba I using the following primers: 5′-attcgcggccgcatgcccctgtcccgctggttgagatc-3; and 5′-aacctctagatcaagcgtagtctgggacgtcgtatgggtactttctccgcttgtagattttgcgcgcaag-3′, engineering it to contain a 3′-HA tag. pLenti6-mCherry was generated by cloning mCherry cDNA (lacking a stop codon) into BamHI and XhoI sites of pLenti6/V5-D-TOPO (Invitrogen). Human VAP-A (transcript variant 2) and Rab5A cDNA were PCR-amplified from Huh-7.5 cell cDNA using the following oligonucleotides (restriction sites are italicized): VAP-A (5′-catctcgagctatggcgtccgcctcaggg-3′ and 5′-ggtacgcgttgcatgcttcactctacaagatgaatttc-3′) and Rab5A (5′-catctcgagcttcaaccatggctagtcgaggcgcaa-3′ and 5′-ggtacgcgtttagttactacaacactgattcct-3′) and cloned, in-frame, into XhoI and MluI sites of pLenti6-mCherry. The expression plasmid, pHalo-PI4K-IIIα, was purchased from Promega (Madison, WI) (Kazusa DNA Research Institute clone pFN21AB1434). pEGFPC1-ALDI and pEGFPC1-ADRP (adipocyte differentiation-related protein) were generously provided by Albert Pol (University of Barcelone, Barcelona, Spain) and John McLauchlan (MRC Virology Unit, Glasgow, UK), respectively. The human viperin plasmid has previously been described,11 and mutant versions of the plasmid were constructed in pLNCX2, either via mutagenesis PCR utilizing a QuickChange mutagenesis II system (Stratagene, La Jolla, CA) or via PCR cloning using the HindIII and NotI sites and 5′FLAG tagging the constructs, using the primers listed in Table 1. Transfection of all plasmids was performed using Fugene6 (Roche, Nutley, NJ), according to the manufacturer's recommendations.

Table 1. Mutagenesis Primers
Plasmid*Sense Primer (5′–3′)Antisense Primer (5′–3′)
  • *

    plncx2 backbone.

 Mutagenesis primers
L142835AL2835A 
 gtggaggagcgcggtcccgctgttctgctgggcgagggcaaccttctagaaggttgccctcgcccagcagaacagcgggaccgcgctcctccac
 Followed by L14 
 ctgcttttgctgggaagctcgcgagtgtgttcaggcaacctgcgagcgctcgcaggttgcctgaacacactcgcgagcttcccagcaaagcag
SAM1cactcgccaggccaactacaaagccggcttcgctttccacacagcgctgtgtggaaagcgaagccggctttgtagttggcctggcgagtg
SAM2gcttaaggaagctggtatggagaagaacaaccaatcac aacaaaagccatttcttcaagaccggggagaatacctggccaggtattctccccggtcttgaagaaatggcttttgt tgtgattggttgttcttctccataccagcttccttaagc
SAM3ccagcgtgagcatcgtggcccttgcaagcctgatccgggcccggatcaggcttgcaagggccacgatgctcacgctgg
SAM4ggacattctcgctatcgcctgtctcgcctttgacgaggaagtcaatgtccggacattgacttcctcgtcaaaggcgagacaggcgatagcgagaatgtcc
 Cloning primers 
W361Actcaagcttatggactacaaggacgacgatgacaagatgtgggtgcttacacctgccaatgcggccgcccgctctacgcatccagcttc
5′Δ17ctcaagcttatggactacaaggacgacgatgacaagatgtgggtgcttacacctgcattagcggccgcctaccaatccagcttcagatcagcctta
5′Δ33aataagcttatggactacaaggacgacgatgacaagatgctgagggcaaccattagcggccgcctaccaatccagcttcagatcagcctta
5′Δ50tgagcttatggactacaaggacgacgatgacaagatggtcctgagagggccagatgattagcggccgcctaccaatccagcttcagatcagcctta
3′Δ17ctcaagcttatggactacaaggacgacgatgacaagatgtgggtgcttacacctgcattgcggccgcctacttcagaaacatcttttc
3′Δ33ctcaagcttatggactacaaggacgacgatgacaagatgtgggtgcttacacctgcattgcggccgcctaaccaacatccaggatgg
3′Δ50ctcaagcttatggactacaaggacgacgatgacaagatgtgggtgcttacacctgcattgcggccgcctacagaaagcgcatatattc
3′Δ4ctcaagcttatggactacaaggacgacgatgacaagatgtgggtgcttacacctgcttatctcgagctacagatcagccttactcc
3′Δ6ctcaagcttatggactacaaggacgacgatgacaagatgtgggtgcttacacctgcttatctcgagctaagccttactccatatgtattt
3′Δ10ctcaagcttatggactacaaggacgacgatgacaagatgtgggtgcttacacctgcttatctcgagctatatgtattttcctcctcgcttc
3′Δ14ctcaagcttatggactacaaggacgacgatgacaagatgtgggtgcttacacctgcTtatctcgagctatcctcgcttcagaaacatcttttc

