SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Cl/HCOmath image anion exchanger 2 (AE2) participates in intracellular pH homeostasis and secretin-stimulated biliary bicarbonate secretion. AE2/SLC4A2 gene expression is reduced in liver and blood mononuclear cells from patients with primary biliary cirrhosis (PBC). Our previous findings of hepatic and immunological features mimicking PBC in Ae2-deficient mice strongly suggest that decreased AE2 expression might be involved in the pathogenesis of PBC. Here, we tested the potential role of microRNA 506 (miR-506) — predicted as candidate to target AE2 mRNA — for the decreased expression of AE2 in PBC. Real-time quantitative polymerase chain reaction showed that miR-506 expression is increased in PBC livers versus normal liver specimens. In situ hybridization in liver sections confirmed that miR-506 is up-regulated in the intrahepatic bile ducts of PBC livers, compared with normal and primary sclerosing cholangitis livers. Precursor-mediated overexpression of miR-506 in SV40-immortalized normal human cholangiocytes (H69 cells) led to decreased AE2 protein expression and activity, as indicated by immunoblotting and microfluorimetry, respectively. Moreover, miR-506 overexpression in three-dimensional (3D)-cultured H69 cholangiocytes blocked the secretin-stimulated expansion of cystic structures developed under the 3D conditions. Luciferase assays and site-directed mutagenesis demonstrated that miR-506 specifically may bind the 3′untranslated region (3′UTR) of AE2 messenger RNA (mRNA) and prevent protein translation. Finally, cultured PBC cholangiocytes showed decreased AE2 activity, together with miR-506 overexpression, compared to normal human cholangiocytes, and transfection of PBC cholangiocytes with anti-miR-506 was able to improve their AE2 activity. Conclusion: miR-506 is up-regulated in cholangiocytes from PBC patients, binds the 3′UTR region of AE2 mRNA, and prevents protein translation, leading to diminished AE2 activity and impaired biliary secretory functions. In view of the putative pathogenic role of decreased AE2 in PBC, miR-506 may constitute a potential therapeutic target for this disease. (HEPATOLOGY 2012)

Primary biliary cirrhosis (PBC) is a chronic cholestatic liver disease of unknown etiopathogenesis that mainly affects middle-age women.1-4 PBC livers exhibit nonsuppurative cholangitis with portal infiltrates and destruction of intralobular bile ducts affected by autoreactive T cells. A disease hallmark is the development of serum antimitochondrial autoantibodies (AMAs), which, together with other autoimmune phenomena, are encountered in most PBC patients. Nevertheless, immunosuppressive agents show little therapeutic efficacy, whereas daily administration of ursodeoxycholic acid (UDCA), the only U.S. Food and Drug Administration–approved treatment for PBC, improves the prognosis in a majority of patients when started in early stages of the disease.1, 5-7

Among its multiple effects, which include poorly defined immunomodulatory properties, the hydrophilic bile acid, UDCA, is known to induce bicarbonate-rich hypercholeresis in humans.1, 6, 7 Interestingly, PBC patients who had not yet initiated the treatment with UDCA were shown to exhibit impaired biliary bicarbonate secretion in response to secretin administration, and this defect was restored in patients under UDCA therapy.8 As smartly illustrated by the bicarbonate-umbrella hypothesis, secretin-stimulated biliary bicarbonate secretion may be crucial in humans to prevent the biliary epithelium from becoming injured by hydrophobic bile acids.9, 10 Secretin-stimulated biliary bicarbonate secretion is mediated by Cl/HCOmath image anion exchanger 2 (AE2),11-13 a widely expressed protein involved in hydroionic fluxes and intracellular pH (pHi) homeostasis, which, in the biliary epithelium, is located on the apical surface of lining cholangiocytes.14 In cholangiocytes of PBC patients, both the expression of AE2 and the level of exchange activity after stimulation with cyclic adenosine monophosphate (cAMP) (the second messenger of secretin signaling) are decreased.15, 16 Of interest, the observed restoration of the secretin response in PBC patients under treatment with UDCA appeared to run parallel with increased expression of AE2 in PBC livers.8, 15 These previous data supported the hypothesis that AE2 dysfunction may have an important pathogenic role in PBC.17 In fact, common genetic variations of the AE2/SLC4A2 gene have been associated with disease susceptibility and/or progression and AMA status among PBC patients.18-20 Additional evidence for a pathogenic role of AE2 dys-regulation was recently obtained with our Ae2a,b-deficient mice, a model that develops biochemical, histological, and immunologic alterations that recapitulate many PBC features (including development of serum AMA).21 Thus, though the deficient expression of AE2 in cholangiocytes of patients with PBC appears to be involved in the pathogenesis of the disease, the mechanisms responsible for AE2 down-regulation remain unclear.

