Pericentral activity of alpha-fetoprotein enhancer 3 and glutamine synthetase upstream enhancer in the adult liver are regulated by β-catenin in mice

Authors

  • Erica L. Clinkenbeard,

    Corresponding author
    1. Department of Microbiology, Immunology, and Molecular Genetics, Lexington, KY
    • Department of Microbiology, Immunology, and Molecular Genetics, University of Kentucky College of Medicine, 800 Rose Street, Lexington, KY 40536
    Search for more papers by this author
    • fax: 859-257-8994

  • James E. Butler,

    1. Department of Microbiology, Immunology, and Molecular Genetics, Lexington, KY
    Search for more papers by this author
    • Potential conflict of interest: Nothing to report.

  • Brett T. Spear

    1. Department of Microbiology, Immunology, and Molecular Genetics, Lexington, KY
    2. Markey Cancer Center, University of Kentucky, Lexington, KY
    Search for more papers by this author

  • These authors contributed equally to this work.

Abstract

We previously showed that mouse alpha-fetoprotein (AFP) enhancer 3 activity is highly restricted to pericentral hepatocytes in the adult liver. Here, using transgenic mice, we show that the upstream enhancer of the rat glutamine synthetase gene is also active, specifically in pericentral regions. Activity of both enhancers is lost in the absence of β-catenin, a key regulator of zonal gene expression in the adult liver. Both enhancers contain a single, highly conserved T-cell factor/lymphoid enhancer factor binding site that is required for responsiveness to β-catenin. We also show that endogenous AFP messenger RNA levels in the perinatal liver are lower when β-catenin is reduced. Conclusion: These data identify the first distinct zonally active regulatory regions required for β-catenin responsiveness in the adult liver, and suggest that postnatal AFP repression and the establishment of zonal regulation are controlled, at least in part, by the same factors. (HEPATOLOGY 2012;56:1892–1901)

The liver performs numerous metabolic and homeostatic functions in the body, including xenobiotic metabolism, energy storage/production, urea formation, glutamine synthesis, and cholesterol homeostasis.1 Many of these functions require the unique architecture of the liver, which is comprised of peri- and pericentral regions.2 Certain hepatic enzymes are expressed solely in periportal regions along this portocentro axis, whereas other enzymes are synthesized in pericentral regions. This compartmentalization of function, or “liver zonation,” enables the liver to perform multiple, and sometimes opposing, metabolic pathways in distinct hepatocyte subpopulations.3

The pericentral expression of glutamine synthetase (GS) was the first example of zonal gene regulation in the adult liver.4 Since this discovery, numerous additional enzymes were found to exhibit zonal patterns of expression in the liver.5 It is generally believed that certain blood-borne compounds (i.e., oxygen and nutrients) that form a gradient along the portocentro axis provide signals that establish the heterogeneity of gene expression in the liver, although the nature of such signals is not fully understood.6 Regardless of the stimulus, intracellular signaling pathways must link extracellular events to the nucleus to govern zonal gene regulation. An elegant study by Benhamouche et al. demonstrated that signaling through β-catenin, a downstream activator of Wnt, governs zonal gene regulation in the adult liver.7 In the absence of Wnt signaling, cytosolic β-catenin is complexed with adenomatous polyposis coli (APC), Axin, and the kinases, glycogen synthase kinase 3 beta and casein kinase 1. This inhibitory complex phosphorylates β-catenin at specific serine residues that mark it for ubiquitin-mediated proteolysis. In the absence of this phosphorylation (i.e., when blocked by Wnt signaling), β-catenin enters the nucleus and regulates target gene expression. Regarding zonal regulation, activated β-catenin (through expression of a nondegradable form of β-catenin or loss of APC) is associated with increased expression of GS (and other pericentral genes) and decreased expression of periportal genes in periportal regions.7-9 In contrast, blocking β-catenin signaling results in a loss of pericentral enzymes and increases periportal enzyme expression.7

β-catenin does not bind DNA directly, but can regulate target genes through several pathways. In the canonical pathway, β-catenin controls target genes through interactions with the T-cell factor/lymphoid enhancer factor (TCF/LEF) family of transcription factors.10 In the absence of β-catenin, TCF/LEF proteins are bound to consensus motifs and silence target genes by recruitment of corepressors, such as Groucho.11 Upon nuclear entry, β-catenin interacts with TCF/LEF proteins, dissociating repressors and recruiting the coactivators, CREB-binding protein/p300, leading to target gene activation.12