Real-time PCR.

All experiments involving real-time PCR were performed in 12-well plates with Huh-7 cells seeded at 8 × 104/well, 24 hours before transfection/infection, and performed at least in triplicate. RNA was extracted from cells using Trizol reagent (Invitrogen). First-strand cDNA was synthesized from total RNA, and real-time PCR analysis was utilized to quantitate relative levels of HCV RNA and viperin messenger RNA (mRNA), in comparison to the housekeeping gene, RPLPO. Reaction conditions and primers are expressed as described previously.11

Immunofluorescence Staining.

Huh-7 cells were seeded on 0.2% gelatin-coated coverslips in 24-well trays (4 × 104 cells/well) 24 hours before transfection/infection. Cells were either fixed using methanol/acetone (1:1) for 5 minutes on ice for standard microscopy or with 4% paraformaldehyde for 10 minutes on ice, followed by a 10-minute incubation in 0.1% Triton-X in phosphate-buffered saline (PBS) for confocal microscopy, before incubation with primary antibodies for 1 hour at room temperature (RT). Cells were washed in PBS and incubated with secondary antibodies for 1 hour at RT before being mounted with Prolong Gold reagent (Invitrogen). Images were acquired with a Bio-Rad Radiance 2100 Confocal (Bio-Rad, Hercules, CA) or a Nikon TiE inverted microscope (Nikon, Tokyo, Japan).

Fluorescence Energy Resonance Transfer Analysis.

Acceptor photobleaching was carried out essentially as previously described19 with the use of Alexa 555– (Invitrogen) and Cy5 (Jackson Laboratories, Westgrove, PA)-conjugated secondary antibodies or GFP- and mCherry-tagged protein constructs. Images of the acceptor and donor flurophores were acquired using a Zeiss Axioplan2 upright microscope, using a 63× PlanApo objective (Carl Zeiss AG, Oberkochen, Germany). Acceptor photobleaching was performed at maximum light intensity for 30-180 seconds, followed by reimaging of the donor and acceptor fluorophores (this was an automated process ensuring identical imaging conditions). The fluorescence energy resonance transfer (FRET) signal (increase in signal postbleach) was determined by the subtraction of the pre- from postbleach donor image using ImageJ software.20 LDs and putative RCs positive for both proteins being examined were selected, and the average intensity in that region was compared on the aligned pre- and postbleach images (the plug-in StackReg was utilized to control for lateral image displacement, and the FRET signal was displayed using the “fire” lookup table). Multiple lipid droplets and/or cytoplasmic foci that were positive for both proteins being measured were examined from at least 10 different cells in each of at least two independent experiments to ensure reproducibility. Negative slides were prepared by either omitting the primary antibody for the acceptor molecule or in the case of the GFP/mCherry FRET-imaging cells, with only the donor molecule present.