MicroRNAs (miRNAs) are a subclass of small, noncoding RNAs that have recently attracted a lot of attention because of their ability to post-transcriptionally regulate the expression of numerous genes into their encoded proteins.22-24 Moreover, abnormal protein expression contributing to the pathogenesis of a variety of diseases has increasingly been recognized to be caused by alterations of specific miRNAs involved in regulating those proteins. Indeed, we reported that miR15-A is down-regulated in cholangiocytes of patients with polycystic liver diseases, leading to increased expression of CDC25A, a key regulator of the cell cycle, and accounting for the benign cholangiocyte hyperproliferation that results in hepatic cystogenesis.25 Also, in patients with PBC, global changes in miRNA expression were recently found in the liver when microarray analyses were carried out.26 With this background, here, we tested the hypothesis that down-regulation of AE2 in cholangiocytes of PBC patients might result from altered miRNA expression.

Our results support the conclusion that miR-506, the levels of which were reported to be increased in the liver of PBC patients,26 is particularly overexpressed in the cholangiocytes of these patients, binds directly to the 3′ untranslated region (3′UTR) of AE2 mRNA inhibiting the protein translation, and resulting in decreased AE2 activity. Moreover, inhibition of miR-506 in cultured PBC cholangiocytes increases their AE2 activity. In view of the putative pathogenic role of decreased AE2 in PBC, miR-506 may therefore constitute a potential therapeutic target for this disease.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

In Silico Predictions and In Situ Hybridization.

According to the MicroCosm Targets resource (http://www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/ v5/) that uses the miRBase database,27 miR-506 was predicted to potentially target the 3′UTR region of human AE2 messenger RNA (mRNA),28 with base complementarities to the sequence, CCCCUGCAGUAAAGUGCUUUG, within that 3′UTR region (see inset in Fig. 1A). Interestingly, miR-506 was one of the miRNAs encountered to be overexpressed in PBC livers when using a microarray.26 We therefore carried out locked nucleic-acid–based in situ hybridization (LNA-ISH) analysis for miR-506 in sections of PBC and control liver tissue (Supporting Methods).

thumbnail image

Figure 1. miR-506 is overexpressed in the liver of PBC patients. (A) Real-time qPCR indicates that the levels of miR-506 in whole liver extracts are increased in PBC, compared to normal controls (3.4-fold in the mean values, as indicated by bars; dots indicate the values of each case). Inset illustrates an alignment of the miRNA-506 sequence and its target in the 3′UTR region of AE2 mRNA. (B) In situ hybridization for miR-506 in liver tissue by using an anti-miR-506 probe: representative image of a PBC liver section with notable miR-506 staining (green) in the intrahepatic bile ducts (which are visualized in red through CK19 staining after using a tetramethyl rhodamine isothiocyanate–labeled secondary antibodies). Representative images of normal and PSC liver control sections indicating no detectable miR-506 expression are included as well (images to the left). The staining detected in PBC cholangiocytes with anti-miR-506 was specific, because no equivalent green staining could be observed in the PBC liver section when incubated with a negative control (scramble) probe (images to the right).

Download figure to PowerPoint

Primary Cholangiocytes and Biliary Cell Line.

We used the H69 cholangiocyte cell line (a gift from Dr. D. Jefferson, Tufts University, Boston, MA), a well-characterized SV40-transformed human bile duct epithelial cell line originally derived from a normal liver harvested for transplantation.29 Also, we used primary cultures of both PBC and normal human cholangiocytes isolated according to an original straightforward procedure (Supporting Methods). By using this procedure, pure differentiated cholangiocytes (positive for cytokeratin-7 and -19 [CK19], cystic fibrosis transmembrane conductance regulator, AE2, and aquaporin 1) were obtained (Supporting Materials and Supporting Fig. 1).

Western Blotting.

H69 human cholangiocytes were transfected with 50 nM (final dilution) of either miR-506 precursor oligonucleotides, miRNA precursor (pre-miRNA) negative control (both from Applied Biosystems, Foster City, CA), or vehicle using the siPORT NeoFX Transfection Agent, AM-4511 (Applied Biosystems). After 48 hours, changes in the protein expression of AE2 or CK19 were detected (Supporting Materials).

