SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

It is well established that inactivation of the central endocannabinoid system (ECS) through antagonism of cannabinoid receptor 1 (CB1R) reduces food intake and improves several pathological features associated with obesity, such as dyslipidemia and liver steatosis. Nevertheless, recent data indicate that inactivation of peripheral CB1R could also be directly involved in the control of lipid metabolism independently of central CB1R. To further investigate this notion, we tested the direct effect of the specific CB1R antagonist, SR141716, on hepatic carbohydrate and lipid metabolism using cultured liver slices. CB1R messenger RNA expression was strongly decreased by SR141716, whereas it was increased by the CB1R agonist, arachidonic acid N-hydroxyethylamide (AEA), indicating the effectiveness of treatments in modulating ECS activity in liver explants both from lean or ob/ob mice. The measurement of O2 consumption revealed that SR141716 increased carbohydrate or fatty acid utilization, according to the cellular hormonal environment. In line with this, SR141716 stimulated ß-oxidation activity, and the role of CB1R in regulating this pathway was particularly emphasized when ECS was hyperactivated by AEA and in ob/ob tissue. SR141716 also improved carbohydrate and lipid metabolism, blunting the AEA-induced increase in gene expression of proteins related to lipogenesis. In addition, we showed that SR141716 induced cholesterol de novo synthesis and high-density lipoprotein uptake, revealing a relationship between CB1R and cholesterol metabolism. Conclusion: These data suggest that blocking hepatic CB1R improves both carbohydrate and lipid metabolism and confirm that peripheral CB1R should be considered as a promising target to reduce cardiometabolic risk in obesity. (HEPATOLOGY 2011)

It is well established that activation of the central endocannabinoid system (ECS) through cannabinoid receptor 1 (CB1R) promotes food intake and weight gain.1-3 Accordingly, pharmacological strategies have been developed to antagonize CB1R. Rimonabant (SR141716) was the first CB1R antagonist to be marketed and prescribed as an antiobesity agent. Its efficiency for weight reduction was supported by a series of major reports.4, 5 CB1R antagonism has also been shown to improve several pathological features associated with obesity, including insulin resistance, hyperglycemia, dyslipidemia, and liver steatosis in rodents6-8 and humans.9, 10 Nevertheless, development and sales of rimonabant was suspended after clinical studies provided compelling evidence that it was associated with the development of severe adverse psychiatric events.11 Both side effects and body-weight loss (and associated beneficial metabolic effects) induced by CB1R antagonism appeared to be related to the blockade of central CB1R. However, several data collected from animal and human studies indicate that peripheral CB1R may also directly control lipid metabolism,12-15 promoting the emerging concept that selective targeting of peripheral CB1R may constitute a novel therapeutic approach. The dominant role played by the liver in mediating the efficacy of CB1R blockage has been highlighted in recent studies using transgenic mice.16, 17 This notion has been particularly well evidenced in a mouse model presenting a hepatocyte-selective deletion of CB1R, because these animals developed neither liver steatosis nor changes in cardiovascular risk factors when maintained on a high-fat diet, whereas their degree of obesity was similar to that of wild-type mice.16 In this study, the investigators demonstrated that activation of hepatic CB1R increases de novo lipogenesis and provided supportive evidence that it also inhibits fatty acid (FA) oxidation. Nevertheless, the mechanisms by which the selective activation or blockade of hepatic CB1R influence liver metabolism remain difficult to explore in vivo because of the biochemical cross-talk between organs. To precisely determine the metabolic changes induced by the blockade of hepatic CB1R on liver lipid and carbohydrate metabolism, we sought to test the direct effect of the specific CB1R antagonist, SR141716, in an in vitro model, in which neural pathways and peripheral influences were excluded. For this, we adapted a model of cultured explants from precision-cut liver slices retaining intact cell structure and respecting the biological organization of the organ.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Animals and Study Design.

Official French regulations (no.: 87848) for the use and care of laboratory animals were followed throughout, and the experimental protocol was approved by the local ethics committee for animal experimentation. C57BL/6JRj and C57BL/6J-Lepob/Lepob male mice (Janvier, Le Genest Saint Isle, France) were housed in individual plastic cages and kept on a standard diet (AO4; UAR, Epinay-sur-Orge, France), until the preparation of liver slices.

Cultured Liver Explants.

Mice (13 weeks old) were anesthetized with an intraperitoneal injection of ketamine/xylazine (7.5 mg/1 mg for 100 g body weight) and were sacrificed by cervical dislocation. To clear the organ of blood, the liver was immediately rinsed by introducing a needle into the heart and perfusing with cold, oxygenated Hanks' balanced salt solution (HBBS). Then, the organ was removed and sliced using a Brendel/Vitron slicer (Vitron Inc., Tucson, AZ) in the same medium. Slices (approximately 200 μm in thickness and 20 mg in weight) from each liver were rinsed and preincubated for 30 minutes at 37°C in HBBS before being randomly distributed in 15-mL culture tubes (6-7 slices per tube) containing 7 mL of oxygenated William's medium E (WME), supplemented with heat-inactivated nondelipidated fetal bovine serum (FBS; 10%) and antibiotic-antifongic cocktail (1%), as previously described.18 Slices were treated with SR141716 (0-10 μM) and, when specified, with arachidonic acid N-hydroxyethylamide (AEA; 5 μM) or atorvastatin (5 μM). SR141716 and AEA were dissolved in dimethyl sulfoxide and diluted in WME. Atorvastatin was prepared in WME. In each case, a series of liver slices treated with vehicle only was assigned to control assays. Tubes were then installed horizontally on a rocking shaker, pierced on the top to allow gas exchange, and incubated for 21 hours in a 5% CO2 atmosphere at 37°C, under slight agitation. At the end of the incubation period, slices were randomly allocated to the different experiments described thereafter. Chemicals and mediums used in this procedure were supplied by Sigma (Saint-Quentin-Fallavier, France), except SR141716, which was provided by Sanofi Aventis (Paris, France).