Luciferase Assays.

Luciferase assays were performed as previously mentioned.10, 21 Briefly, Huh-7 cells were seeded at 8 × 104 in 12-well plates 24 hours before transient transfection using Fugene, with either pLNCX2-viperin, pLNCX2-viperin3′Δ17, or empty vector. Twenty-four hours after transfection, cells were transfected using 2 μg of in vitro transcribed RNA (DMRIE-C) representing SGRm-JFH1BlaRL.10 Input Renilla luciferase was measured at 3 hours post-RNA transfection to obtain a background reading, with further measurements being taken at 24 and 48 hours. All time points were performed in quadruplicate. Luciferase assays involving the dicistronic reporter plasmid, pRLHL,21 were performed in a similar manner, with firefly and Renilla luciferase measured at 24 hours postvector transfection. RLuc is translated via cap-dependent translation, whereas the translation of FLuc is directed by the HCV IRES.

Statistical Analysis.

Student t-tests were utilized to analyze the distributions of 2 normally distributed data sets. All statistical analysis was performed using SPSS 10 (SPSS, Inc., Chicago, IL).

Results

Viperin Is Induced During HCV Infection of Huh-7 Cells and Inhibits Replication.

We have previously demonstrated that viperin mRNA expression in Huh-7 cells is responsive to either the double-stranded RNA (dsRNA) analog, poly I:C, or in vitro transcribed HCV RNA.11 To extend these observations in the context of the complete HCV life cycle, we infected Huh-7 cells with HCV JFH-1 and monitored viperin mRNA expression. Viperin mRNA expression was significantly increased (∼25-fold) at 72 hours postinfection, which coincided with an increase in HCV RNA (Fig 1A). Interestingly, similar experiments performed in the Huh7.5 cell line, which is defective in dsRNA signaling via a mutation in the pathogen-recognition receptor, retinoic-acid inducible gene (RIG-I),22 showed only a slight increase in viperin mRNA expression, even though greater than 95% of cells were infected (Fig 1B; Supporting Fig. 1), implying that its expression in the Huh-7s was RIG-I mediated. We also extended our previous results using the HCV replicon system to show that after transient expression of viperin, HCV JFH-1 replication was inhibited by approximately 45% (Fig. 1C). Interestingly, dual immunostaining for both HCV antigen (NS5A) and viperin revealed few cells expressing both antigens, even though control cells were approximately 90% positive for HCV (Fig. 1D). In those cells expressing both NS5A and viperin, a much lower level of HCV NS5A expression was noted (Fig. 1D, arrows). These results confirm the anti-HCV activity of viperin using the more physiologically relevant JFH-1 infectious virus system.

Figure 1.

Viperin is antiviral and important in the anti-HCV properties of IFN. (A, B) Expression of viperin in HCV-infected Huh-7 and Huh-7.5 cells. Cells were infected with JFH-1 at a multiplicity of infection (MOI) of 0.03 and RNA was harvested for real-time PCR at the indicated time points (data are represented as mean + standard error of the mean [SEM]). (C) Viperin expression limits HCV replication. Huh-7 cells were transfected with pLNCX2-viperin 24 hours before JFH-1 infection (MOI = 0.03), and RNA was harvested 24 hours postinfection. HCV replicon cells were transfected with pLNCX2-viperin and were cell sorted for positive expression 48 hours post-transfection (data are represented as mean ± SEM, with a significance of P < 0.05 calculated using a Student's t-test for all three samples). (D) Viperin limits HCV replication. Huh-7 cells were transfected with pLNCX2-viperin 24 hours pre-JFH-1 infection (MOI = 0.03) and immunofluorescence staining performed 48 hours later using a rabbit polyclonal antiviperin antibody and a mouse monoclonal anti-NS5A antibody, followed by an Alexa 488–conjugated goat antirabbit immunoglobulin (Ig) and an Alexa 555–conjugated goat antimouse Ig secondary antisera. Red cells are stained for NS5A antigen, and green cells are expressing viperin, with dual-labeled cells indicated by arrowheads. (E) shRNA-mediated inhibition of IFN-induced viperin expression in Huh-7 cells. Polyclonal Vip-shRNA cell line #5 and its control were infected with JFH-1 (MOI = 0.03), then treated with IFN-α 24 hours postinfection for 16 hours before real-time PCR was performed on extracted RNA (data are represented as mean + SEM; *P < 0.001 for Vip-shRNA cell line #5 versus the control at the indicated treatments). (F) Viperin knockdown reduces the anti-HCV activity of IFN. The polyclonal Vip-shRNA cell line #5 and its control were either pretreated (24 hours) before JFH-1 infection (MOI = 0.03) or post-treated 24 hours after infection for 16 hours with 50 U/mL of IFN-α. RNA was analyzed using real-time PCR (data are represented as mean + SEM, with a significance of P < 0.05 for control cells versus viperin shRNA in the pre- and post-IFN calculated using a Student's t-test).

