SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Induction or overexpression of the heme-degrading enzyme, heme oxygenase 1 (HO-1), has been shown to protect mice from liver damage induced by acute inflammation. We have investigated the effects of HO-1 induction in a mouse model of chronic liver inflammation and fibrogenesis with progression to hepatocellular carcinoma (HCC) (Mdr2ko; FVB.129P2-Abcb4tm1Bor). HO-1 was induced in vivo by treatment with cobalt protoporphyrin IX, starting at week 5 or 12 of mice lifespan, and continued for 7 weeks. Our results showed that HO-1 induction reduced liver damage and chronic inflammation by regulating immune cell infiltration or proliferation as well as tumor necrosis factor receptor signaling. Fibrosis progression was significantly reduced by HO-1 induction in mice with mild, as well as established, portal and lobular fibrosis. HO-1 induction significantly suppressed hepatic stellate cell activation. During established fibrosis, HO-1 induction was able to revert portal inflammation and fibrosis below levels observed at the start of treatment. Moreover, hepatocellular proliferation and signs of dysplasia were decreased after HO-1 induction. Conclusion: Induction of HO-1 interferes with chronic inflammation and fibrogenesis and, in consequence, might delay progression to HCC. (HEPATOLOGY 2012;)

Heme oxygenase 1 (HO-1) plays an essential role in heme catabolism, where it catalyzes oxidative degradation of heme to carbon monoxide (CO), free iron, and biliverdin, which is subsequently converted to bilirubin by bilirubin reductase.1, 2 Deficiency in HO-1 results in detrimental inflammatory processes,3 whereas induction by, for example, cobalt protoporphyrin IX (CoPP) or elevated expression by genetic aberrations4 interfere with inflammation. HO-1 has been shown to decrease proinflammatory cytokines, such as tumor necrosis factor alpha (TNF-α), in vitro5, 6 as well as in vivo.7, 8 We could show previously that induction or overexpression of HO-1 reduces liver damage in mouse models of acute inflammation.7, 8 Here, we investigated the effects of HO-1 induction on chronic inflammation and fibrosis of the liver. Chronic hepatitis, induced by, for example, viral infections or chronic exposure to toxins represents a severe health problem, because it bears a risk of progression to hepatocellular carcinoma (HCC), which represents the fifth most common cancer worldwide.9, 10

To investigate HO-1 effects on chronic hepatitis, we used an animal model of chronic portal inflammation and bile duct proliferation with progression to liver fibrosis and HCC (multidrug resistance transporter 2 knockout [Mdr2ko] mouse; FVB.129P2-Abcb4tm1Bor).11 Mdr2ko mice are lacking the Mdr2 P-glycoprotein, a phosphatidylcholine transporter, resulting in dysfunctional phospholipid secretion.12 Signs of inflammation (e.g. intense hepatic leukocyte infiltrations), which appear within the first weeks of age, are accompanied by an increase in plasma transaminase levels and followed by enhanced connective tissue storage and progression to fibrosis.13 Fibrogenesis is a dynamic process associated with activation of hepatic stellate cells (HSCs), which is characterized by collagen and alpha smooth muscle actin (α-SMA) expression as well as chemokine secretion and activation of matrix metalloproteinases (MMPs) and their inhibitors, tissue inhibitors of matrix metalloproteinases (TIMPs).14 As a consequence of chronic inflammation and progressing fibrosis, Mdr2ko mice have been shown to develop HCC within 12-15 months of age.15

We investigated the effect of HO-1 induction on chronic inflammation and fibrogenesis in mice with mild or established fibrosis. Our results show that HO-1 induction decreased chronic inflammation by regulating immune cell infiltration or proliferation, TNF receptor (TNFR) expression, and subsequent events in proinflammatory cytokine signaling, such as extracellular signal-related kinase (ERK) phosphorylation. Liver damage was significantly ameliorated for at least 8 weeks beyond treatment. HO-1 induction improved lobular fibrosis as well as portal inflammation to a state observed before the onset of treatment. In conclusion, induction of HO-1 interfered with chronic inflammation and fibrosis formation.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Animals.

Mdr2 knockout (Mdr2ko; FVB.129P2-Abcb4tm1Bor) mice were kindly provided by Frank Lammert (Homburg, Germany). For all experiments, female mice were used, which display a more severe pathology than male mice.16 All mice received human care according to the guidelines of the National Institutes of Health as well as to the legal requirements in Germany. They were maintained under controlled conditions (22°C, 55% humidity, and 12-hour day-night rhythm) and fed a standard laboratory chow.

Dosage and Application Routes.

CoPP (Frontier Scientific Europe, Ltd., Lancashire, UK) was administered to mice intraperitoneally at 5 mg/kg twice-weekly; CoPP was dissolved in NaOH (0.2 M), adjusted to pH 7.6 with HCl (0.1 M), and filled with water to a stock solution of 1 mg/mL. Control mice were treated equally using solvent. Treatment was started at 5 or 12 weeks of age and continued for 7 consecutive weeks. For long-term follow-up experiments, mice were treated for 9 consecutive weeks, also starting at week 5 of age. For in vitro experiments, CoPP was used at 10 μg/mL.

Determination of Plasma Transaminase and Cytokine Levels.