Lipid Parameters.

At the end of the incubation period, 4-5 explants from each tube were submitted to lipid extraction with chloroform/methanol (2:1, v/v), according to the method of Folch et al.19 After mixing thoroughly, 1.0 mL of organic phase was transferred to a tube containing 1 mL of 1% Triton X-100 in chloroform and dried using nitrogen. The residue was resolubilized in 0.25 mL of distilled water and subjected to triglyceride assay, using a commercial kit (BioMérieux, Marcy l'Etoile, France). Total cholesterol was determined from another aliquot of organic phase by gas chromatography.20 Liver malonyl-CoA (coenzyme A) concentration was determined using the high-performance liquid chromatography method, as previously described.21

FA Oxidation.

ß-oxidation activity was estimated by measuring the production of labeled CO2 and acid-soluble products (mainly acetyl-CoA and ketone bodies) in the medium after incubation of entire slices or homogenates with [1-14C]-palmitic acid, as previously described.21, 22

Respiration Rates.

At the end of the 21-hour treatment period, explants were transferred for 1 additional hour either in (1) the same medium (i.e., standard conditions), (2) in WME supplemented with insulin (5 μg/mL) and malonyl-CoA (100 μM) to promote glucose catabolism, or (3) in glucose-free Dulbecco's modified Eagle's medium (DMEM), supplemented with palmitic acid (50 μM), 5-aminoimidazole-4-carboxamide-1-beta-D-ribofuranoside (AICAR; 100 mM), and glucagon (200 ng/L) to promote FA catabolism. Then, liver slices were placed in the chamber of an oxygraph equipped with a Clark-type O2 electrode (Hansatech Instruments Ltd., Norfolk, UK) and containing 1 mL of phosphate-buffered saline (PBS). Instantaneous respiration rates were determined from 3-4 minutes of recording using the software, oxygraph Plus V1.01 (Hansatech Instruments). Values were standardized by protein assay.

Immunoblotting.

Fresh liver slices were preincubated for 30 minutes at 37°C in HBBS before being randomly distributed in 15-mL culture tubes containing WME, supplemented with SR141716 or vehicle. After incubation from 0 to 6 hours, slices were submitted to immunodetection of phosphorylated AMP kinase (AMPK-p) with a phospho(p)-AMPKα (Thr172) antibody, as previously described.21

[3H]-Cholesteryl Ether/High-Density Lipoprotein Uptake.

A high-density lipoprotein (HDL) fraction was isolated from human plasma by sequential flotation ultracentrifugations and radiolabeled with [3H]-cholesteryl ether (CE), as previously described.18 Measurement of uptake was carried out at 37°C by incubating 2 liver slices in 1 mL of WME containing 40 μg of proteins (0.3 mCi of HDL-[3H]CE), under slight agitation. After 3 hours, slices were removed from medium, washed 3 times, and homogenized in 400 mL of PBS with a minibeadbeater (BioSpec Products, Inc., Bartlesville, OK). Radioactivity recovered in the homogenate was finally estimated, representing the amount of HDL-C uptaken by liver cells.

Gene Expression.

Total messenger RNAs (mRNAs) from liver slices were extracted with Tri-Reagent (Euromedex, Souffelweyersheim, France) and were reverse-transcripted using the Iscript complementary DNA (cDNA) kit (Bio-Rad, Hercules, CA). Real-time reverse-transcriptase polymerase chain reaction (RT-PCR) was performed, as described previously,23 in a 96-well plate using a Bio-Rad iCycler iQ. The sequences of forward and reverse primers used for amplification are represented in Table 1. For each gene, a standard curve was established from four cDNA dilutions (1/10 to 1/10,000) and was used to determine relative gene-expression variation after normalization, with a geometric average of 18S and TATA box-binding protein expression.

Table 1. Primers for Real-Time PCR
 5′-Sense Primer-3′5′-Antisense Primer-3′Length of PCR Products (bp)
  1. Abbreviation: bp, base pair.

ACC1acaccatgttgggagttgtggctgttcctcaggctcacat64
ACC2catggtagtggctttgaaggacgtgtcgatatcgttgttctg114
CB1Rccgcaaagatagtcccaatgaaccccacccagtttgaac48
FASggctgcagtgaatgaatttgttcgtacctccttggcaaac55
FAT/CD36aattagtagaaccgggccacccaactcccaggtacaatca67
GLCKactttccaggccacaaacatcccagaactgtaagccactc78
HLgtgaatgtggggttagtggacacttcgcagattcctccagc129
HMG-CoAgcctggatgggaaggagtacttatggctctgcagcctct90
SR-B1tcccttcgtgcattttctcagttcatcccaacaaacaggc86
SREBP-1acctggtgtcagcttgtggaccacttcgggtttcatgc70
TPBacggcacaggacttactccagctgtctttgttgctcttccaa77
18Sgtgtggggagtgaatggtggcgagacagtcaaaccacg60

Statistical Analysis.