Using transgenic (Tg) mice, we showed previously that the activity of alpha-fetoprotein (AFP) enhancer 3 (E3), one of the three AFP enhancers, is highly restricted to a single layer of pericentral hepatocytes in the adult liver,13, 14 a pattern identical to GS and other highly restricted pericentral enzymes. AFP is expressed abundantly in the fetal liver and silenced at birth, but can be transiently reactivated during liver regeneration and is often activated in hepatocellular carcinoma (HCC).15 Here, we show that pericentral activity of E3 is β-catenin dependent. Using Tg mice, we also show that the upstream enhancer of the rat GS gene can confer pericentral activity to a linked reporter gene, and that the activity of this enhancer is also β-catenin dependent. Both enhancers contain a highly conserved TCF site that binds TCF4 in vitro, and mutation of these TCF sites results in a loss of β-catenin responsiveness in cultured cells. We also show that E3 activity and endogenous AFP expression in the perinatal liver are reduced in the absence of β-catenin, suggesting that β-catenin regulates AFP during liver development. These data identify the first defined zonally regulated cis-acting control regions that confer β-catenin responsiveness.

Abbreviations

AFP, alpha-fetoprotein; Alb-Cre, albumin-Cre recombinase; APC, adenomatous polyposis coli; βgl, β-globin; BCA, bicinchoninic acid; bp, base pair; cDNA, complementary DNA; E3, enhancer 3; EMSA, electrophoretic mobility shift assay; FITC, fluorescein isothiocyanate; GS, glutamine synthetase; HCC, hepatocellular carcinoma; HNF, hepatocyte nuclear factor; IgG, immunoglobulin G; kb, kilobases; mAb, monoclonal antibody; mRNA, messenger RNA; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; RGSe, rat glutamine synthetase upstream enhancer; TCF/LEF, T-cell factor/lymphoid enhancer factor; Tg, transgenic; WT, wild-type.

Materials and Methods

Plasmids.

E3 was excised from E3/β-globin (βgl)-Dd14 and cloned into pGL3-promoter (Promega, Madison, WI) to generate E3-Luc. Rat glutamine synthetase upstream enhancer (RGSe) was amplified from rat DNA using primers RGSeU and RGSeL (Table 1) and cloned into βgl-Dd to generate RGSe-βgl-Dd or into pGL3-promoter to generate RGSe-Luc. Megaprimer mutagenesis,16 using primers listed in Table 1, generated TCF-site mutations in E3-Luc and RGSe-Luc; mutations were confirmed by DNA sequencing. TOP-Flash and FOP-Flash were provided by H. Clevers.17 Expression vectors for wild-type (WT) β-catenin, βcatS37A, and TCF4 were provided by S. Byers18 and Chunming Lui.19

Table 1. Oligonucleotides Used in This Study
  1. Underlined sequences indicate the TCF binding motif. Nucleotides in bold indicate mutations that were incorporated to eliminate TCF binding.

RGSeU:5′-GCTAGGATCCAAGCTTCTTGTTTACCCCTG
RGSeL:5′-TCAAGGATCCGAGTTTCAGATGGCAGCTTC
mE3 TFCU:5′-AGATAAAATTCCTTTGATGAAGGAAAA
mE3 TFCL:5′-TTTTCCTTCATCAAAGGAATTTTATCT
mE3 TFCMutU:5′-AGATAAAATTCCCGGGATGAAGGAAA
mE3 TFCMutL:5′-TTTTCCTTCATCCCGGGAATTTTATCT
RGSe TFCU:5′-CATGGAAGGATCAAAGCAAGCCTGC
RGSe TFCL:5′-GCAGGCTTGCTTTGATCCTTCCATG
RGSe TFCMutU:5′-CATGGAAGGACCCGGGCAAGCCTGC
RGSe TFCMutL:5′-GCAGGCTTGCCCGGGTCCTTCCATG
Control TCFU:5′-GGTACTGGCCCTTTGATCTTTCTGG
Control TCF L:5′-CCAGAAAGATCAAAGGGCCAGTACC
Control TCFMutU:5′-GGTACTGGCCCGGGGATCTTTCTGG
Control TCFMutL:5′-CCAGAAAGATCCCCGGGCCAGTACC
AFP5′:5′ CCGGAAGCCACCGAGGAGGA
AFP3′:5′ TGGGACAGAGGCCGGAGCAG
bCat5′:5′ CTCTTCAGGACAGAGCCAATG
bCat3′:5′ ATGCTCCATCATAGGGTCCA
L305′:5′ ATGGTGGCCGCAAAGAAGACGAA
L303′:5′ CCTCAAAGCTGGACAGTTGTTGGCA

Cell Culture and Luciferase Assays.