Liver damage was assessed by measuring plasma enzyme activity of alanine aminotransferase (ALT),17 using an automated procedure (COBAS MIRA; Roche, Basel, Switzerland). Enzyme-linked immunosorbent assays (TNF, TNFR1, and TNFR2) were performed as described previously.18

Cell Isolation and Fluorescence-Activated Cell Sorting.

Isolation of primary hepatocytes (PHs) as well as fluorescence-activated cell-sorting (FACS) analysis were performed as described previously.18 HSCs were isolated, as described previously,19 and activated with 2 ng of transforming growth factor beta 1 (TGF-β1)/mL (Chinese hamster ovary–derived; R&D Systems, Minneapolis, MN).

Detection of Messenger RNA by Real-Time Reverse-transcriptase Polymerase Chain Reaction.

Isolation of total RNA, complementary DNA synthesis, and real-time reverse-transcriptase polymerase chain reaction (RT-PCR) were carried out as described previously.20 Oligonucleotides for subsequent PCR reactions were obtained from Metabion International AG (Martinsried, Germany) and are summarized in Table 1.

Table 1. Oligonucleotide Sequences for Real-Time RT-PCR
TargetForward PrimerReverse PrimerSequence Reference
  1. Abbreviations: RT-PCR, reverse-transcriptase polymerase chain reaction; mATPsyβ, mitochondrial adenosine triphosphate synthase beta; HO-1, heme oxygenase 1; TNF-α, tumor necrosis factor alpha; TNFR, tumor necrosis factor receptor; PCNA, proliferating cell nuclear antigen; TGF-β, transforming growth factor beta; α-SMA, alpha smooth muscle actin; TIMP, tissue inhibitor of matrix metalloproteinase; MMP, matrix metalloproteinase.

mATPsyβattgccatcttgggtatggaaatgggtcccaccatgtagaNM_016774
HO-1gagatagagcgcaacaagcagcttgacctcaggtgtcatctcNM010442
TNF-αcaccaaacgagggatgagaagttcccaactcatccctgtggtttgctacgacgtgM11731
TNFR1ctgctgtcactggtgctcctgcacacaccgtgtccttgtcagM59378
TNFR2gtcgcgctggtcttcgaaccacttgctcagcctcatgM59377
CollagenA1T1gagcggagagtactggatcgtactcgaacgggaatccatcNM007742
CollagenA1T3gtccacgagacaaaggtgatgcccacttgttccatctNM009930
PCNAccacattggagatgctgttgcagtggagtggcttttgtgaX53068
CyclinD1agtgcgtgcagaaggagattcacaacttctcggcagtcaaNM007631
TGF-β2ccttcgccctctttacattgttcgatcttgggcgtatttcNM009367
CyclinE1ccctctgaccattgtgtccttcgcaccactgataacctgaBC084588
ActintggaatcctgtggcatccatgaaataaaacgcagctcagtaacagtccgX03765
OsteopontinctctgatcaggacaacaaccctcagaagatgaactctcAF515708
α-SMAgcatccacgaaaccacctataggtagacagcgaagccaagX13297
TIMP-1catcaatgcctgcagcttccaagcaaagtgacggctcNM011593
MMP-9cattcgcgtggataaggagtacctggttcacctcatggtcNM_013599
MMP-13tttgagaacacggggaagactgggcccattgaaaaagtagNM_0086607
TGF-β1gaagtggatccacgagccctgcacttgcaggagcgcM13177

Protein Isolation From Mouse Liver and Western Blotting Analysis.

Protein lysates were prepared as described previously.21 Semiquantitative evaluations were performed using the VersaDocM Imaging System 4000 MP (Bio-Rad, Munich, Germany) after quantification with Image Lab Software (Bio-Rad).

Hydroxyproline Assay and Zymography.

Assays were performed as described previously.22

Antibodies.

Antibodies for western blotting, immunhistochemistry (IHC), and FACS analysis are listed in Table 2.

Table 2. Antibodies
  1. Abbreviations: HO-1, heme oxygenase 1; mAb, monoclonal antibody; Erk, extracellular signal-related kinase; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; Ab, antibody; CD, cluster of differentiation; Foxp3, forkhead box protein 3; α-SMA, alpha smooth muscle actin; PCNA, proliferating cell nuclear antigen.

Western blotting  
 HO-1 rabbit mAb1:1,000Epitomics, Burlingame, CA
 p38 rabbit mAb1:1,000Cell Signaling Technology, Inc., Danvers, MA
 Phospho-p38 mouse mAb1:1,000Cell Signaling Technology, Inc., Danvers, MA
 Erk rabbit mAb1:1,000Cell Signaling Technology, Inc., Danvers, MA
 Phospho-Erk mouse mAb1:1,000Cell Signaling Technology, Inc., Danvers, MA
 GAPDH mouse Ab1:2,0005G4; HyTest, Turku, Finnland
Immunohistochemistry  
 CD-3 rat Ab1:1,000Serotec, Düsseldorf, Germany
 Foxp31:200eBioscience, San Diego,CA
 F4/801:100eBioscience, San Diego,CA
 α-SMA1:100DakoCytomation, Glostrup, Denmark
 Desmin1:200DakoCytomation, Glostrup, Denmark
 PCNA1:50Delta Biolabs, Gilroy, CA
Fluorescence-activated cell sorting  
 CD11b PerCP/Cy5.5 rat Ab1:200BioLegend Inc., San Diego, CA
 Gr1 APC rat Ab1:200BD Pharmingen, Heidelberg, Germany

Histology.