shRNA Knockdown of Viperin Reduces the Antiviral Effect of IFN-α.

To determine whether endogenous viperin would have anti-HCV activity after IFN-α stimulation, we created a number of polyclonal Huh-7 cell lines stably expressing shRNA targeting viperin mRNA (Supporting Fig. 2). The cell line, Vip shRNA#5, compared to a control cell line expressing nonspecific shRNA, produced significantly less viperin mRNA after IFN-α stimulation (Fig. 1E; P < 0.001). Vip shRNA#5 cells stimulated for 24 hours with varying concentrations of IFN-α had approximately 90%-95% less viperin mRNA than their control counterparts. Vip shRNA#5 cells were then either pretreated with IFN-α for 24 hours before JFH-1 infection or treated with IFN-α for 24 hours after JFH-1 infection. The control cell line was able to reduce HCV replication levels by 69% and 66%, respectively, after either pre- or post-IFN-α treatment, whereas the Vip shRNA#5 cell line was only able to reduce HCV replication by 45% and 37%, respectively, under the same conditions (Fig. 1F). These results demonstrate that viperin plays an important, but not exclusive, role in the antiviral effects of IFN-α against HCV in vitro.

Viperin Interacts With HCV Core and NS5A.

Previous reports suggest that viperin localizes to the ER18, 23; however, we and others have observed that viperin also localizes to LDs in Huh-7 cells (Supporting Figs. 3 and 4).24 The LD plays an important role in the HCV life cycle, because both core and NS5A localize to the LD surface.25 With this in mind, we investigated the distribution of viperin, HCV core, and NS5A in Huh-7 cells productively infected with JFH-1 using confocal microscopy. These studies revealed considerable, but not absolute, colocalization between viperin and both core and NS5A proteins surrounding LDs (Fig. 2A). In addition, viperin also colocalized with NS5A in a proportion of small cytoplasmic foci that have been well characterized as part of the HCV RC26 (arrowheads in Fig. 2B). Next, we investigated the localization of viperin and NS5A in cells harboring a HCV subgenomic replicon devoid of HCV structural proteins. In these cells, viperin colocalized with NS5A in a similar manner to that observed for JFH-1-infected cells with colocalization of viperin and NS5A at the RC and LD surface (Fig. 2C, inset), although the latter was not as pronounced as in JFH-1 infection. This suggests that viperin may exert its antiviral effect through a possible interaction with NS5A, either within the RC or at the LD surface. To extend our confocal microscopy results and to determine whether viperin would physically interact with NS5A and core, FRET was utilized. Even though viperin and ADRP colocalize by confocal analysis, no positive FRET was observed (Fig. 3A), indicating that it is unlikely that these two proteins physically interact. In contrast, Huh-7 cells infected with JFH-1 displayed significant FRET at the LD surface between viperin and either HCV core or NS5A, in addition to positive FRET with NS5A within the HCV RC (Fig. 3B,C). Collectively, these results strongly suggest that viperin is able to interact with core and NS5A on the LD surface and with NS5A within the RC.