Hep3B human hepatoma cells and HEK293 cells were maintained, and transfections were performed as previously described.20 Hep3B cells were seeded into 12-well dishes and transfected in duplicate with 500 ng of luciferase reporter plasmid, 1 μg of expression plasmid, and 12.5 ng of Renilla luciferase plasmid. To prepare nuclear extracts, HEK293 cells were seeded onto 10-cm plates and transfected with 15 μg of the Flag-TCF4 expression plasmid (or mock transfected). For both cell types, media were changed after 6 hours and cells were harvested 48 hours later. Transfected Hep3B cells were harvested into Glo-lysis buffer (Promega), and firefly/Renilla luciferase levels were determined in duplicate. All transfections were repeated at least twice. Results were analyzed using the Student t test, with P values <0.05 considered to be statistically significant.

Electrophoretic Mobility Shift Assay.

Nuclear lysates were collected from HEK293 cells using the NE-PER extraction kit (Thermo Fisher Scientific, Rockville, IL). Protein concentrations were determined using the bicinchoninic acid (BCA) protein assay (Pierce, Rockville, IL). Labeling of annealed oligonucleotides (Table 1) (Integrated DNA Technologies, Inc., Coralville, IA) with 32P and electrophoretic mobility shift assay (EMSAs) were carried out as previously described.21

Mouse Studies.

The E3-βgl-Dd Tg mice were described elsewhere.14 RGSe-βgl-Dd founder mice were generated at the University of Kentucky Transgenic Mouse facility (Lexington, KY). Mice were screened for the transgene by polymerase chain reaction (PCR) analysis of tail DNA. Mice containing Albumin-Cre recombinase (Alb-Cre)22 and the floxed β-catenin (Ctnnb1) gene23 were purchased from The Jackson Labs (Bar Harbor, ME). Standard breeding was performed to obtain mice of the appropriate genotype. Oligonucleotides and PCR conditions for screening genetically modified mice are available upon request. All mouse experiments were approved by the University of Kentucky Institutional Animal Care and Use Committee, following guidelines established by the National Institutes of Health.

Immunohistochemistry.

Frozen livers were sectioned at 10-μm thickness. For transgene analysis, slides were incubated overnight with fluorescein isothiocyanate (FITC)-conjugated anti-H2-Dd monoclonal antibodies (mAbs) (catalog no.: 553579; BD Pharmingen, San Diego, CA). For β-catenin and GS, antibodies against active β-catenin (catalog no.: 05-665; Millipore, Billerica, MA) and GS (catalog no.: G2781; Sigma-Aldrich, St. Louis, MO) were used. Staining details are available upon request.

Hydrodynamic Tail-Vein Injections/Flow Cytometry.

Eight-week-old E3/βgl-Dd mice were injected with 2.5 mL of 0.9% saline containing 50 μg of plasmid.24 After 48 hours, mice were sacrificed and livers were harvested. Livers, along with 5 mL of RPMI containing 10% fetal bovine serum, were placed in a stomacher bag and compressed for 60 seconds using Stomacher-80 Laboratory blender (Seward Lab Systems, Bohemia, NY). Cells were transferred to 15-mL conical tubes along with DNaseI (160 U/mL) and collagenase (400 U/mL) and incubated at 37°C for 20 minutes, passaged through a 40-micron strainer, centrifuged, and washed with 2 mL of ice-cold phosphate-buffered saline (PBS) with 0.1% BSA/0.1% azide. Hepatocytes were purified by Percoll centrifugation and stained with FITC-anti-H2-Dd or control immunoglobulin G (IgG), followed by flow cytometry, at the University of Kentucky Flow Cytometry Facility.

RNA Analysis.