Liver tissue was fixed in 4% phosphate-buffered formalin and embedded into paraffin. Hematoxylin and eosin (H&E) stainings of 3-μm paraffin sections were used to evaluate basic histomorphology of the specimens, especially the portal and lobular amount of inflammatory cells (score 0-3 for negative to strong infiltration) and signs of regeneration/degeneration of hepatocytes (e.g., cytoplasmic volume, nuclear polymorphism, and thickness of liver cell plates as well as hepatic apoptotic bodies).23 Content of extracellular collagen was measured by the amount of chromotrope-aniline blue (CAB) in the portal tract and hepatic lobule (score 0-3 for negative to strong staining).24 Proliferating cell nuclear antigen (PCNA) and desmin staining were performed on an autostainer system (Dako), using the EnVision Detection System (Dako, Glostrup, Denmark), and developed using diaminobenzidine as the chromogen substrate (Roche Molecular Biochemicals, Mannheim, Germany), according to the manufacturer's instructions. To highlight neutrophil granulocytes in liver tissue, naphtol AS-D chloroacetate esterase enzyme (NASD) histochemistry was used.25 Liver slices were stained for cluster of differentiation (CD)3 and forkhead box protein 3 (Foxp3) and developed with the PolapKit (Zytochem, Las Condes, Chile). Images were evaluated per mm2 (PCNA) or high-power field (400× magnification) using ImageAccess Enterprise software (version 9; Imagic, Glattbrugg, Switzerland). Histological quantification was performed by a pathologist.

Statistical Analysis.

Results were analyzed using the Student's t test, if two groups were compared; in addition, for analysis of real-time RT-PCR, logarithmized data and Welch's t test were used. All data in this study are expressed as a mean ± standard error of the mean. P ≤ 0.05 was considered significant.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

HO-1 Induction Interferes With Chronic Liver Inflammation.

HO-1 induction or overexpression have been shown to interfere with liver damage in mouse models of acute inflammation and apoptosis.7, 8 We have investigated the effects of HO-1 induction on chronic hepatic inflammation and fibrosis in Mdr2ko mice.

Nine weeks of HO-1 induction in Mdr2ko mice (weeks 5-14 of lifespan) decreased plasma ALT levels, which increased over the first 22 weeks of lifespan (Fig. 1A, open bars). Significant improvement was observed for at least 8 weeks beyond treatment (Fig. 1A, closed bars). HO-1 induction by CoPP in liver tissue was detectable on messenger RNA (mRNA) (Supporting Fig. 1A) and protein level (Supporting Fig. 1B) and did not alter hematocrit values (Supporting Fig. 1C). Likewise, isolated PHs and HSCs of Mdr2ko mice showed HO-1 induction after CoPP incubation (Supporting Fig. 1D). IHC staining of liver samples obtained at 12 weeks of age revealed reduced periportal and lobular inflammation in CoPP-treated mice (Fig. 1B). HO-1 induction significantly reduced the expression of TNFR1 and 2, whereas TNF expression in whole liver tissue was increased in Mdr2ko mice, compared to FVB background control (data not shown), but was not altered by HO-1 induction (Fig. 1C). Additionally, plasma levels of soluble TNF receptors were elevated by CoPP treatment, indicating higher shedding rates (Supporting Fig. 1E). Furthermore, downstream targets of TNF-signaling were found to be regulated. Although equal amounts of p38 protein were detected, phosphorylated p38 (pp38) was significantly reduced in CoPP-treated Mdr2ko mice (Fig. 1D; Supporting Fig. 1F). Similarly, protein levels of total Erk42 and phosphorylated Erk44 (pErk44) were significantly reduced in CoPP-treated Mdr2ko mice (Fig. 1D; Supporting Fig. 1F), affirming decreased proinflammatory signaling.

thumbnail image

Figure 1. HO-1 induction in Mdr2ko mice interferes with inflammation. (A) Mdr2ko mice (age, 5 weeks) were treated with solvent (n = 47) or CoPP (5 mg/kg) (n = 41) twice-weekly for 7 or 9 weeks. Plasma ALT levels were measured in FVB background control mice (n = 18), solvent-, or CoPP-treated Mdr2ko mice. At age 12 weeks (after 7 weeks of treatment) 17 solvent-treated and 15 CoPP-treated mice were analyzed. Remaining mice were treated until week 14 and subjected to long-term follow-up studies. (B) Representative H&E staining of livers of Mdr2ko mice treated with solvent (n = 17) or CoPP (n = 15) for 7 weeks (weeks 5-12). (C) Hepatic expression levels of TNF, TNFR1, TNFR2, and OPN were determined by real-time RT-PCR in livers of Mdr2ko mice described in (B). (D) Semiquantitative analysis of western blotting (Supporting Fig. 1F) for p38, pp38, Erk42/44, and pErk42/44 from livers of mice described in (B). *P ≤ 0.05.