Luciferase Reporter Constructs and Assay.

A 175-base-pair DNA amplicon of the 3′UTR region of human AE2 mRNA with the miR-506 target site was obtained by reverse-transcription polymerase chain reaction (RT-PCR) using specific oligonucleotides (forward 5′-CCCAAGCTTCCGCCACCGAGGGACAGC-3′ and reverse 5′-GACTAGTAGGTGGGGGCCAAAGCAC-3′). Subcloning of this fragment into the pMIR-REPORT Luciferase vector (Applied Biosystems) resulted in the cytomegalovirus (CMV)-driven expression construct, Luc-AE2-3′UTR. The mutated reporter construct, Luc-mut-AE2-3′UTR, was then obtained through site-directed mutagenesis of the putative miR-506 target site (wild-type [WT] 5′-CAGTAAAGTGCTTTG-3′ [RIGHTWARDS ARROW] mutated 5′-TGATGAAGGGCTGCG-3′). H69 human cholangiocytes were cotransfected with either the WT or the mutated reporter construct, together with miR-506 precursor oligonucleotides, using FuGENE-HD Transfection Reagent (Promega, Fitchburg, WI). Briefly, 3 μL of FuGENE were added to 97 μL of Opti-MEM (modified Eagle's medium) and incubated for 5 minutes at room temperature. Then, 50 nM (final dilution) of miR-506 precursor oligonucleotides (or pre-miRNA negative control) were added to the FuGENE/Opti-MEM mixture, incubated again for 15 minutes, and applied to the human cholangiocytes under suspension. Luciferase activity was assessed 24 hours after transfection using the Luciferase Assay Kit, E151A (Promega), in a NOVOstar Apparatus (BMG LABTECH GmbH, Ortenberg, Germany). Luciferase activity was normalized to TK Renilla construct as previously reported.30

Assessment of AE2 Anion Exchange Activity.

H69, PBC, and normal human cholangiocytes were examined for their AE2 activity12 by microfluorimetry13 (Supporting Materials). Experiments were carried out in cells 48 hours after their transfection with 50 nM (final dilution) of either pre-miR-506, pre-miR negative control, or anti-miR-506 commercial oligonucleotides (all from Applied Biosystems), or vehicle.

Determination of miR-506 Expression Levels.

Total RNA was isolated from both freshly cultured cholangiocytes and whole liver tissue with TRI-Reagent (Sigma-Aldrich, St. Louis, MO). Aliquots (200 ng) were reverse-transcribed into complementary DNA (cDNA) using the TaqMan MicroRNA Reverse Transcription Kit and commercial miR-specific primers (Applied Biosystems) in a total volume of 15 μL. Expression levels of four particular miRNAs (i.e., miR-506, miR-149-3p, miR-765, and miR-944) were determined by real-time quantitative PCR (qPCR), according to the TaqMan MicroRNA Assay protocol, in a StepOne Plus Apparatus. For each miRNA, we employed 1.33 μL of the respective cDNA reaction as a template and carried out qPCRs under the following conditions: 95°C for 10 minutes and 45 cycles of both 95°C for 15 seconds and 60°C for 60 seconds. Data were analyzed by using the comparative Ct method and normalized with the expression of the Z-30 small nuclear RNA control (Applied Biosystems).31 The control group was related to 100% of expression. Liver tissue samples were obtained from the University Clinic of Navarra (Pamplona, Spain), and the experiments were approved by the University of Navarra Institution Review Board.

Three-Dimensional Culture of H69 Cholangiocytes.

Three-dimensional (3D)-cultured H69 cholangiocytes form cystic structures, which expand over time as a consequence of fluid secretion.32 Briefly, confluent H69 cholangiocytes were scrapped in enriched Dulbecco's modified Eagle's medium (DMEM)-Ham's F-12 medium, transferred to a 50-mL Falcon tube at 37°C, and left to stand during 2 hours for spontaneous recircularization. After a series of sequential filtrations through 100- and 40-μm meshes, H69 cystic structures, ranging from 40 to 100 μm, were seeded and grown between two layers of type I rat collagen (1.5 mg/mL; BD Biosciences, San Diego, CA) in enriched DMEM-Ham's F-12 medium for 24 hours at 37°C in the presence of either pre-miR-506 or pre-miR-control (50 nM each)33 or just vehicle. H69 cystic structures were then monitored for their expansion in response to 1 μM of secretin (Bachem, Torrance, CA) for 30 minutes in enriched DMEM-Ham's F-12 medium. The circumferential area of each cyst was measured by using ImageJ software (National Institutes of Health, Bethesda, MD).