Figure 2.

Viperin colocalizes with HCV core and NS5A proteins.

(A, B) Huh-7 cells were infected with JFH-1 (MOI = 0.03) for 72 hours, before being transfected with pLNCX2-viperin. Cells were stained 24 hours after transfection with a rabbit polyclonal antiviperin antibody or a mouse monoclonal anticore or anti-NS5A, followed by an Alexa 555–conjugated goat antirabbit Ig or an Alexa 555–conjugated goat antimouse Ig secondary antisera. The boxed region is shown enlarged in (B), with arrows indicating colocalization of viperin and NS5A in putative RC (LD = lipid droplet). (C) NNeo3-5B cells were transfected with pLNCX2-viperin and stained as described above 48 hours later.

Figure 3.

Viperin displays positive FRET with HCV core and NS5A.

Huh-7 cells were infected with JFH-1 (MOI = 0.03) for 48 hours, before being transfected with pLNCX2-viperin or being cotransfected with pLNCX2-viperin and pEGFPC1-ADRP. Twenty-four hours post-transfection, cells were stained with either a rabbit polyclonal antiviperin antibody, followed by an Alexa 555–conjugated goat antirabbit Ig and (A) a biotinylated goat anti-GFP antibody and a CY5-conjugated rabbit antigoat Ig, (B) a mouse monoclonal anticore antibody, followed by a CY5 goat antimouse Ig, or (C) a mouse monoclonal anti-NS5A, followed by a CY5 goat antimouse Ig. Slides were analyzed on a Zeiss Axioplan microscope for FRET, with a representative cell displaying a positive FRET signal shown for each experiment (Carl Zeiss AG, Oberkochen, Germany) (data are represented as mean ± SEM with a significance of P < 0.001 for [B] and [C]).

Mutagenic Analysis Reveals Important Regions of Viperin for Anti-HCV Activity.

Little is known about the functional aspects of viperin that contribute to its antiviral activity. Recent work has demonstrated that viperin is able to bind the enzyme, FDPS, and interrupt the mevalonate pathway, causing a restriction in influenza budding from lipid rafts.23 Restoration of this pathway did not rescue HCV replication in viperin-expressing cells, thereby indicating an alternative antiviral mechanism for the protein in the context of HCV (Supporting Fig. 6).

Viperin is a member of the radical S-adenosyl methionine (SAM) family of enzymes27 and contains four radical SAM motifs, in addition to a putative leucine zipper domain, which may be of importance in protein-protein interactions. To further understand the anti-HCV mechanism of viperin, mutations were made to destabilize the leucine and SAM1-4 domains (Fig. 4A). In contrast to previous reports,9 all viperin mutations retained anti-HCV activity in JFH-1-infected Huh-7 cells (Fig. 4B; M1-4). Next, we created a panel of deletion mutants from the N- and C-termini of viperin (Fig. 4A). Deletion of 33 or 17 amino acids from the N- and C-termini, respectively, abrogated viperin's anti-HCV function (Fig. 4B). Interestingly, coincident with the loss of anti-HCV activity for the N-terminal deletions was a redistribution of viperin from the LDs and ER to a homogeneous cytoplasmic pattern (Fig. 4C). This was not entirely unexpected, given the presence of an N terminally located amphipathic-alpha helix,13, which is thought to allow peripheral proteins to anchor into the ER, induce curvature of the ER, and bind LD surfaces.28 In contrast to previous reports,9 the six terminal amino acids were not required for antiviral activity (Fig. 4B; Supporting Fig 5). However, deletion of 10 amino acids abrogated the anti-HCV action of viperin.

Figure 4.

Viperin N′- and C′-terminal mutants are not antiviral.