Results are expressed as means ± standard error of the mean (SEM). Data were subjected to one-way analysis of variance, followed by the Tukey-Kramer post-hoc test. Differences were considered significant at P < 0.05.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Effects of Treatments on CB1R Gene Expression.

Concordant arguments from in vivo and in vitro studies suggest that hepatic expression of CB1R is submitted to an autoregulation process. Activation of ECS by high-fat diets or by agonists is associated with an increase in the expression of CB1R, whereas this effect is prevented by the simultaneous use of CB1R antagonist.13, 16, 17, 24, 25 So, in this study, the effect of each treatment on the activation status of the ECS was estimated by measuring the mRNA expression of CB1R. Treating liver explants from lean mice with SR141716 at 100 nM induced a strong down-regulation of CB1R expression, whereas AEA treatment increased CB1R mRNA, in comparison with controls. When both molecules were simultaneously added in the culture medium, the stimulating effect of AEA was limited by the presence of SR141716 (Fig. 1A). In ob/ob mice that displayed markedly higher mRNA levels of CB1R than lean mice (Fig. 1B), SR141716 also decreased CB1R expression at 10 μM in the presence of AEA or not (Fig. 1C), whereas it was inefficient at 100 nM (data not shown). On the whole, these data support the effectiveness of SR141716 treatment in modulating ECS activity in our model.

thumbnail image

Figure 1. Effect of SR141716 and AEA on CB1R mRNA expression in liver explants. (A) Liver explants from lean mice were treated for 21 hours either with SR141716 (100 nM) or AEA (5 μM) or a combination of both and used for real-time RT-PCR analysis. (B) Comparison of mRNA levels of CB1R in the liver of control lean and ob/ob mice. (C) Liver explants from ob/ob mice were treated for 21 hours either with SR141716 (10 μM) or AEA (5 μM) or a combination of both and used for real-time RT-PCR analysis. Results are expressed as means ± SEM (lean, n = 8; ob/ob, n = 5). Values with different superscript letters (a, b, c) are statistically different at P < 0.05.

Download figure to PowerPoint

Effects of CB1R Antagonism on Substrate Utilization.

The effect of CB1R antagonism on substrate utilization was analyzed by oxygen-consumption measurement. In this approach, because carbohydrate catabolism uses less oxygen than FA, low oxygen-consumption rates indicate reliance on carbohydrate oxidation as the major energy substrate. Thus, oxygen-consumption rates were the lowest when control explants were preincubated in a media promoting carbohydrate utilization (Fig. 2, empty column 2). Conversely, when control explants were preincubated in a media promoting FA utilization (Fig. 2, empty column 3), respiration rates were unchanged, suggesting that FAs were the preferential substrate for liver explants at the end of the 21-hour culture period.

thumbnail image

Figure 2. Effect of hepatic CB1R antagonism on oxygen consumption by liver explants. Liver explants from lean mice were cultured for 21 hours either with SR141716 (100 nM) or vehicle in WME. Then, explants were preincubated for 1 additional hour either in the same medium (CON) or in WME, supplemented with insulin and malonyl-CoA to promote carbohydrate catabolism (CHO), or in glucose-free DMEM, supplemented with palmitic acid, AICAR, and glucagon, to promote FA catabolism (FAT). Instantaneous respiration rates were measured in PBS from 3 to 4 minutes of recording. Values are means ± SEM (n = 8 per series). For each treatment, * indicates statistical difference with CON at P < 0.05. P values indicate statistical significance of SR141716 treatment.

Download figure to PowerPoint

Interestingly, treating liver explants with SR141716 induced a marked decrease in oxygen consumption (Fig. 2, black column 1), in comparison with control, suggesting a change in substrate oxidation in favor of carbohydrate. In line with this hypothesis, respiration rates remained low when carbohydrate metabolism was strained (Fig. 2, black column 2).

It is also remarkable that, under conditions promoting FA utilization, SR141716 tended to strengthen FA catabolism (Fig. 2, black column 3). Taken together, these data suggested that CB1R blockade improved carbohydrate and FA catabolism, according to the operating metabolic pathway.

Effects of CB1R Antagonism on Carbohydrate Metabolism and Lipogenesis.

The stimulatory effect of SR141716 on carbohydrate metabolism revealed by respiration measurements was associated with an increased expression of glucokinase (GLCK), which catalyzes glucose phosphorylation and controls glycolytic flux26 (Fig. 3A). These findings were associated with a slight overexpression of sterol regulatory element-binding protein (SREBP-1) and with a concomitant increase in cellular triacylglycerol (TG) content, whereas the expression of the two isoforms of acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) remained unchanged (Fig. 3A,B). Besides, fatty acid translocase (FAT/CD36) mRNA levels were increased by SR141716, suggesting that TG accumulation could result from FA uptake, rather from de novo lipogenesis. Interestingly, hyperactivation of ECS by AEA treatment induced both a strong increase in SREBP-1 expression and in genes related to lipogenesis (e.g., ACC, FAS, and GLCK) that was suppressed by the presence of SR141716 (Fig. 3A).

thumbnail image

Figure 3. Effects of CB1R antagonism on lipogenesis. Liver explants from lean mice were treated for 21 hours either with SR141716 (100 nM), AEA (5 μM), SR141716+AEA, or vehicle before real-time RT-PCR analysis (A) and determination of TG content (B). Results are expressed as means ± SEM (n = 5 per series). Values with different superscript letters (a, b, c) are statistically different at P < 0.05.