RNA was prepared using two rounds of Trizol (Invitrogen, Carlsbad, CA) and processed into complementary DNA using qScript (Quanta BioSciences, Inc., Gaithersburg, MD). Quantitative PCR was carried out using SYBR Green (Quanta BioSciences) using the Bio-Rad MyiQ thermal cycler (Bio-Rad, Hercules, CA). AFP and β-catenin messenger RNA (mRNA) levels were normalized to ribosomal gene L30, using primers shown in Table 1.

Results

The Upstream GS enhancer Exhibits Pericentral Activity in Tg Mice.

Pericentral GS expression was first described in 1983,4, 25 and GS continues to be the most extensively studied pericentral gene. Several elements controlling GS activity have been identified in tissue-culture cells, including a single upstream enhancer centered 2.2 kilobases (kb) upstream of exon 1 and several regulatory regions within the first intron.26-30 Previous studies indicated that the 3.2-kb region upstream of the rat GS gene (−3,150 to +59) could confer pericentral expression of a linked reporter gene in Tg mice.31 To test whether the upstream enhancer of the rat GS gene exhibited pericentral activity by itself, this enhancer was cloned as a 400-base-pair (bp) fragment (as previously defined21 and which will be referred to as RGSe) and fused to the heterologous human β-globin promoter linked to the mouse H-2Dd reporter gene (βgl-Dd). We have used βgl-Dd extensively to monitor gene expression in cells and Tg mice; this cassette is inactive in all mouse tissues, but is highly responsive to linked enhancers.14 Furthermore, transgenes with βgl-Dd fused to the albumin enhancer are expressed throughout the adult liver, demonstrating that the β-globin promoter can be activated in all adult hepatocytes (unpublished data). Several founder mice containing the RGSe-βgl-Dd transgene were generated. Immunofluorescence staining using anti-Dd antibodies indicated that transgene expression was restricted to a single layer of pericentral hepatocytes in the adult liver (Fig. 1). This pericentral activity is identical to the expression of endogenous GS and to E3-βgl-Dd transgenes, which we previously showed to exhibit pericentral expression in the adult liver.13, 14 These data demonstrate that the upstream GS enhancer, RGSe, is sufficient to confer highly restricted pericentral activity in the adult liver in the absence of other GS-regulatory regions.

Figure 1.

Expression of RGSe-βgl-Dd transgenes is restricted to hepatocytes directly surrounding the central vein in the adult liver. The rat RGSe, centered at −2.2 kb, was amplified as a 400-bp fragment and fused to βgl-Dd. Offspring of two different Tg founders containing RGSe-βgl-Dd were sacrified at ∼8 weeks of age. Frozen sections were prepared and stained with an FITC-anti-Dd mAb. Dd expression was restricted to hepatocytes directly surrounding the central veins. The same pattern of staining was observed with lines from two other RGSe-βgl-Dd founder mice (data not shown). Magnification, ×20.

E3 and RGSe Enhancer Activities Are Dependent on β-Catenin.

Numerous genes expressed in pericentral regions are controlled by β-catenin signaling, with active β-catenin being found only in pericentral hepatocytes of the adult liver.7 Because E3 activity is highly restricted to this population of hepatocytes, we predicted that pericentral activity of this enhancer would colocalize with active β-catenin. To test this, we costained liver sections of adult E3-βgl-Dd mice with antibodies against Dd and active (i.e., unphosphorylated) β-catenin (Fig. 2A). Consistent with previous studies, we found active β-catenin localized to pericentral hepatocytes.7 E3-βgl-Dd expression and active β-catenin overlap in these pericentral cells. This colocalization of Dd and active β-catenin supports the possibility that active β-catenin is required for E3 activity.

Figure 2.

E3-βgl-Dd transgene expression and active β-catenin are colocalized in pericentral hepatocytes. (A) Tg mice containing E3-βgl-Dd were sacrificed at ∼8 weeks of age. Sections were stained for Dd expression (left panel, green) and active β-catenin (middle panel, red), as previously described. Overlay of these (right panel, yellow) demonstrates the colocation of Dd and active β-catenin in the same population of hepatoctyes. (B) Hydrodynamic tail-vein injection was used to transfer control plasmid (pcDNA3.1, left panels) and the constitutively active βcatS37A (right panels) into adult E3-βgl-Dd mice. After 2 days, hepatocytes were isolated, then stained with control IgG antibodies (upper two panels) or FITC-anti-Dd antibodies (lower two panels). The percentage of cells gated as positive for Dd expression (those in the lower right area of each panel) are shown.