Statistical Analysis.

Data are shown as mean ± standard error of the mean. Once normality was assessed with Kolmogorov-Smirnov's or Shapiro-Wilks' tests, we used the Student's t test for statistical comparisons between two groups of normally distributed variables and one-way analysis of variance and subsequent post-hoc tests (Bonferroni's, DMS, or Tamhane's T2) for comparisons between more than two groups. When nonparametric methods were required, we used Wilcoxon's, Friedman's, or Kruskal-Wallis' and Mann-Whitney's tests. Analyses were carried out with GraphPad Prism 5 (GraphPad Software Inc., La Jolla, CA) and/or SPSS statistical packages (SPSS, Inc., Chicago, IL). Two-tailed P values <0.05 were considered statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

miR-506 Is Overexpressed in the Intrahepatic Bile Ducts of PBC Patients.

The expression analysis of miR-506 by qPCR showed 3.4-fold up-regulation in PBC liver biopsies, compared to normal livers (n = 6 individuals in each experimental group) (Fig. 1A). To assess the location of miR-506, in situ hybridization experiments were carried out in liver samples of PBC patients and compared with normal and primary sclerosing cholangitis (PSC) liver samples (Fig. 1B). Most PBC liver sections showed marked miR-506 staining, which specifically located in the cholangiocyte lining of the intrahepatic bile ducts, rather than in hepatocytes. In normal liver specimens, no detectable staining was observed in either hepatocytes or bile ducts. On the other hand, only a minority of the PSC samples used as disease control showed a slight staining within few cholangiocytes.

miR-506 Down-regulates AE2 Protein Expression in H69 Cholangiocytes.

miR-506 overexpression in PBC livers could be responsible, at least in part, for the previously reported diminished AE2 immunoreactivity in the bile ducts of PBC patients.15 We therefore assessed whether miR-506 could down-regulate AE2 protein expression by using the SV40-immortalized normal human cholangiocytes (H69) transfected with pre-miR-506 (a miR-506 precursor). Real-time qPCR confirmed that H69 cells transfected with pre-miR-506 for 48 hours overexpressed the mature miR-506, compared with control H69 cholangiocytes transfected with either a pre-miRNA negative or vehicle (Fig. 2A). Noticeably, immunoblotting analysis indicated that overexpression of miR-506 in H69 cholangiocytes result in a marked decrease in AE2 protein expression, compared to controls (Fig. 2B). At the studied time point, levels of AE2 mRNA remained unchanged in those cells overexpressing miR-506 (data not shown), and therefore miR-506 appears to modulate AE2 protein expression through sequestration of the AE2 transcript.

thumbnail image

Figure 2. AE2 protein expression is down-regulated by miR-506. (A) qPCR indicates that H69 human cholangiocytes transfected for 48 hours with a miR-506 precursor (pre-miR-506) have increased expression of miR-506, compared to H69 cells that received either vehicle or the pre-miRNA negative control, pre-miR(−); values are given as fold levels relative to vehicle control levels. (B) Representative immunoblotting showing that overexpression of miR-506 in H69 human cholangiocytes leads to down-regulation of AE2 protein expression 48 hours after transfection, compared to cells receiving vehicle or the pre-miRNA negative control. β-actin was used as a normalizing loading control. Bottom panel shows the quantitation of AE2 protein levels relative to β-actin expression; values are given as percentage relative to cells receiving just vehicle. n, number of wells analyzed in each group.

Download figure to PowerPoint

miR-506 Binds to AE2 mRNA and Inhibits Protein Translation in H69 Cholangiocytes.