Download figure to PowerPoint

Effects of CB1R Antagonism on Cholesterol Metabolism.

To address the role of CB1R antagonism on cholesterol de novo synthesis, we tested the effects of SR141716 in the presence of atorvastatin as a potent inhibitor of hydroxymethylglutaryl-coenzyme A reductase (HMG-CoA red), the enzyme responsible for the first step of cholesterol synthesis. Cholesterol content was increased by SR141716, whereas treatment with atorvastatin tended to decrease it (P < 0.185) (Fig. 4A. It is noteworthy that SR141716 failed to increase cholesterol hepatocyte content in the presence of atorvastatin. Because another possible source of cholesterol for hepatocytes could be HDL, we also measured the effect of CB1R blockade on HDL-CE uptake. We showed that HDL-CE uptake was significantly increased in explants treated with SR141716 (Fig. 4B). Concomitantly, variations of intracellular cholesterol contents induced by SR141716 were associated with an increased expression of HMG-CoA red, whereas scavenger receptor class B type 1 (SR-B1) and hepatic lipase (HL) mRNA levels were reduced (Fig. 4C). All together, these biochemical and molecular data suggested the existence of interrelations between cholesterol metabolism and CB1R signaling.

thumbnail image

Figure 4. Effects of CB1R antagonism on cholesterol metabolism. (A) Liver explants from lean mice were treated for 21 hours either with SR141716 (100 nM) or atorvastatin (5 μM) or a combination of both before determination of cholesterol content. (B) HDL-CE uptake was determined from radioactivity recovered in explants pretreated with SR141716 (100 nM) or vehicle for 21 hours and incubated for 3 additional hours in the presence of CE-HDL. (C) mRNA expression of HMG-CoA red, SR-B1, and HL in explants treated for 21 hours with SR141716 was analyzed by real-time RT-PCR. Results are expressed as means ± SEM (n = 5 per series). Values with different superscript letters (a, b, c) are statistically different at P < 0.05.

Download figure to PowerPoint

Effects of CB1R Antagonism on FA Oxidation.

In line with an improvement of FA catabolism by SR141716 (Fig. 2), we observed that CB1R blockade increased the capacity of liver explants to ß-oxidize palmitic acid (Fig. 5A). On the other hand, when explants were treated with AEA to hyperactivate ECS and, therefore, approach the physiological conditions encountered in the liver of obese subjects, palmitic acid oxidation was decreased by 30%, compared to control, whereas cotreatment of liver explants with AEA and SR141716 normalized oxidation rates (Fig. 5A).

thumbnail image

Figure 5. Effects of CB1R blockade on parameters related to FA oxidation in lean and ob/ob mice. (A) FA oxidation rates in whole liver explants from lean mice. (B) FA oxidation rates in homogenized liver slices from lean mice. (C) Malonyl-CoA content in liver explants from lean mice. (D) CPT-I mRNA expression in liver explants from lean mice. (E) FA oxidation rates in whole liver explants from ob/ob mice. In (A) to (E), liver explants were treated for 21 hours either with SR141716 (100 nM for lean mice or 10 μM for ob/ob mice) or AEA (5 μM) or a combination of both before measuring FA oxidation parameters. Results are expressed as means ± SEM (n = 5-8 per series). Values with different superscript letters (a, b, c) are statistically different at P < 0.05. (F) FA oxidation rates in whole liver explants from ob/ob mice in short-term treatment conditions. SR141716 and AEA were added in the medium at the beginning of the 2-hour FA oxidation-determination procedure. Results are expressed as means ± SEM of three independent experiments.

Download figure to PowerPoint

The competitive effect of SR141716 versus AEA was also supported by Supporting Fig. 1, showing an abolishment of the AEA-induced inhibition of FA oxidation by SR141716 in a concentration-dependent manner. Furthermore, the stimulatory effect of SR141716 on FA oxidation rates was maintained when measured in disrupted cells, suggesting that it was not exclusively the result of an increase in FA uptake by hepatocytes (Fig. 5B). In addition, the lower malonyl-CoA content (Fig. 5C) and the higher carnitine palmitoyltransferase I (CPT-I) mRNA levels (Fig. 5D) measured in slices treated with SR141716 are also consistent with an improvement of FA catabolism.

To examine whether the beneficial effects of CB1R blockade on FA oxidation could also be applicable to the steatotic liver, we measured palmitic acid oxidation in liver slices from ob/ob mice. Interestingly, treating liver slices with SR141716 at 10 μM significantly increased ß-oxidation activity, both in the absence and in the presence of AEA (Fig. 5E), whereas a treatment with SR141716 at 100 nM was ineffective (data not shown). In this experiment, AEA did not reduce ß-oxidation activity, likely because the latter was already very low in livers of ob/ob mice.

In 21-hour treatment experiments, the activation of ß-oxidation induced by CB1R antagonism could result from long-term metabolic adaptation involving the alteration of gene-expression levels. To further investigate this notion, the short-term effect of SR141716 on this parameter was also tested. For this, ß-oxidation rates were measured in liver slices from ob/ob mice, in which CB1R expression was high, in the presence or not of SR141716 and AEA for only 2 hours. AEA inhibited FA oxidation, and this effect was completely abolished by SR141716 for concentration values from 0.1 to 100 μM (Fig. 5F). Interestingly, SR141716 alone did not induced ß-oxidation activity in these short-term conditions.