Download figure to PowerPoint

Expression of the immune cell attractant, osteopontin (OPN),26 was found to be significantly decreased upon HO-1 induction at 12 weeks (Fig. 1C) and also at 19 weeks of age (data not shown). In fact, cell counting revealed reduced total numbers of hepatic leukocytes after HO-1 induction, whereas total amounts of hepatic leukocytes were elevated in Mdr2ko mice, in comparison to FVB background mice (Supporting Fig. 2A). Staining liver slices of 12-week-old Mdr2ko mice for CD3+ or Foxp3+ cells revealed increased amounts of both cell types in Mdr2ko mice, whereas HO-1 induction decreased those cell counts (Fig. 2A-C). Quantification showed that in periportal (Fig. 2B), but not in lobular (Fig. 2C), tracts of CoPP-treated Mdr2ko mice, the ratio between CD3+ and Foxp3+ cells was shifted toward Foxp3+ cells (1:0.48 versus 1:0.63; Fig. 2B), indicating a higher immunosuppressive status in CoPP-treated animals. Additionally, the population of Gr1+CD11b+ cells (including Gr1high and Gr1intermediate cells) among all leukocytes revealed significant reduction by HO-1 induction (Supporting Fig. 2B, representative dot plots, and 2C, quantification). Further gating for Gr1 and CD11b demonstrated an overrepresentation of Gr1intCD11bhigh cells after HO-1 induction (Supporting Fig. 2B,D). Moreover, the population of neutrophil granulocytes (Gr1highCD11bhigh) was reduced in Mdr2ko mice upon HO-1 induction (54.9% ± 2% versus 63.3% ± 2.2%; Supporting Fig. 2B, upper gate), whereas the frequency of Gr1intCD11bhigh cells was increased in CoPP-treated Mdr2ko mice, compared to solvent-treated Mdr2ko mice (45.1% ± 2% versus 36.7% ± 2.2%; Supporting Fig. 2B, lower gate, and 2C). Because of the typical light-scatter characteristics of monocytes/macrophages (dark gray area in the dot plot of forward- versus side-scatter characteristics), this population of Gr1intCD11bhigh cells might represent a phenotype of monocytic myeloid-derived suppressor cells (mMDSCs) (Supporting Fig. 2B).

thumbnail image

Figure 2. HO-1 induction in Mdr2ko mice reduces inflammatory cell counts. Liver slices of mice described in Fig. 1B were immunostained and quantified for CD3 (A-C), Foxp3 (A-C), or F4/80 (D). Neutrophil granulocytes were visualized by NASD reaction and quantified (E). *P ≤ 0.05.

Download figure to PowerPoint

Similarly to CD3+ and Foxp3+ cells, histochemistry revealed significantly more macrophages (F4/80; Fig. 2D) as well as neutrophil granulocytes (NASD; Fig. 2E) in livers of Mdr2ko mice. HO-1 induction reduced periportal and lobular macrophages (Fig. 2D), as well as periportal neutrophil granulocytes (Fig. 2E), significantly.

HO-1 Induction Interferes With Progression of Fibrosis.

Livers of 12-week-old solvent- or CoPP-treated Mdr2ko mice were analyzed for fibrosis formation. CAB staining revealed beginning septa formation detectable in portal tracts and hepatic lobules of solvent-treated Mdr2ko mice (Fig. 3A), whereas in CoPP-treated mice, only mild fibrosis was observed, which was limited to the portal tracts (Fig. 3A). The equilibrium of assembly and disassembly of the extracellular matrix (ECM) is regulated by the activity of MMPs.27 We observed that activity of MMP-9 was significantly up-regulated in Mdr2ko mice upon HO-1 induction, whereas activity of MMP-2 was not altered (Fig. 3B,C). The fibrosis marker, hydroxyproline, was also found to be significantly reduced in livers of CoPP-treated Mdr2ko mice (Fig. 4A). Fibrogenesis is characterized by high expression levels of collagens I and III,28 which we found to be reduced upon HO-1 induction (Fig. 4B).

thumbnail image

Figure 3. Fibrosis formation in Mdr2ko mice is anticipated by induction of HO-1. (A) In livers of mice described in Fig. 1B, content of extracellular collagens was determined by CAB staining (score 0-3 for negative to strong staining). Representative stainings are shown. Enzymatic activity of MMP-2 and MMP-9 was measured in liver samples by zymography (B) and quantified by Quantity One software (C).

Download figure to PowerPoint

thumbnail image

Figure 4. HO-1 induction in Mdr2ko mice reduces fibrosis. In liver lysates of mice described in Fig. 1B, hepatic fibrosis was determined by hydroxyproline measurements (A). Hepatic expression levels of collagens I and III were determined by real-time RT-PCR (B). In livers of mice described in Fig. 1B, desmin was stained to show total HSC numbers (C) and α-SMA was stained to determine HSC activation (D). Isolated HSC from wild-type animals were stimulated with TGF-β (2 ng/mL) and incubated with CoPP (10 μg/mL) for 24 hours. Expression levels of α-SMA, TNFR1, and TNFR2 (E), as well as HO-1, TIMP1, and MMP9 (F), were determined by real-time RT-PCR. *P ≤ 0.05.

Download figure to PowerPoint

Because activated HSCs play a crucial role in fibrosis, we stained for the HSC marker, desmin, and found those cells increased in Mdr2ko mice, whereas HSCs were reduced after CoPP-treatment (Fig. 4C). Staining for α-SMA revealed a large number of activated HSCs in Mdr2ko mice, which was significantly reduced in livers of CoPP-treated animals (Fig. 4D). To specifically investigate the effect of HO-1 induction on HSC activation, we isolated HSCs from wild-type mice, activated those cells by incubation with TGF-β1 and induced HO-1 in vitro. Our results showed that HO-1 induction significantly reduced the expression of the HSC activation marker, α-SMA, TNFRs, as well as expression of TGF-β1 (Fig. 4E), whereas it enhanced the expression of HO-1, TIMP-1, MMP-9, and MMP-13 (Fig. 4F).