(A) Schematic diagram of viperin and mutant derivatives. (B) Analysis of the anti-HCV activity of the viperin mutants. Huh-7 cells were transfected with pLNCX2-viperin or the indicated mutant, viperin, plasmid and, 24 hours later, infected with JFH-1 (MOI = 0.03) for 24 hours before RNA harvest and real-time PCR analysis (data are represented as mean ± SEM; *P < 0.05). (C) N-terminal mutants of viperin have altered localization. Huh-7 cells were transfected with pLNCX2-viperin or one of the six pLNCX2-viperin truncation mutants. Cells were stained 24 hours after transfection with either a rabbit polyclonal antiviperin antibody, followed by an Alexa 488–conjugated goat antirabbit Ig, or, in the case of the C-terminal mutants, a mouse monoclonal anti-FLAG antibody, followed by an Alexa 488–conjugated goat antimouse Ig antisera.

Figure 5.

The C-terminus of viperin is important for its interaction with HCV core and NS5A. Huh-7 cells were infected with JFH-1 (MOI = 0.03) for 48 hours before being transfected with viperin 3′Δ17. Twenty-four hours post-transfection, cells were stained with a rabbit polyclonal anti-FLAG antibody, followed by an Alexa 555–conjugated goat antirabbit Ig and (A) a mouse monoclonal anti-NS5A antibody, followed by a CY5 goat antimouse Ig or (B) a mouse monoclonal anticore antibody, followed by a CY5 goat antimouse Ig. Slides were analyzed on a Zeiss Axioplan microscope for FRET (Carl Zeiss AG, Oberkochen, Germany) (data are represented as mean ± SEM).

In contrast to N-terminal deletions, C-terminal truncations of viperin localized to the ER and LD (Fig. 4C) and colocalized with HCV core and NS5A (Fig. 5A,B), even though its antiviral activity had been abrogated (Fig. 4B). FRET analysis of JFH-1-infected Huh-7 cells expressing the 3′Δ17 viperin mutant revealed that viperin was no longer associated with either HCV core or NS5A (Fig. 5A,B). Collectively, these results demonstrate that the final 10 amino acids of the C-terminal region of viperin are essential for its ability to limit intracellular HCV RNA levels through interaction with HCV NS5A and/or core.

Viperin Interrupts HCV Replication.

Given the ability of viperin to limit the HCV subgenomic replicon (Fig. 1C), and its interaction with NS5A within the RC (Fig. 3B), we hypothesized that viperin was acting at the level of HCV RNA replication. To investigate the mechanism of viperin action in more detail, we used a subgenomic HCV replicon that encodes the Renilla luciferase reporter gene (SGRm-JFH1BlaRL) that allowed us to investigate the kinetics of HCV RNA replication uncoupled from virion assembly.10 Compared to control (empty plasmid) or a viperin 3′-deletion mutant that has no antiviral activity (pLNCX2-viperin3′Δ17), cells transfected with wild-type (WT) viperin expressing plasmid revealed a significant decrease in Renilla output (P = 0.005) at 48 hours post-transfection (Fig. 6A). We also discounted any effect of viperin on HCV IRES–directed translation (Fig. 6C). Collectively, these results suggest that viperin acts at the level of HCV RNA replication via a direct interaction of viperin with NS5A at the RC.

Figure 6.

Viperin inhibits HCV RNA replication, but not IRES activity. (A) Huh-7 cells were transiently transfected with pLNCX2-viperin, pLNCX2-viperin3′Δ17, or empty vector 24 hours before RNA transfection with SGRm-JFH1BlaRL. (B) Representative transfections efficiencies of the viperin plasmids. (C) Effects of viperin on HCV IRES activity were ascertained via transient transfection of the HCV-IRES plasmid, pRLHL, with either pLNCX2 or pLNCX2-viperin into Huh-7 cells. Luciferase read-outs were taken 24 hours after transfection and were controlled by Renilla expression. All data are represented as mean ± SEM, *P < 0.05.