Effects of CB1R Antagonism on AMPK Activity.

Given the central role of AMPK in regulating carbohydrate and lipid metabolism, we investigated whether blocking CB1R could affect the activation of AMPK. The kinetic data presented in Fig. 6 indicate that SR141716 was able to markedly induce the phosphorylation of AMPK during the first 15 minutes of exposition, compared to control.

thumbnail image

Figure 6. Effect of SR141716 on phospho(p)-AMPK. Fresh liver slices were incubated from 0 to 2 hours with SR141716 (100 nM) or vehicle. Representative immunoblots and density quantification of phospho(p)-AMPK and ß-actin.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

It has been proposed that overactivation of liver ECS promotes lipogenesis and induced steatosis,16, 27 which could contribute to the pathogenesis of nonalcoholic steatohepatitis, a common characteristic of overweight or obese patients with type 2 diabetes. Despite several studies showing that administration of CB1R antagonist is associated with a reduction of fatty liver,6, 13 only a few studies investigated the specific role of hepatic CB1R.16, 17, 27

This study provides evidence that hepatic CB1R have a major role in the molecular and enzymatic regulation of liver-energy metabolism. The measurement of oxygen consumption by liver explants showed that CB1R blockade could promote the preferential use of carbohydrate or FA, depending on the hormonal environment of the cells. First, data indicated that liver explants cultured under classical conditions preferentially oxidized FA as a substrate, showing that the metabolism of hepatocytes corresponded to a fasting profile. Interestingly, treatment with CB1R antagonist induced a significant decrease in oxygen consumption, comparable to that obtained when insulin was added to the medium, characterizing a switch to carbohydrate utilization. The stimulation of GLCK gene expression also concurs with this concept, because high GLCK mRNA levels are associated with a stimulation of glucose uptake and glycogen synthesis in the liver.28-30 In the liver, SREBP-1 is a major factor of insulin action on GLCK gene expression.31 Our findings, showing a concomitant up-regulation of SREBP-1 and GLCK gene expression, means that it is, therefore, very likely, but not yet tested, that SR141716 increased glucose utilization. In return, one could expect a concomitant increase in lipogenesis.32 Because hepatic genes involved in FA synthesis require both high insulin and high glucose concentrations for their activation,32 it is not surprising that ACC and FAS mRNA levels were not changed with our conditions of culture. Accordingly, the higher intracellular TG contents observed in explants treated by the CB1R antagonist likely more correspond to an increase in the uptake of lipids present in the medium supplemented with FBS than in de novo lipogenesis, as suggested by FAT/CD36 mRNA levels. On the other hand, data also strongly support the concept already evoked by other investigators, that hyperactivation of ECS increases de novo lipogenesis.27 In our study, we provided further evidence that the stimulation of this pathway by AEA was blunted by CB1R blockade.

Interestingly, SR141716 induced an increase in cellular cholesterol content, which was associated with an induction of the expression of HMG-CoA red, the rate-limiting enzyme of the biosynthetic cholesterol pathway, indicating that CB1R inactivation induced cholesterol synthesis. The use of atorvastatin (a selective inhibitor of HMG-CoA red) confirmed this hypothesis, because it inhibited the effects of SR141716 on both HMG-CoA red expression and cholesterol concentration. A stimulation of HMG-CoA red by insulin treatment has been shown in different cultured cell lines,33, 34 supporting the concept of an insulin-like effect of SR141716 on cholesterol metabolism. Notably, it has been demonstrated that the selective uptake of HDL by SR-B1 is dependent on the activation of the insulin-signaling pathway.35 The stimulation of HDL-CE uptake induced by SR141716 treatment also indicates that exogenous cholesterol could contribute to increased intracellular contents. Remarkably, transcript levels of SR-BI and HL both involved in HDL-CE uptake36, 37 were decreased by SR141716, suggesting a feedback regulation in response to the increase in cholesterol cell content. This concept is further supported by our findings showing a normalization of SR-BI and HL gene expression when cholesterol synthesis was reduced by atorvastatin treatment (data not shown) and by other works showing the existence of an inverse relation between cholesterol cell content and HL mRNA levels.38 The stimulation of HDL-C uptake by SR141716 is in contrast with human and rodent in vivo studies reporting that CB1R blockade was associated with increased HDL-C levels.6, 9, 10 Nevertheless, plasma HDL-C also depends on cholesterol efflux from cells and tissues, and recent works have indicated that CB1R antagonism might increase cholesterol efflux39 and thereby HDL-C. Taken together, these data suggest that CB1R blockade may improve reverse-cholesterol transport, inducing both cholesterol efflux and removal.