Established Fibrosis Is Reduced Upon HO-1 Induction.

To investigate the effects of HO-1 induction on established fibrosis, we started treatment of Mdr2ko mice at the age of 12 weeks. Measurement of plasma ALT levels after 7 weeks of CoPP treatment revealed that induction of HO-1 significantly decreased hepatocyte damage (Supporting Fig. 3A). Similar to our observations during early fibrosis (Fig. 4B), CoPP treatment decreased the expression of collagens I and III (Supporting Fig. 3B) and elevated MMP-9 activity significantly (data not shown). Inflammation (Supporting Fig. 3C) and fibrosis (Supporting Fig. 3D) were significantly decreased upon HO-1 induction. Quantitative evaluation and comparison of histological staining revealed that HO-1 induction, at late time points, improved inflammation and fibrosis to better scores than observed at the age of 12 weeks. This observation was statistically significant for portal inflammation (Fig. 5A) and lobular fibrosis (Fig. 5B).

thumbnail image

Figure 5. Quantification and statistical evaluation of inflammation and fibrosis after HO-1 induction. Graphical illustration of inflammation (A) and fibrosis (B) scores and statistical analysis comparing Mdr2ko mice treated for 7 weeks with solvent or CoPP (5 mg/kg): 12 weeks: treatment with solvent (n = 17) or CoPP (n = 15) between weeks 5 and 12 of lifespan; 19 weeks: treatment with solvent (n = 14) or CoPP (n = 13) between weeks 12 and 19 of lifespan (black arrows, P ≤ 0.05; broken arrows, P ≤ 0.001).

Download figure to PowerPoint

HO-1 Induction Impedes Proliferation and Dysplasia in Mdr2ko Mice.

HCC frequency is increased in patients after years of chronic inflammation.29 Mdr2ko mice, which suffer from chronic hepatic inflammation, have been shown to develop HCC from the age of 12-15 month onward.12 To analyze effects of HO-1 induction on early signs of progression to HCC, we first investigated expression levels of growth factors and proliferation markers. TGF-β2 was significantly down-regulated in livers of Mdr2ko mice upon HO-1 induction during early (Fig. 6A) and established fibrosis (Fig. 6B). The proliferation marker, PCNA, and the cell-cycle regulators, cyclinD1 and E1, were down-regulated in 12-week-old CoPP-treated Mdr2ko mice, compared to solvent-treated mice (Fig. 6A). Likewise, HO-1 induction during already-established fibrosis significantly reduced the expression of cyclinD1 and PCNA (Fig. 6B). These results are supported by the finding that in liver slices of 12-week-old mice, significantly more PCNA-positive stained hepatocyte nuclei were found after solvent treatment (6,095 ± 203.88 PCNA nuclei/mm2), compared to CoPP-treatment (4,268.33 ± 175.94 PCNA nuclei/mm2; P < 0.05) (Supporting Fig. 4). These results indicate that the combination of anti-inflammatory and -fibrotic HO-1 effects might reduce the risk of Mdr2ko mice to progress to tumor formation. This hypothesis is supported by histological staining, revealing significantly less signs of dysplasia (e.g., irregular hepatic plates, hepatocellular enlargement, nuclear polymorphisms, imbalanced nucleus/cytoplasm ratio, and related to large-cell dysplasia) in CoPP-treated mice (Fig. 6C). For quantification, 12-week-old mice were solvent treated (0.41 ± 0.507), compared to CoPP-treated mice (0.07 ± 0.067; P < 0.05); also, 19-week-old mice were solvent treated (0.64 ± 0.497), compared to CoPP-treated mice (0.00 ± 0.000; P < 0.05).

thumbnail image

Figure 6. Induction of HO-1 expression in Mdr2ko mice regulates proliferation, regeneration, and dysplasia formation. Hepatic expression levels of cyclinD1, cyclinE1, PCNA, and TGF-β2 were determined in livers of (A) 12- or (B) 19-week-old Mdr2ko mice with (closed bars) or without (open bars) induction of HO-1 by treatment with CoPP (5 mg/kg; 7 weeks) by real-time RT-PCR. *P ≤ 0.05. H&E staining of liver samples of solvent- (n = 10) and CoPP-treated mice (n = 10) described in Fig. 1B. Liver slices were quantified for dysplasia formation. (C) Representative samples are shown.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Chronic inflammation, either caused by viral infections, alcoholic, or nonalcoholic steatohepatitis, parasites, or autoimmune diseases, frequently leads to persistent wound healing and fibrogenesis.30, 31 In animal models of acute hepatitis, HO-1 has been shown to protect from inflammatory liver damage via its products, CO and biliverdin.7, 8 We have investigated the anti-inflammatory effects of HO-1 in the Mdr2ko mouse model of chronic hepatitis, primary sclerosing cholangitis (PSC), and progression to HCC. In general, protection was characterized by reduced hepatic leukocyte infiltrations. This might have been the result of the fact that HO-1 induction interfered with the expression of OPN in the liver, a member of the small integrin-binding ligand N-linked glycoprotein family of proteins, which is an early marker of T-cell activation and is crucially involved in the recruitment of monocytes/macrophages, neutrophils, and natural killer T cells, thereby promoting inflammation.26