The phosphoryation, and subsequent degradation, of β-catenin accounts for its absence in nonpericentral hepatocytes. In contrast to the WT protein, a mutant form of β-catenin in which the serine at position 37 is changed to alanine (βcatS37A), cannot be phosphorylated and is less susceptible to degradation.18 Previous studies showed that adenovirus-mediated βcatS37A overexpression resulted in increased GS expression throughout the liver lobule.8 We used hydrodynamic tail-vein injection to express βcatS37A in the liver of adult E3-βgl-Dd mice. Three days after injection, hepatocytes were purified and analyzed by flow cytometry with anti-Dd antibodies. In control mice, roughly 3% of hepatocytes, presumably representing pericentral cells, stained positive for Dd (Fig. 2B). In contrast, 30% of hepatocytes expressed Dd in livers from βcatS37A-injected mice. This provides evidence that AFP enhancer E3 can be activated in nonpericentral hepatocytes by constitutively active β-catenin.

If β-catenin is required for the activity of pericentral enhancers, its absence should result in the loss of enhancer activity in the adult liver. To explore this possibility, we crossed E3-βgl-Dd and RGSe-βgl-Dd Tg mice to mice that were homozygous for a floxed allele of the β-catenin gene (Ctnnb1) and expressed the Alb-Cre transgene. Previous studies showed that Alb-Cre transgene expression leads to a loss of β-catenin in essentially all hepatocytes of adult mice.32 Expression of both E3-βgl-Dd (Fig. 3A) and RGSe-βgl-Dd (Fig. 3B) transgenes was completely absent in hepatocytes lacking β-catenin (βCatΔliv), whereas both transgenes continued to be expressed in hepatocytes of βCatfl mice that did not contain Alb-Cre. As expected, endogenous GS proteins were also absent in β-catenin-deficient livers (Fig. 3).

Figure 3.

E3-βgl-Dd and RGSe-βgl-Dd expression is lost in the absence of β-catenin in adult hepatocytes. Several rounds of breeding were performed to obtain those that contained E3-βgl-Dd (A) or RGSe-βgl-Dd (B) transgenes, were homozygous for the floxed Ctnnb1 allele, and contained (βcatΔliv; right panels) or did not contain (βcatfl; left panels) the Alb-Cre transgene. Frozen adult liver sections were stained with FITC-anti-Dd antibodies (upper panels) or tetramethyl rhodamine isothiocyanate (TRITC)-anti-GS (lower panels). In the presence of β-catenin, Dd-containing transgenes and the endogenous GS gene were expressed in pericentral hepatocytes. In the absence of β-catenin, no transgene-derived Dd or endogenous GS expression was observed.

β-Catenin Regulates E3 and RGSe Through Conserved TCF/LEF Sites.

β-catenin does not bind DNA directly, but can regulate target gene expression through several mechanisms. In the canonical pathway, nuclear β-catenin replaces repressors interacting with bound TCF/LEF factors with coactivators. To further explore the control of E3 and RGSe by β-catenin, we searched for TCF sites in these two defined enhancers. AFP enhancer E3 contains a strong TCF/LEF site located toward the 3′ end of this 340-bp element. Previous studies had identified a single TCF/LEF site in the 3′ end of RGSe33; our analysis indicates that this is the only TCF/LEF site in this 400-bp enhancer.33 The TCF sites in these two enhancers are highly conserved, suggesting that they are important for the activities of these elements (Table 2).

Table 2. TCF sites in AFP E3 and GS Upstream Enhancer
  1. TCF consensus: A/T A/T C A A A G (G), where middle “A” is indispensable and (G) improves LEF binding (55).55 Residues that are different from the mouse are highlighted in gray.