Importantly, it also emerged from the present study that the ECS has a major role in the regulation of liver FA oxidation. Indeed, when experimental conditions were set to force the utilization of FA as a substrate, CB1R antagonism led to an increase in oxygen consumption, likely resulting from a stimulation of FA oxidation. This assumption is supported by the current findings that the selective inactivation of CB1R by SR141716 increased palmitic acid ß-oxidation, decreased cytosolic malonyl-CoA content, and increased CPT-I gene expression in liver explants. Because malonyl-CoA is a strong inhibitor of CPT-I activity,40, 41 it could be assumed that the penetration of FA into mitochondria is facilitated. The regulation process likely involves the phosphorylation and inactivation of ACC, which catalyzes the transformation of acetyl-CoA to malonyl-CoA, as suggested by the stimulatory effect of SR141716 on p-AMPK.42 Our results are consistent with others showing that treatment with a CB1R antagonist stimulates CPT-I activity in the liver of mice fed a standard diet,16 and with those of Watanabe et al., in which CB1R antagonism results in the phosphorylation of AMPK in ob/ob adipo−/− mice.43 Of particular note is the finding that antagonism of liver CB1R stimulates fat oxidation when carbohydrate utilization is limited. Such conditions are encountered in vivo in the fasting state and, particularly, in type II diabetes that is associated with excessive rise in plasma free FA.44 In line with this, direct evidence for an improvement of FA catabolism by CB1R blockade in the steatotic liver is provided by the present findings showing an increase in ß-oxidation activity in livers of diabetic ob/ob mice.

Data relative to ß-oxidation activity also give information regarding the pharmacological action of SR141716. In liver slices from lean mice, endogenous EC production should be very low,27, 45 supporting the possibility that per se effect of SR141716 on ß-oxidation activity may be the result of inhibition of constitutive CB1R activity and/or to the inverse agonist action of the compound.46, 47 Conversely, because AEA concentration is high in the fatty liver,27 the most likely mechanism of action of SR141716, in these conditions, may be competition with endogenous endocannabinoids produced by steatotic liver explants during treatment, as suggested by the inefficiency of exogenous AEA to inhibit ß-oxidation in this tissue. It is also noteworthy that per se effect of SR141716 on ß-oxidation occurred only after 21-hour incubation conditions, consistent with a long-term regulation process likely involving gene regulation, a situation different from that observed in the muscle concerning CB1R-mediated glucose uptake.48 At the opposite, the induction of ß-oxidation by competitive inactivation of liver CB1R by SR141716 occurred with short-term treatment, suggesting the involvement of rapid signaling pathways that remain to be explored. However, our data did not strictly demonstrate that SR141716 action is mediated by CB1R, and additional experiments using liver slices from CB1R−/− mice should be performed to fully validate this hypothesis.

In conclusion, our findings suggest that limiting hepatic ECS activity through CB1R blockade both reduces de novo lipogenesis and increases FA catabolism. Such effects may be associated with the reduction of liver steatosis and improvement of plasma parameters observed in vivo in rodents and humans treated with CB1R antagonists.6, 9, 13 Data also suggest that SR141716, in addition to counteracting the effects of CB1R activation by endocannabinoids, could exert per se specific effects, possibly reflecting activation of insulin-signaling pathways and favorableness to carbohydrate utilization. Finally, the present study further confirms that the peripheral antagonism of CB1R may improve metabolism independently of central effects on food intake and should be considered as a promising strategy to reduce cardiometabolic risk in obesity.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

The authors thank Prof. Laurence Perségol for her helpful assistance with HDL preparation.