TNF is a known mediator of inflammatory processes.32 TNF signaling has been described for intestinal cells from patients with inflammatory bowel disease,33 as well as for hepatocytes, Kupffer cells, and infiltrating mononuclear cells from patients with chronic viral hepatitis.34 TNF is a crucial mediator of acute experimental hepatitis and has been shown to be down-regulated by HO-1 induction or overexpression.7 In our model of chronic hepatic inflammation, we observed increased TNF expression, but did not observe changes in TNF expression by HO-1 induction in whole liver tissue. On the other hand, TNF signaling seemed to be down-regulated as a result of reduced expression and higher shedding rates of its receptors, because soluble TNFRs have been shown to efficiently block TNF bioactivity.35 This is in line with recent findings showing down-regulation of TNFR1-dependent oxidative stress in cultured human tracheal smooth muscle cells upon HO-1 overexpression.30 In consequence, downstream signaling of TNF was affected by HO-1 induction, because we found significantly reduced levels of activated p38, Erk42/44, and activated Erk42 in CoPP-treated mice—all involved in TNF-dependent gene transcription.

Recent studies in a PSC and fibrosis model in OPN- or TNFR1-knockout mice showed that both factors are crucial for the establishment of 3,5-diethoxycarbonyl-1,4-dihydrocollidine–induced toxic fibrosis.36 Both OPN and TNFR1 were found to be down-regulated in our mouse model. We could show that HO-1 induction prevents the progression of fibrosis, indicated by, for example, lower levels of hydroxyproline, as well as decreased expression levels of collagens I and III, which both are highly present in fibrotic livers.37 Likewise, expressions of collagens I and III were found to be significantly reduced in CoPP-treated mice, even when fibrosis was already established. Antifibrotic activity of HO-1 could either be a consequence of reduced inflammation or mediated by a specific antifibrotic mechanism. Our findings are in line with reports showing that specific overexpression of HO-1 in HSCs attenuates CCl4-induced liver fibrosis in rats.38 We also found evidence that HO-1 induction might even resolve established fibrosis. The ratio between MMP and TIMP expression seems to be crucial for the switch from fibrosis progression to fibrolysis.39 We found that HO-1 induction directly interfered with HSC activation, whereas it induced the expression of MMP-9 and -13 more dramatically than the expression of TIMP1. The ratio of MMP-13/TIMP-1 has been linked to fibrolysis,40 and, in fact, we found fibrolytic activity caused by HO-1 induction. These findings suggest that HO-1 bears anti-inflammatory, antifibrotic, and fibrolytic capacity.

Fibrosis progression frequently results in the development of HCC.41 This process is accompanied by increased proliferation and growth-factor activity. TGF-β1, which is one of the most potent profibrogenic cytokines,42 has been linked to wound healing and carcinoma progression.43 Beside proliferation, TGF-β has been shown to be involved in differentiation of fibroblasts into myofibroblasts as well as in ECM production and deposition.43 TGF-β2 has been shown to be specifically expressed in epithelial cells of proliferating bile ducts in fibrotic livers of rats and humans44 and could, therefore, support PSC formation. We could show that TGF-β2 was significantly down-regulated in Mdr2ko mice upon HO-1 induction, independently of the time point of treatment onset, indicating that HO-1 induction would reduce bile duct proliferation and liver inflammation. Proliferation is further characterized by increased expression levels of cell-cycle regulators, such as cyclinD1 and E1, as well as PCNA.45, 46 Those markers were found to be down-regulated upon HO-1 induction, further indicating inhibition of proliferation. These results are in line with our observation that HO-1 induction reduced early signs of dysplasia and indicate that HO-1 induction at early time points (e.g., during inflammation or fibrosis) might have consequences on subsequent progression to HCC. Preliminary results even indicate that early HO-1 induction might interfere with progression to HCC.

HO-1 has been shown to be overexpressed in alcohol-induced HCC in patients.47 Moreover, HO-1 down-regulation via short interfering RNA significantly decreased tumor growth, whereas it increased cellular damage and apoptosis.47 Therefore, in the liver, HO-1 overexpression seems to exert beneficial or detrimental effects, depending on pathological conditions (e.g., inflammation or solid tumor formation). However, tumor-promoting effects by early HO-1 induction are unlikely, because induced HO-1 protein is degraded within days after treatment, whereas anti-inflammatory effects of HO-1 induction seem to last for at least 8 weeks longer than treatment with CoPP. Therefore, follow-up experiments have to determine the consequences of early HO-1 induction on progression to HCC caused by chronic inflammation.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

The expert technical assistance by Elena Tassika, Christine Loscher, and Nicola Peters is gratefully acknowledged.