AFP E3 (3′ – 5′)
 Mouse:gttttccttc ATCAAAGG aattttatct
 Rat:ttttccctcc ATCAAAGG aattttatct
 Guinea pig:catttcctca ATCAAAAG gactttactt
 Cat:tcattccttt ATCAAAGA gattttgcct
 Dog:tcattccttc ATCAAAGG gattttgcct
 Lemur:gttttccttc ATCAAAGG gattttattt
 Rhesus:gtttcccttt ATCAAAGG gatcttgtcc
 Chimp:atttcacttt ATCAAAGG gatcttgccc
 Human:atttcacttc ATCAAAGG gatcttgtcc
GS upstream enhancer (5′ – 3′)
 Mouse:acatgaaagg ATCAAAGC aaatccgctt
 Rat:acatgaaagg ATCAAAGC aagcctgctt
 Guinea pig:acatgaaagg ATCAAAGC aaatccattt
 Cat:acatgaatgg ATCAAAGC aaatccattt
 Dog:acatgaatgg ATCAAAGC aaatccattt
 Lemur:acatgaacgg ATCAAAGC gaatctattt
 Rhesus:acatgaatgg ATCAAAGC aaatccattt
 Chimp:acatgaatgg ATCAAAGC aaatccattt
 Human:acatgaatgg ATCAAAGC aaatccattt

EMSAs were used to determine whether the conserved TCF/LEF sites in E3 and RGSe could bind TCF4. Nuclear extracts were prepared from HEK293 cells that were mock transfected or transfected with a FLAG-tagged TCF4 expression plasmid. Using extracts from TCF4-transfected cells, TCF4 binding could be detected using radiolabeled oligonucleotides containing the conserved TCF sites from E3 and RGSe (Fig. 4A,B, respectively); these complexes were not present in mock-transfected cell extracts. In both cases, oligonucleotides containing a consensus TCF site, as well as unlabeled self-fragments, could effectively compete for TCF4 binding. In contrast, mutant forms of these oligonucleotides could no longer act as cold competitors. The ability of anti-FLAG antibodies to supershift the bands with E3 and RGSe oligonucleotides confirmed the presence of TCF4 in these complexes. When the consensus TCF oligonucleotide was used as a radiolabeled probe, WT E3 and RGSe oligonucleotides could effectively compete for binding, whereas mutant forms of these oligonucleotides could no longer compete (data not shown).

Figure 4.

TCF4 binds TCF sites found in E3 and RGSe. Radiolabeled oligonucleotides corresponding to TCF sites from E3 (A) or GS upstream enhancer (B) were used in EMSAs containing no extract (lane 1) or extracts from HEK293 cells that were mock transfected (lane 2) or transfected with a FLAG-tagged TCF4 expression vector (lanes 3-8). Samples contained no cold competitor (lane 3) or 100-fold excess of cold competitors (oligonucleotides containing the TCF site of E3 [A] or RGSe [B], i.e., WT [self-wt, lane 4] or mutant [self-mt, lane 5] or oligonucleotides containing a consensus TCF site, i.e., WT [Con-wt, lane 6] or mutant [con-mt, lane 7]) or anti-FLAG antibody (lane 8). Bands corresponding to free probe (F.P.) and TCF4-DNA complex (TCF4) are designated. With both probes, the WT versions of the cold competitors could effectively compete for binding to TCF4, whereas the corresponding mutant forms of these oligonucleotides could not compete. The addition of the FLAG antibody resulted in a supershifted complex. Sequences of WT and mutant oligonucleotides are shown in Table 1.

TCF4 regulation of E3 and RGSe was explored further using transient transfections. Both enhancers were linked to pGL3-luciferase and transfected into Hep3B cells, along with WT β-catenin or βcatS37A. Hep3B cells were used because they have low endogenous β-catenin levels. TOP-Flash and FOP-Flash vectors, which contain three copies of consensus or mutated TCF sites, respectively, upstream of the minimal c-fos promoter, were included as controls.17 As expected, TOP-Flash responded to increasing βcatS37A, as determined by normalized luciferase levels, whereas FOP-Flash was unresponsive to cotransfected βcatS37A (Fig. 5). Similar results were observed when WT β-catenin was transfected, although the extent of TOP-Flash activation was less than that observed with βcatS37A (data not shown). Both E3-Luc and RGSe-Luc were activated by βcatS37A (Fig. 5) and, to a lesser extent, by β-catenin (data not shown). Enhancers containing mutated TCF/LEF sites were also assayed for responsiveness to β-catenin. Mutation of the TCF4 site in both enhancers resulted in increased basal activity, compared to WT enhancers, which is likely the result of a release of repression from TCF4-associated corepressors. The mutant E3-Luc reporter gene showed a ∼2-fold induction in response to βcatS37A (Fig. 5) or β-catenin (data not shown); this modest activation was less than the WT enhancer and did not change with increasing amounts of βcatS37A. RGSe-Luc with the mutated TCF4 site showed no responsiveness to βcatS37A or β-catenin (Fig. 5 and data not shown).