To prove that miR-506 may indeed bind its target site in the 3′UTR region of AE2 mRNA and prevent protein translation, we performed additional experiments of luciferase assay and site-directed mutagenesis. H69 cholangiocytes were contransfected with the CMV-driven luciferase construct, Luc-AE2-3′UTR (which contains the WT sequence of human AE2-3′UTR mRNA with the predicted miR-506 target), and either pre-miR-506, pre-miRNA negative control, or vehicle. The luciferase activity of the WT construct, Luc-AE2-3′UTR, was significantly inhibited in cells overexpressing miR-506, compared to cells receiving pre-miRNA negative control (25.45% inhibition) or vehicle (35.04%) (Fig. 3). On the other hand, the luciferase activity of the WT construct, Luc-AE2-3′UTR, was significantly increased in cells overexpressing anti-miR-506 oligonucleotides, compared to cells receiving pre-miRNA negative control or vehicle (49.13% and 41.28% increase, respectively). Site-directed mutagenesis of the putative miR-506-binding site (construct Luc-mut-AE2-3′UTR) prevented the inhibitory effect of pre-miR-506 cotransfection and the stimulatory effect of the cotransfection with anti-miR-506 oligonucleotides (Fig. 3). These data indicate that miR-506 can specifically bind to its predicted target site in the AE2-3′UTR mRNA region to inhibit protein translation.

thumbnail image

Figure 3. miR-506 targets the 3′UTR region of human AE2 mRNA. Upper inset illustrates the miR-506 target sequences (WT and mutated) of the 3′UTR region of human AE2 mRNA, which are contained in the respective luciferase reporter constructs (Luc-AE2-3′UTR and Luc-mut-AE2-3′UTR). In cultured H69 human cholangiocytes transfected with the WT Luc-AE2-3′UTR recombinant vector, translation of the luciferase reporter (detected as luciferase activity) was significantly decreased when H69 cells were cotransfected with the miR-506 precursor versus cells cotransfected with either a pre-miRNA negative control (∼25% inhibition) or just vehicle (∼35%). Cells cotransfected with Luc-AE2-3′UTR and anti-miR-506 oligonucleotides showed increased luciferase activity versus both cells receiving pre-miRNA negative control (∼50% increase) or vehicle (∼40%). Site-directed mutagenesis of the predicted miR-506 binding sequence in the Luc-mut-AE2-3′UTR construct eliminated the inhibitory effect of miR-506, as well as the stimulatory effect of anti-miR-506 oligonucleotides, and the luciferase activity remained similar to that observed with vehicle or the pre-miRNA negative control. n, number of wells analyzed in each group.

Download figure to PowerPoint

miR-506 Down-regulates AE2-Mediated Cl/HCOmath image Exchange Activity in H69 Cholangiocytes.

We previously showed that secretion of bicarbonate through Cl/HCOmath image exchange activity is only mediated by AE2 in human cholangiocytes.12 Here, we extended our studies to the functional level and assessed whether the decrease in AE2 protein elicited by miR-506 overexpression could result in diminished anion exchange activity. Cultured H69 cholangiocytes transfected with pre-miR-506 for 48 hours (which are therefore overexpressing miR-506) were trypsinized and seeded for microfluorimetric monitoring of pHi variations upon perfusion maneuvers (i.e., pHi alkalinization upon Cl removal) (which forces AE2 to operate in a reverse mode, extruding intracellular Cl in exchange with HCOmath image) and further normalization of pHi after restoration of extracellular Cl (which allows AE2 to operate in a physiological mode secreting HCOmath image). The rates of initial alkalinization and subsequent pHi recovery obtained by these maneuvers were both markedly decreased in H69 cholangiocytes transfected with pre-miR-506 versus control transfected cholangiocytes (Fig. 4A,B). These data indicate that overexpression of miR-506 leads to decreased AE2 activity in human cholangiocytes.

thumbnail image

Figure 4. miR-506 down-regulates the AE2-mediated Cl/HCOmath image exchange activity in H69 human cholangiocytes. (A) Representative traces showing that removal of extracellular Cl (by perfusion with an isethionate-based medium) leads to intracellular alkalinization as a result of HCOmath image uptake in exchange with Cl (through an AE2 activity operating in a reverse mode). Restoration of extracellular Cl decreases the pHi as a result of HCOmath image secretion in exchange with Cl (physiological AE2 activity). The rates of intracellular alkalinization and subsequent pHi recovery elicited by these maneuvers were down-regulated in cultured H69 human cholangiocytes in the presence of the miR-506 precursor (middle panel) versus cells receiving vehicle or a pre-miRNA negative control. (B) Quantitation of the physiological Cl/HCOmath image exchange activity (calculated from the tangent of the experimental plot of intracellular acidification upon restoration of extracellular Cl, and expressed as transmembrane base fluxes Jmath image) shows that overexpression of miR-506 (in cells receiving miR-506 precursor) leads to a significant decrease in the AE2 activity, compared with cells receiving vehicle or the pre-miRNA negative control. n, number of cells analyzed from three independent experiments for each condition.