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information
  • 1
    Maines MD, Trakshel GM, Kutty RK. Characterization of two constitutive forms of rat liver microsomal heme oxygenase. Only one molecular species of the enzyme is inducible. J Biol Chem 1986; 261: 411-419.
  • 2
    Maines MD. Heme oxygenase: function, multiplicity, regulatory mechanisms, and clinical applications. FASEB J 1988; 2: 2557-2568.
  • 3
    Paine A, Eiz-Vesper B, Blasczyk R, Immenschuh S. Signaling to heme oxygenase-1 and its anti-inflammatory therapeutic potential. [Review]. Biochem Pharmacol 2010; 80: 1895-1903.
  • 4
    Devey L, Mohr E, Bellamy C, Simpson K, Henderson N, Harrison EM, et al. c-Jun terminal kinase-2 gene deleted mice overexpress hemeoxygenase-1 and are protected from hepatic ischemia reperfusion injury. Transplantation 2009; 88: 308-316.
  • 5
    Woo J, Iyer S, Cornejo MC, Mori N, Gao L, Sipos I, et al. Stress protein-induced immunosuppression: inhibition of cellular immune effector functions following overexpression of haem oxygenase (HSP 32). Transpl Immunol 1998; 6: 84-93.
  • 6
    Devey L, Ferenbach D, Mohr E, Sangster K, Bellamy CO, Hughes J, et al. Tissue-resident macrophages protect the liver from ischemia reperfusion injury via a heme oxygenase-1-dependent mechanism. Mol Ther 2009; 17: 65-72.
  • 7
    Sass G, Seyfried S, Parreira Soares M, Yamashita K, Kaczmarek E, Neuhuber WL, et al. Cooperative effect of biliverdin and carbon monoxide on survival of mice in immune-mediated liver injury. HEPATOLOGY 2004; 40: 1128-1135.
  • 8
    Sass G, Soares MC, Yamashita K, Seyfried S, Zimmermann WH, Eschenhagen T, et al. Heme oxygenase-1 and its reaction product, carbon monoxide, prevent inflammation-related apoptotic liver damage in mice. HEPATOLOGY 2003; 38: 909-918.
  • 9
    Edmondson HA, Peters RL. Tumors of the liver: pathologic features. Semin Roentgenol 1983; 18: 75-83.
  • 10
    Sagmeister S, Eisenbauer M, Pirker C, Mohr T, Holzmann K, Zwickl H, et al. New cellular tools reveal complex epithelial-mesenchymal interactions in hepatocarcinogenesis. Br J Cancer 2008; 99: 151-159.
  • 11
    Mauad TH, van Nieuwkerk CM, Dingemans KP, Smit JJ, Schinkel AH, Notenboom RG, et al. Mice with homozygous disruption of the mdr2 P-glycoprotein gene. A novel animal model for studies of nonsuppurative inflammatory cholangitis and hepatocarcinogenesis. Am J Pathol 1994; 145: 1237-1245.
  • 12
    Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L, et al. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993; 75: 451-462.
  • 13
    Katzenellenbogen M, Pappo O, Barash H, Klopstock N, Mizrahi L, Olam D, et al. Multiple adaptive mechanisms to chronic liver disease revealed at early stages of liver carcinogenesis in the Mdr2-knockout mice. Cancer Res 2006; 66: 4001-4010.
  • 14
    Friedman SL. Liver fibrosis—from bench to bedside. J Hepatol 2003; 38( Suppl 1): S38-S53.
  • 15
    Katzenellenbogen M, Mizrahi L, Pappo O, Klopstock N, Olam D, Barash H, et al. Molecular mechanisms of the chemopreventive effect on hepatocellular carcinoma development in Mdr2 knockout mice. Mol Cancer Ther 2007; 6: 1283-1291.
  • 16
    van Nieuwerk CM, Groen AK, Ottenhoff R, van Wijland M, van den Bergh Weerman MA, Tytgat GN, et al. The role of bile salt composition in liver pathology of mdr2 (-/-) mice: differences between males and females. J Hepatol 1997; 26: 138-145.
  • 17
    Bergmeyer HU. Methods of Enzymatic Analysis, 3rd ed. Weinheim, Germany: Verlag Chemie; 1984: 416-456.
  • 18
    Erhardt A, Wegscheid C, Claass B, Carambia A, Herkel J, Mittrücker HW, et al. CXCR3 deficiency exacerbates liver disease and abrogates tolerance in a mouse model of immune-mediated hepatitis. J Immunol 2011; 186: 5284-5293.
  • 19
    Kluwe J, Pradere JP, Gwak GY, Mencin A, De Minicis S, Osterreicher CH, et al. Modulation of hepatic fibrosis by c-Jun-N-terminal kinase inhibition. Gastroenterology 2010; 138: 347-359.
  • 20
    Lehmann E, El-Tantawy WH, Ocker M, Bartenschlager R, Lohmann V, Hashemolhosseini S, et al. The heme oxygenase 1 product biliverdin interferes with hepatitis C virus replication by increasing antiviral interferon response. HEPATOLOGY 2010; 51: 398-404.
  • 21
    Sass G, Shembade ND, Haimerl F, Lamoureux N, Hashemolhosseini S, Tannapfel A, et al. TNF pretreatment interferes with mitochondrial apoptosis in the mouse liver by A20-mediated down-regulation of Bax. J Immunol 2007; 179: 7042-7049.
  • 22
    Uchinami H, Seki E, Brenner DA, D'Armiento J. Loss of MMP 13 attenuates murine hepatic injury and fibrosis during cholestasis. HEPATOLOGY 2006; 44: 420-429.