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information
  • 1
    Di Marzo V, Goparaju SK, Wang L, Liu J, Batkai S, Jarai Z, et al. Leptin-regulated endocannabinoids are involved in maintaining food intake. Nature 2001; 410: 822-825.
  • 2
    Jamshidi N, Taylor DA. Anandamide administration into the ventromedial hypothalamus stimulates appetite in rats. Br J Pharmacol 2001; 134: 1151-1154.
  • 3
    Williams CM, Kirkham TC. Anandamide induces overeating: mediation by central cannabinoid (CB1) receptors. Psychopharmacology (Berl) 1999; 143: 315-317.
  • 4
    Curioni C, Andre C. Rimonabant for overweight or obesity. Cochrane Database Syst Rev 2006: CD006162.
  • 5
    Padwal RS, Majumdar SR. Drug treatments for obesity: orlistat, sibutramine, and rimonabant. Lancet 2007; 369: 71-77.
  • 6
    Gary-Bobo M, Elachouri G, Gallas JF, Janiak P, Marini P, Ravinet-Trillou C, et al. Rimonabant reduces obesity-associated hepatic steatosis and features of metabolic syndrome in obese Zucker fa/fa rats. HEPATOLOGY 2007; 46: 122-129.
  • 7
    Poirier B, Bidouard JP, Cadrouvele C, Marniquet X, Staels B, O'Connor SE, et al. The anti-obesity effect of rimonabant is associated with an improved serum lipid profile. Diabetes Obes Metab 2005; 7: 65-72.
  • 8
    Ravinet Trillou C, Arnone M, Delgorge C, Gonalons N, Keane P, Maffrand JP, Soubrie P. Anti-obesity effect of SR141716, a CB1 receptor antagonist, in diet-induced obese mice. Am J Physiol Regul Integr Comp Physiol 2003; 284: R345-R353.
  • 9
    Despres JP, Golay A, Sjostrom L. Effects of rimonabant on metabolic risk factors in overweight patients with dyslipidemia. N Engl J Med 2005; 353: 2121-2134.
  • 10
    Van Gaal LF, Rissanen AM, Scheen AJ, Ziegler O, Rossner S. Effects of the cannabinoid-1 receptor blocker rimonabant on weight reduction and cardiovascular risk factors in overweight patients: 1-year experience from the RIO-Europe study. Lancet 2005; 365: 1389-1397.
  • 11
    Christensen R, Kristensen PK, Bartels EM, Bliddal H, Astrup A. Efficacy and safety of the weight-loss drug rimonabant: a meta-analysis of randomised trials. Lancet 2007; 370: 1706-1713.
  • 12
    Di Marzo V, Despres JP. CB1 antagonists for obesity—what lessons have we learned from rimonabant? Nat Rev Endocrinol 2009; 5: 633-638.
  • 13
    Jourdan T, Djaouti L, Demizieux L, Gresti J, Verges B, Degrace P. CB1 antagonism exerts specific molecular effects on visceral and subcutaneous fat and reverses liver steatosis in diet-induced obese mice. Diabetes 2010; 59: 926-934.
  • 14
    Matias I, Bisogno T, Di Marzo V. Endogenous cannabinoids in the brain and peripheral tissues: regulation of their levels and control of food intake. Int J Obes (Lond) 2006; 30( Suppl 1): S7-S12.
  • 15
    Nogueiras R, Veyrat-Durebex C, Suchanek PM, Klein M, Tschop J, Caldwell C, et al. Peripheral, but not central, CB1 antagonism provides food intake-independent metabolic benefits in diet-induced obese rats. Diabetes 2008; 57: 2977-2991.
  • 16
    Osei-Hyiaman D, Liu J, Zhou L, Godlewski G, Harvey-White J, Jeong WI, et al. Hepatic CB1 receptor is required for development of diet-induced steatosis, dyslipidemia, and insulin and leptin resistance in mice. J Clin Invest 2008; 118: 3160-3169.
  • 17
    Tam J, Vemuri VK, Liu J, Batkai S, Mukhopadhyay B, Godlewski G, et al. Peripheral CB1 cannabinoid receptor blockade improves cardiometabolic risk in mouse models of obesity. J Clin Invest 2010; 120: 2953-2966.
  • 18
    Djaouti L, Jourdan T, Demizieux L, Chevrot M, Gresti J, Verges B, Degrace P. Different effects of pioglitazone and rosiglitazone on lipid metabolism in mouse cultured liver explants. Diabetes Metab Res Rev 2010; 26: 297-305.
  • 19
    Folch J, Lees M, Sloane Stanley GH. A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 1957; 226: 497-509.
  • 20
    Niot I, Gresti J, Boichot J, Sempore G, Durand G, Bezard J, Clouet P. Effect of dietary n-3 and n-6 polyunsaturated fatty acids on lipid-metabolizing enzymes in obese rat liver. Lipids 1994; 29: 481-489.
  • 21
    Jourdan T, Djaouti L, Demizieux L, Gresti J, Verges B, Degrace P. Liver carbohydrate and lipid metabolism of insulin-deficient mice is altered by trans-10, cis-12 conjugated linoleic acid. J Nutr 2009; 139: 1901-1907.
  • 22
    Demizieux L, Degrace P, Gresti J, Loreau O, Noel JP, Chardigny JM, et al. Conjugated linoleic acid isomers in mitochondria: evidence for an alteration of fatty acid oxidation. J Lipid Res 2002; 43: 2112-2122.
  • 23
    Degrace P, Moindrot B, Mohamed I, Gresti J, Du ZY, Chardigny JM, et al. Upregulation of liver VLDL receptor and FAT/CD36 expression in LDLR−/− apoB100/100 mice fed trans-10,cis-12 conjugated linoleic acid. J Lipid Res 2006; 47: 2647-2655.
  • 24
    Bifulco M, Laezza C, Portella G, Vitale M, Orlando P, De Petrocellis L, Di Marzo V. Control by the endogenous cannabinoid system of ras oncogene-dependent tumor growth. FASEB J 2001; 15: 2745-2747.
  • 25
    Mukhopadhyay B, Liu J, Osei-Hyiaman D, Godlewski G, Mukhopadhyay P, Wang L, et al. Transcriptional regulation of cannabinoid receptor-1 expression in the liver by retinoic acid acting via retinoic acid receptor-gamma. J Biol Chem 2010; 285: 19002-19011.
  • 26
    Wu C, Okar DA, Kang J, Lange AJ. Reduction of hepatic glucose production as a therapeutic target in the treatment of diabetes. Curr Drug Targets Immune Endocr Metabol Disord 2005; 5: 51-59.
  • 27
    Osei-Hyiaman D, DePetrillo M, Pacher P, Liu J, Radaeva S, Batkai S, et al. Endocannabinoid activation at hepatic CB1 receptors stimulates fatty acid synthesis and contributes to diet-induced obesity. J Clin Invest 2005; 115: 1298-1305.