Download figure to PowerPoint

miR-506 Overexpression Inhibits the Apical Hydroionic Fluxes Stimulated by Secretin in 3D-Cultured H69 Cholangiocytes.

Also, we investigated the effect of miR-506 on the hydrocholeretic function of human cholangiocytes using the model of 3D-cultured H69 cholangiocytes. Under 3D conditions, H69 human cholangiocytes may form cystic structures, which spontaneously expand over time as a consequence of fluid secretion into the cyst lumen. As previously reported for 3D-cystic structures derived from rat cholangiocytes,32 the expansion rate of the human H69 cystic structures was accelerated by the presence of secretin in culture medium during 30 minutes (6.40% ± 1.26%; P = 0.0002; Fig. 5), indicating an increase in fluid secretion to the cyst lumen. But, preincubation with pre-miRNA-506 in culture medium for 24 hours blocked the secretin-stimulated expansion of H69 cholangiocyte cystic structures. Altogether, our findings indicate that up-regulated miR-506 may inhibit both AE2 expression and AE2-mediated hydrocholeretic function in human cholangiocytes.

thumbnail image

Figure 5. miR-506 inhibits the apical hydroionic fluxes stimulated by secretin in 3D-cultured H69 cholangiocytes. Secretin-stimulated expansion of the cystic structures formed by 3D-cultured H69 cells was significantly inhibited when cystic structures had been preincubated for 24 hours with pre-miR-506, compared to H69 cystic structures receiving vehicle or the pre-miRNA negative control. n, number of cystic structures analyzed from two independent experiments for each condition.

Download figure to PowerPoint

Decreased AE2 Activity in PBC Cholangiocytes May Be Caused by miR-506 Overexpression.

Next, we investigated whether our previous data of decreased AE2 activity in cultured PBC cholangiocytes16 could be related to overexpression of miR-506. We isolated PBC cholangiocytes using pieces of a liver explant from a female patient with PBC and cultured them for 7-10 passages. Also, we isolated normal cholangiocytes from liver pieces of normal bordering tissue (obtained during a surgical intervention in a female patient; Supporting Materials) and cultured them as for PBC cholangiocytes. qPCR analysis of miR-506 levels revealed a 2-fold increase in cultured PBC cholangiocytes versus normal cholangiocytes (Fig. 6A). However, expression levels of two other miRNAs predicted to potentially target human AE2 mRNA (i.e., miR-149-3p and miR-765) were down-regulated in cultured PBC cholangiocytes, compared to normal cholangiocytes (Supporting Materials and Supporting Fig. 2).

thumbnail image

Figure 6. Cultured PBC cholangiocytes show decreased AE2 activity, which is at least partially the result of miR-506 overexpression. (A) qPCR indicated that isolated and cultured PBC cholangiocytes have 2-fold increased miR-506 expression, compared to similarly isolated and cultured normal human cholangiocytes; n, number of wells analyzed. (B) Cultured PBC cholangiocytes (left black box) show decreased AE2 anion exchange activity, compared to normal cholangiocytes (open box). Diminished AE2 activity in PBC cholangiocytes is partially, but significantly, recovered through overexpression of anti-miRNA-506 oligonucleotides (right black box) versus PBC cholangiocytes with either vehicle or the pre-miRNA negative control; n, number of cells analyzed from two independent experiments for each condition. (C) Immunofluorescent confocal images confirm that cultured PBC cholangiocytes have decreased AE2 protein expression — visualized as green fluorescence after using fluorescein isothiocyanate–labeled secondary antibodies — compared to normal cholangiocytes. PBC cholangiocytes transfected with Cy3-labeled (ref. AM1632; Ambion, Austin, TX) anti-miR-506 oligonucleotides (visualized as red dots) show increased AE2 protein expression, compared to PBC cholangiocytes transfected with Cy3-labeled pre-miR negative control (also visualized as red dots) or vehicle; nuclei are stained in blue with TOPRO-3.