  • 23
    Libbrecht L, Desmet V, Roskams T. Preneoplastic lesions in human hepatocarcinogenesis. Liver Int 2005; 25: 16-27.
  • 24
    Churg J, Prado A. A rapid Mallory trichrome stain (chromotrope-aniline blue). AMA Arch Pathol 1956; 62: 505-506.
  • 25
    Beckstead JH, Halverson PS, Ries CA, Bainton DF. Enzyme histochemistry and immunohistochemistry on biopsy specimens of pathologic human bone marrow. Blood 1981; 57: 1088-1098.
  • 26
    Ramaiah SK, Rittling S. Pathophysiological role of osteopontin in hepatic inflammation, toxicity, and cancer. Toxicol Sci 2008; 103: 4-13.
  • 27
    Arthur MJ. Fibrogenesis II. Metalloproteinases and their inhibitors in liver fibrosis. Am J Physiol Gastrointest Liver Physiol 2000; 279: G245-G249.
  • 28
    Martinez-Hernandez A, Amenta PS. The extracellular matrix in hepatic regeneration. FASEB J 1995; 9: 1401-1410.
  • 29
    Naugler WE, Sakurai T, Kim S, Maeda S, Kim K, Elsharkawy AM, at al. Gender disparity in liver cancer due to sex differences in MyD88-dependent IL-6 production. Science 2007; 317: 121-124.
  • 30
    Lee IT, Luo SF, Lee CW, Wang SW, Lin CC, Chang CC, et al. Overexpression of HO-1 protects against TNF-alpha-mediated airway inflammation by down-regulation of TNFR1-dependent oxidative stress. Am J Pathol 2009; 175: 519-532.
  • 31
    Hussain SP, Hofseth LJ, Harris CC. Radical causes of cancer. Nat Rev Cancer 2003; 3: 276-285.
  • 32
    Beutler B, Cerami A. Cachectin/tumor necrosis factor: an endogenous mediator of shock and inflammation. Immunol Res 1986; 5: 281-293.
  • 33
    MacDonald TT, Hutchings P, Choy MY, Murch S, Cooke A. Tumour necrosis factor-alpha and interferon-gamma production measured at the single cell level in normal and inflamed human intestine. Clin Exp Immunol 1990; 81: 301-305.
  • 34
    González-Amaro R, García-Monzón C, García-Buey L, Moreno-Otero R, Alonso JL, Yagüe E, et al. Induction of tumor necrosis factor alpha production by human hepatocytes in chronic viral hepatitis. J Exp Med 1994; 179: 841-848.
  • 35
    Aderka D, Englemann H, Hornik V, Skornick Y, Levo Y, Wallach D, et al. Increased serum levels of soluble receptors for tumor necrosis factor in cancer patients. Cancer Res 1991; 51: 5602-5607.
  • 36
    Fickert P, Thueringer A, Moustafa T, Silbert D, Gumhold J, Tsybrovskyy O, et al. The role of osteopontin and tumor necrosis factor alpha receptor-1 in xenobiotic-induced cholangitis and biliary fibrosis in mice. Lab Invest 2010; 90: 844-852.
  • 37
    Théret N, Lehti K, Musso O, Clément B. MMP2 activation by collagen I and concanavalin A in cultured human hepatic stellate cells. HEPATOLOGY 1999; 30: 462-468.
  • 38
    Tsui TY, Lau CK, Ma J, Wu X, Wang YQ, Farkas S, et al. rAAV-mediated stable expression of heme oxygenase-1 in stellate cells: a new approach to attenuate liver fibrosis in rats. HEPATOLOGY 2005; 42: 335-342.
  • 39
    Iredale JP. Models of liver fibrosis: exploring the dynamic nature of inflammation and repair in a solid organ. J Clin Invest 2007; 117: 539-548.
  • 40
    Bansal R, Prakash J, Post E, Beljaars L, Schuppan D, Poelstra K. Novel engineered targeted interferon-gamma blocks hepatic fibrogenesis in mice. HEPATOLOGY 2011; 54: 586-596.
  • 41
    Schuppan D, Afdhal NH. Liver cirrhosis. Lancet 2008; 371: 838-851.
  • 42
    Brenner DA. Molecular pathogenesis of liver fibrosis. Trans Am Clin Climatol Assoc 2009; 120: 361-368.
  • 43
    Margadant C, Sonnenberg A. Integrin-TGF-beta crosstalk in fibrosis, cancer, and wound healing. EMBO Rep 2010; 11: 97-105.
  • 44
    Milani S, Herbst H, Schuppan D, Stein H, Surrenti C. Transforming growth factors beta 1 and beta 2 are differentially expressed in fibrotic liver disease. Am J Pathol 1991; 139: 1221-1229.
  • 45
    Hunter T, Pines J. Cyclins and cancer. II. Cyclin D and CDK inhibitors come of age. Cell 1994; 79: 573-582.
  • 46
    Naryzhny SN. Proliferating cell nuclear antigen: a proteomics view. Cell Mol Life Sci 2008; 65: 3789-3808.
  • 47
    Sass G, Leukel P, Schmitz V, Raskopf E, Ocker M, Neureiter D, et al. Inhibition of heme oxygenase 1 expression by small interfering RNA decreases orthotopic tumor growth in livers of mice. Int J Cancer 2008; 123: 1269-1277.

Supporting Information

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
HEP_24711_sm_SuppFig1.tif4310KSupporting Information Figure 1.
HEP_24711_sm_SuppFig2.tif4768KSupporting Information Figure 2.
HEP_24711_sm_SuppFig3.tif12851KSupporting Information Figure 3.
HEP_24711_sm_SuppFig4.tif5333KSupporting Information Figure 4.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.