  • 28
    Iynedjian PB, Jotterand D, Nouspikel T, Asfari M, Pilot PR. Transcriptional induction of glucokinase gene by insulin in cultured liver cells and its repression by the glucagon-cAMP system. J Biol Chem 1989; 264: 21824-21829.
  • 29
    Magnuson MA, Andreone TL, Printz RL, Koch S, Granner DK. Rat glucokinase gene: structure and regulation by insulin. Proc Natl Acad Sci U S A 1989; 86: 4838-4842.
  • 30
    Seoane J, Gomez-Foix AM, O'Doherty RM, Gomez-Ara C, Newgard CB, Guinovart JJ. Glucose 6-phosphate produced by glucokinase, but not hexokinase I, promotes the activation of hepatic glycogen synthase. J Biol Chem 1996; 271: 23756-23760.
  • 31
    Foretz M, Guichard C, Ferre P, Foufelle F. Sterol regulatory element binding protein-1c is a major mediator of insulin action on the hepatic expression of glucokinase and lipogenesis-related genes. Proc Natl Acad Sci U S A 1999; 96: 12737-12742.
  • 32
    Girard J, Ferre P, Foufelle F. Mechanisms by which carbohydrates regulate expression of genes for glycolytic and lipogenic enzymes. Annu Rev Nutr 1997; 17: 325-352.
  • 33
    Krone W, Greten H. Evidence for post-transcriptional regulation by insulin of 3-hydroxy-3-methylglutaryl coenzyme A reductase and sterol synthesis in human mononuclear leucocytes. Diabetologia 1984; 26: 366-369.
  • 34
    Maitra A, LaVoie HA, Day RN, Garmey JC, Veldhuis JD. Regulation of porcine granulosa cell 3-hydroxy-3-methylglutaryl coenzyme A reductase by insulin and insulin-like growth factor I: synergism with follicle-stimulating hormone or protein kinase A agonist. Endocrinology 1995; 136: 5111-5117.
  • 35
    Shetty S, Eckhardt ER, Post SR, van der Westhuyzen DR. Phosphatidylinositol-3-kinase regulates scavenger receptor class B type I subcellular localization and selective lipid uptake in hepatocytes. Arterioscler Thromb Vasc Biol 2006; 26: 2125-2131.
  • 36
    Lambert G, Chase MB, Dugi K, Bensadoun A, Brewer HB, Jr., Santamarina-Fojo S. Hepatic lipase promotes the selective uptake of high density lipoprotein-cholesteryl esters via the scavenger receptor B1. J Lipid Res 1999; 40: 1294-1303.
  • 37
    Vidal-Puig AJ, Considine RV, Jimenez-Linan M, Werman A, Pories WJ, Caro JF, Flier JS. Peroxisome proliferator-activated receptor gene expression in human tissues. Effects of obesity, weight loss, and regulation by insulin and glucocorticoids. J Clin Invest 1997; 99: 2416-2422.
  • 38
    Perret B, Mabile L, Martinez L, Terce F, Barbaras R, Collet X. Hepatic lipase: structure/function relationship, synthesis, and regulation. J Lipid Res 2002; 43: 1163-1169.
  • 39
    Sugamura K, Sugiyama S, Fujiwara Y, Matsubara J, Akiyama E, Maeda H, et al. Cannabinoid 1 receptor blockade reduces atherosclerosis with enhances reverse cholesterol transport. J Atheroscler Thromb 2010; 17: 141-147.
  • 40
    Kashfi K, Mynatt RL, Cook GA. Hepatic carnitine palmitoyltransferase-I has two independent inhibitory binding sites for regulation of fatty acid oxidation. Biochim Biophys Acta 1994; 1212: 245-252.
  • 41
    Murthy MS, Pande SV. Malonyl-CoA binding site and the overt carnitine palmitoyltransferase activity reside on the opposite sides of the outer mitochondrial membrane. Proc Natl Acad Sci U S A 1987; 84: 378-382.
  • 42
    Brownsey RW, Boone AN, Elliott JE, Kulpa JE, Lee WM. Regulation of acetyl-CoA carboxylase. Biochem Soc Trans 2006; 34: 223-227.
  • 43
    Watanabe T, Kubota N, Ohsugi M, Kubota T, Takamoto I, Iwabu M, et al. Rimonabant ameliorates insulin resistance via both adiponectin-dependent and adiponectin-independent pathways. J Biol Chem 2009; 284: 1803-1812.
  • 44
    Groop LC, Bonadonna RC, DelPrato S, Ratheiser K, Zyck K, Ferrannini E, DeFronzo RA. Glucose and free fatty acid metabolism in non-insulin-dependent diabetes mellitus. Evidence for multiple sites of insulin resistance. J Clin Invest 1989; 84: 205-213.
  • 45
    Mukhopadhyay B, Cinar R, Yin S, Liu J, Tam J, Godlewski G, et al. Hyperactivation of anandamide synthesis and regulation of cell-cycle progression via cannabinoid type 1 (CB1) receptors in the regenerating liver. Proc Natl Acad Sci U S A 2011; 108: 6323-6328.
  • 46
    Bouaboula M, Perrachon S, Milligan L, Canat X, Rinaldi-Carmona M, Portier M, et al. A selective inverse agonist for central cannabinoid receptor inhibits mitogen-activated protein kinase activation stimulated by insulin or insulin-like growth factor 1. Evidence for a new model of receptor/ligand interactions. J Biol Chem 1997; 272: 22330-22339.
  • 47
    Sim-Selley LJ, Brunk LK, Selley DE. Inhibitory effects of SR141716A on G-protein activation in rat brain. Eur J Pharmacol 2001; 414: 135-143.
  • 48
    Esposito I, Proto MC, Gazzerro P, Laezza C, Miele C, Alberobello AT, et al. The cannabinoid CB1 receptor antagonist rimonabant stimulates 2-deoxyglucose uptake in skeletal muscle cells by regulating the expression of phosphatidylinositol-3-kinase. Mol Pharmacol 2008; 74: 1678-1686.

Supporting Information

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
HEP_24733_sm_SuppFig1.eps6442KSupporting Information Figure 1. Competitive effect of SR141716 on AEA inhibition of FA oxidation rates in lean mice. Liver explants were treated for 21 hours with AEA (5 μM) and increasing concentrations of SR141716 (0-500 nM) or only with vehicle (CON). Results are expressed as means ± SEM (n = 5). *P < 0.05, different from CON; †P < 0.05, different from 0 nM of SR141716.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.