Download figure to PowerPoint

Microfluorimetric studies indicated that miR-506 overexpression in PBC cholangiocytes was associated with decreased AE2 activity (Fig. 6B). To test the hypothesis that the down-regulated AE2 activity in PBC cholangiocytes is at least partially the result of the increased miR-506 levels, we used commercial anti-miR-506 oligonucleotides to inhibit miR-506. miR-506 inhibition resulted in significantly increased AE2 activity, compared with the activity of PBC cholangiocytes receiving pre-miRNA negative control or vehicle (Fig. 6B). These results were also associated with consistent changes in AE2 protein expression (Fig. 6C).

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

The key findings reported here relate to the cellular mechanisms accounting for AE2 down-regulation in the biliary epithelium of PBC patients. We identified miRNA-506 as a candidate to modulate AE2 and carried out experiments to determine its actual role for AE2 expression in cholangiocytes. Our data indicate that: (1) miR-506 is overexpressed in the liver of PBC patients, compared to normal controls (as demonstrated by qPCR); (2) miR-506 overexpression takes place in the intrahepatic bile ducts of PBC patients (as shown by in situ hybridization); (3) miR-506 is able to bind specifically to the 3′UTR region of AE2 mRNA, preventing protein expression (as shown by luciferase-reporter assays); (4) overexpression of miR-506 in a cholangiocyte cell line leads to a decrease in both AE2 protein expression and anion exchange activity (as demonstrated by immunoblotting and microfluorimetry, respectively); (5) miR-506 is involved in the diminished AE2 activity observed in cultured PBC cholangiocytes that overexpress this microRNA (as indicated by the partial improvement of the exchange activity upon miR-506 inhibition); and (6) an increase in AE2 protein is induced in these cells after treatment with anti-miR-506. Our data are consistent with the notion that miR-506 may control AE2 expression in cholangiocytes and may play an important role in the pathogenesis of PBC.

PBC is a disease with an obscure etiopathogenesis in which intralobular bile ducts are selectively damaged by autoreactive T cells.1-4 We had previously reported that AE2 expression is decreased in the liver and peripheral blood mononuclear cells (PBMCs) from PBC patients.15, 34 Moreover, the cAMP-stimulated Cl/HCOmath image exchange activity, which, in human cholangiocytes, is only mediated by AE2,12 was found to be diminished in cultured PBC cholangiocytes.16 Our recent findings that Ae2a,b-deficient mice develop biochemical, histological, and immunologic alterations that recapitulate many of the features of PBC indeed support the hypothesis that AE2 dysfunctions may have an important role in the pathogenesis of the disease.21 It is quite possible that AE2 deficiency in PBC patients may render cholangiocytes more immunogenic and susceptible to autoimmune attack, whereas an equivalent defect in lymphocytes may alter immunological homeostasis, leading to autoimmunity.35 However, why AE2 expression and activity are down-regulated in bile ducts from PBC patients is unknown.

miRNAs are recognized as important regulators of cell function.22-24 Recently, microarray-scan studies in liver tissue identified several differentially expressed miRNAs in PBC.26 Using in silico approaches, we found that one of the miRNAs that were up-regulated in PBC livers,26 miR-506, exhibits base complementarities to the 3′UTR of AE2 mRNA and could possibly target this messenger. Thus, miR-506 was a prime candidate to potentially account for the down-regulation of AE2. The expression analyses of miR-506 by qPCR revealed over 3-fold up-regulation in PBC liver biopsies, compared to normal liver specimens (Fig. 1A). Moreover, in situ hybridization showed that miR-506 overexpression in PBC is mainly located in cholangiocytes of intrahepatic bile ducts (Fig. 1B). No detectable staining was observed in normal tissue specimens, and only very limited miR-506 expression was found in PSC samples, suggesting that overexpression of miR-506 is characteristic of PBC. In fact, miR-506 overexpression could also be recognized in freshly isolated and cultured PBC cholangiocytes, which were confirmed to have decreased AE2 activity, as previously reported.16 Of interest, the cause-effect relationship between miR-506 overexpression and decreased AE2 activity in PBC cholangiocytes was hereby substantiated by our finding that blockage of miR-506 with anti-miR-506 oligonucleotides could partially recover the diminished AE2 expression and activity in PBC cholangiocytes.