Viperin Colocalizes With VAP-A, a Known NS5A Interacting Cellular Factor.

A number of cellular factors, including Rab5a, VAP-A, and the ER lipid kinase, PI4K-IIIa, are essential for HCV replication and colocalize with NS5A at the RC.29, 30 We, therefore, investigated the potential for interaction between the above-mentioned factors and viperin using confocal microscopy. In the absence of productive HCV infection, viperin colocalized with VAP-A, but not Rab5a or PI4K-IIIa (Fig. 7A). To investigate the significance of the viperin/VAP-colocalization in the context of HCV replication, FRET analysis between viperin and VAP-A was performed in Huh-7 cells harboring the HCV full-length genomic replicon. Viperin was found to positively interact with VAP-A in small cytoplasmic foci representing RCs (Fig. 7B). These results confirm that viperin/NS5A cytoplasmic structures are RCs, and suggest that the interaction of viperin with VAP-A at the RC may destabalize HCV RNA replication.

Figure 7.

Viperin interacts with the HCV RC factor, VAP-A.

(A) Huh-7 cells were transiently transfected with pLNCX2-viperin and either pLenti6-mCherry-Rab5a, Halo-PI4K-IIIα, or pLenti6-mCherry-VAP-A. Twenty-four hours post-transfection, the Halo-TMR ligand (Promega, Madison, WI) was mixed with cells expressing PI4K-IIIα for 15 minutes before being washed out, and all cells were fixed. Cells were stained for viperin using a mouse monoclonal anti-FLAG antibody, followed by an Alexa 488–conjugated goat antimouse Ig antisera. (B) NNeoC-5B cells were cotransfected with pEGFP-viperin and pLenti6-mCherry-VAP-A. Twenty-four hours post-transfection, cells were fixed and the slides were analyzed on a Zeiss Axioplan microscope for FRET (Carl Zeiss AG, Oberkochen, Germany), with a representative cell displaying a positive FRET signal shown (data are represented as mean ± SEM, with a significance of P < 0.001).

Discussion

The standard treatment for CHC is IFN-α2/ribavirin combination therapy; however, at the molecular level, its mode of action is not well understood. In individuals that clear HCV after IFN therapy, there is a rapid first phase of decline lasting approximately 1-2 days, followed by a slower second phase of decline.31 This early decline suggests that IFN has a direct effect on HCV replication via expression of antiviral ISGs in infected hepatocytes. This observation has been validated in vitro with IFN-α treatment of replicon cells resulting in a dose-dependant decrease in HCV RNA,32, 33 whereas long-term treatment with IFN-α can completely cure these cells of HCV replication.34 However, the ISGs responsible for this decrease in HCV RNA are not well characterized. Considering that hundreds of ISGs are induced after IFN stimulation, a systematic approach is required to identify novel ISGs with antiviral activity.

We previously identified the ISG, viperin, as being significantly expressed in the HCV-infected liver and, subsequently, demonstrated viperin to have anti-HCV activity.11 In this study, we now show that viperin is antiviral in the context of the complete HCV life cycle. Consistent with viperin being an ISG, we also observed that in Huh-7 cells, there was a significant increase in viperin mRNA after infection with HCVcc (JFH-1). Interestingly, this increase in viperin mRNA was not observed in Huh-7.5 cells that are highly permissive for HCV infection and defective in the dsRNA-sensing molecule, RIG-I. This strongly suggests that viperin expression is induced through the cellular innate dsRNA response and subsequent interferon production that feeds back to induce viperin expression through IRF3- and ISGF3-dependent mechanisms.35, 36 To confirm viperin's anti-HCV activity, we knocked down viperin expression, using an RNA interference (RNAi) approach, and were able to demonstrate, for the first time, that viperin plays an important, but not exclusive, role in the anti-HCV activity of IFN-α. Considering that many genes are differentially regulated in Huh-7 cells after IFN-α stimulation, it is highly likely that a coordinated ISG response is responsible for the control of HCV replication.

A number of studies have suggested that viperin has an ER distribution18, 23; however, we and others have observed that viperin localizes to both LDs and, in our studies, the HCV NS5A-positive RCs.24 LDs have recently been shown to be an essential component of the HCV life cycle,25 and it is thought that the close association of the LD and ER membranes provides a microenvironment essential for HCV RNA replication and virion production. It has been hypothesized that the interaction of viperin with NS5A at the LD surface is the possible mechanism whereby viperin exerts its antiviral effect through the disruption of virion assembly.12, 13 However, a number of lines of evidence suggest that this is unlikely. First, viperin exerts its anti-HCV effect against the HCV subgenomic replicon, which lacks the HCV structural proteins and is defective in virion assembly. This would also suggest that the viperin-core interaction we observed is not fundamental to viperin antiviral activity, and that the interaction with NS5A is critical. It is plausible that the observed interaction between viperin and core at the surface of the LD is mediated by the ability of core to recruit and interact with NS5A at the LD surface to initiate virion assembly. Second, viperin is antiviral against a genotype 2a HCV subgenomic replicon (SGRm-JFH1BlaRL), in which the HCV IRES drives the expression of the luciferase reporter gene to allow for the quantitative measurement of HCV RNA replication kinetics uncoupled from virion assembly after transfection of in vitro transcribed HCV RNA.10 Expression of viperin significantly suppressed luciferase output from this HCV subgenomic replicon, suggesting that the anti-HCV effect of viperin was at the level of HCV replication and not virion assembly. Finally, through confocal miscroscopy and FRET analysis, we have conclusively shown that viperin interacts with both NS5A and the proviral host factor, VAP-A, within the HCV RC. VAP-A (also known as hVAP-33) is a known interacting partner with NS5A (and NS5B) and is required for the efficient replication of HCV genomic RNA.30 Although the exact mechanism of how VAP-A enhances HCV replication is unknown, VAP-A is involved in the regulation, biosynthesis, and trafficking of sterols and lipids and is thought to be involved in the formation of the HCV RC.30 Thus, based on our observations, it is conceivable to envisage that viperin interacts with VAP-A at the HCV RC, and that this interaction perturbs the association of NS5A with VAP-A that is essential for efficient viral RNA replication.

In this study, we have shown that the ISG viperin is physically associated with the HCV NS5A and core proteins at the LD interface while interacting with the proviral host factor, VAP-A, at the HCV RC. Through the mutational analysis of viperin, we have also demonstrated that the presence of the N-terminal amphipathic helix of viperin is important to localize the protein to the LD and RC, and that the C-terminal region of viperin is essential for its ability to interact with NS5A and exert its anti-HCV action. Furthermore, we have demonstrated that viperin is antiviral against HCV JFH-1 and the HCV subgenomic replicon (genotype 1b and 2a), suggesting that the interaction with core protein is not essential for its antiviral activity. This strongly implicates the association of viperin with NS5A and VAP-A at the RC as the site where viperin exerts its novel antiviral activity through altering the stability and/or functionality of the HCV RC. Interestingly, whereas the list of viruses toward which viperin exerts its antiviral effect on is growing, its mode of action is unique in many cases, highlighting the complexity of this multifunctional protein. This work adds to our understanding of viral host interaction and hepatocyte response to overcome viral infection. Moreover, defining the mechanism of action of these ISGs will add to our understanding of HCV replication and may present novel therapeutic strategies for CHC.

Acknowledgements

The authors thank Takaji Wakita for the use of JFH-1 and Charles Rice for the use of Huh7.5 cells and the kind gift of the HCV monoclonal NS5A antibody (9E10). The authors also thank John McLauchlan and Albert Pol for supplying us with the plasmids, pEGFPC1-ADRP and pEGFPC1-ALDI, respectively; and Stephen Gregory for assistance with FRET analysis.

Ancillary