Experiments of luciferase assay and site-directed mutagenesis in the human cholangiocyte cell line, H69, showed that miR-506 may specifically bind its target site in the AE2 mRNA 3′UTR region and prevent protein translation. Moreover, we extended our studies in this cell line to the functional level and ascertained that down-regulation of AE2 protein expression by miR-506 leads to decreased AE2 anion exchange activity. We also used the model of 3D-cultured H69 cholangiocytes to investigate the effect of miR-506 on the hydrocholeretic function of human cholangiocytes. Under 3D conditions, H69 cholangiocytes formed cystic structures, which accelerated their spontaneous expansion upon secretin stimulation because of an increase in fluid secretion to the cyst lumen (similarly to what it was already reported for 3D-cystic structures derived from rat cholangiocytes).32 Interestingly, the presence of pre-miR-506 in the culture medium blocked the secretin-stimulated expansion of H69 cholangiocyte cystic structures. Altogether, our data indicate that overexpression of miR-506 is able to inhibit both AE2 protein expression and AE2-mediated hydrocholeretic function in human cholangiocytes.

Under our experimental conditions, miR-506 appears to modulate AE2 through sequestration, rather than degradation, of the AE2 message, because H69 cells transfected with pre-miR-506 showed no decrease in AE2 mRNA levels (data not shown). Concerning the decreased AE2 mRNA expression previously reported in PBC livers,34 it is possible that a chronic up-regulation of miR-506 (versus acute) might result in AE2 mRNA degradation. Moreover, other features different from miR-506 up-regulation (e.g., gene-sequence variations, epigenetic modifications, abnormalities affecting transcription factors, and even diverse miRNAs) might additionally be involved, an issue that needs to be fully clarified in future studies. At this moment, we know that other miRNAs predicted to potentially target human AE2 mRNA, such as miR-149-3p and miR-765, were down-regulated in cultured PBC cholangiocytes versus normal cholangiocytes (Supporting Fig. 2), and that expression of a third candidate (miR-944) was undetectable in both PBC and normal cholangiocytes. Thus, the particular role of miR-506 for the decreased AE2 in PBC livers appears to be further enlightened. Though PBMCs were also reported to have decreased AE2 mRNA expression in PBC,34 this decreased transcriptional expression is, however, unrelated to miR-506, because we found no up-regulation of miR-506 in the peripheral blood cells collected from patients with PBC (data not shown).

PBC is currently regarded as a multifactorial liver disease that may ensue from highly complex interactions of genetic- and environmental-related factors, a view that is being stressed by recent results of genome-wide association studies36-39 and more conventional genetic and epidemiological studies.40-43 Exposure of susceptible individuals to environmental agents, such as chemical/xenobiotics, tobacco, alcohol, and a variety of microorganisms, may result in epigenetic alterations, which might include not only DNA methylation and histone modification, but also dys-regulated expression of miRNAs.23 Indeed, miRNAs are recently being considered as authentic effectors of environmental influences on gene expression and disease.23 The mechanisms leading to miR-506 up-regulation in PBC cholangiocytes remain to be elucidated, and involvement of environmental agents may be postulated. Although in vivo animal experiments sound attractive to further explore this issue, unfortunately, rat and mouse animal models are not suitable, because the AE2 target sequence is present in the human AE2 mRNA,28 but not in the orthologous sequences in rats and mice. On the other hand, the consequences of miR-506 up-regulation in the biliary epithelium might be more extensive than primarily inferred from its effects on AE2, and this possibility will certainly deserve further investigation in the future. Thus, miR-506 was also predicted by bioinformatic approaches to potentially target the 3′UTR region of human CK19 mRNA, with base complementarities to the sequence UGUCCUUUGGAGGGUGUCUUC. Interestingly, our western blotting data indicate that overexpression of miR-506 in H69 cholangiocytes result in down-regulation of CK19 protein expression (Supporting Materials and Supporting Fig. 3).

In summary, our results identify a molecular mechanism (i.e., miRNA suppression of protein translation), which can account for the down-regulation of AE2 protein and activity in cholangiocytes of patients with PBC and provide direct evidence that a specific miRNA (i.e., miR-506) is important in the process. Our data therefore introduce the concept that miRNA dysfunction may be central to the pathogenesis of PBC. Moreover, they indicate that miR-506 is a potential target to restore the AE2 function in PBC cholangiocytes.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

The authors thank Dr. D. Jefferson, Tufts University for the gift of the H69 cholangiocyte cell line. The authors are very grateful to Dr. I. Uriarte for his help. The authors also thank the MicroCosm Targets' team and the miRBase-Sanger web team for the useful web resources for searching microRNAs.

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
HEP_25691_sm_SuppInfo.doc492KSupporting Information

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.