Figure 5.

β-catenin activates E3 and RGSe through their conserved TCF sites. Hep3B cells were transfected with luciferase reporter constructs (TOP-Flash, FOP-Flash, and E3-Luc and RGSe-Luc with WT and mutated TCF sites), pcDNA alone (0 μg) or in conjunction with increasing amounts of βcatS37A (0.1 and 1.0 μg), and Renilla luciferase. Cells were harvested after 48 hours, and luciferase levels were determined; firefly luciferase was normalized to Renilla. TOP-Flash, E3-Luc, and RGSe-Luc were activated by βcatS37A in a dose-dependent manner; FOP-Flash and RGSe-Luc with a mutated TCF site did not respond, whereas E3-Luc with a mutated TCF site showed a modest response to βcatS37A. *Significance over cells transfected with pcDNA alone (P < 0.05).

Control of E3 Activity and Endogenous AFP Expression by β-Catenin in Perinatal Livers.

In contrast to the pericentral expression observed in the adult liver, E3-βgl-Dd transgenes are expressed in all hepatocytes in the fetal liver.14 A gradual loss of E3 activity in periportal hepatocytes occurs during the perinatal period, which led us to consider whether E3 activity during this time is also dependent on β-catenin. To test this, we monitored E3-βgl-Dd expression by immunofluorescence at postnatal day 1 (p1) in βCatΔliv mice (Fig. 6A). We chose p1, rather than prenatal time points, becasue Alb-Cre expression begins later during fetal development, and we wanted to allow maximal time for Cre to delete the floxed Ctnnb1 allele.22 In the presence of β-catenin, E3-regulated transgenes are zonally expressed, although activity is not yet fully restricted to a single layer of hepatocytes (Fig. 6A). Similarly to what was observed in the adult liver, E3-βgl-Dd transgenes were not expressed in p1 βCatΔliv livers; the small number of cells that still express Dd likely represents hepatocytes in which the Ctnnb1 gene had not yet been deleted (Fig. 6A). Because endogenous AFP expression in the developing liver requires the AFP-enhancer region,34 we also analyzed hepatic AFP mRNA levels in p1 βCatΔliv mice. Although AFP mRNA levels varied between mice, we found a significant reduction in AFP mRNA levels when β-catenin levels were low (Fig. 6B). These data suggest that β-catenin is required for normal AFP expression in the developing liver.

Figure 6.

β-catenin is required for E3 activity and AFP expression in the perinatal liver. Livers were removed from E3-βgl-Dd at postnatal day 1 (p1) that did (βcatfl) or did not (βcatΔliv) express β-catenin in hepatocytes. (A) p1 livers were cryosectioned and stained with FITC-anti-Dd antibodies. E3-regulated transgenes were expressed in pericentral cells from β-catenin-positive livers, although expression wass not as highly restricted as in adult livers. Transgene expression in βCatΔliv p1 livers was dramatically reduced. Magnification, ×20. (B) Total RNA was prepared from p1 livers from two independent litters and analyzed for β-catenin (left panel) and AFP (right panel) expression (normalized to L30) by real-time reverse-transcription PCR. Levels of both transcripts are significantly reduced in βcatΔliv livers (n = 7), compared to transcript levels in βcatfl livers (n = 5). *Significant difference between βcatfl and βcatΔliv cohorts (P < 0.05).

Discussion

The compartmentalization of function enables the adult liver to carry out a variety of different and, in some cases, opposing functions. Previous studies showed that the β-catenin signaling pathway has an important role in regulating zonally expressed genes in the adult liver, although the mechanism by which β-catenin regulates target genes is not fully understood. Here, we have shown that two defined enhancer elements that exhibit pericentral activity in the adult liver (E3 and RGSe) are regulated by β-catenin. This was accomplished by demonstrating overlapping E3 activity and active β-catenin expression in the adult liver, increased activation of E3-regulated transgenes in βcatS37A-overexpressing livers, and a loss of E3- and RGSe-regulated transgene expression in the absence of β-catenin. Furthermore, we identified evolutionarily conserved TCF/LEF sites in these enhancers that are required for β-catenin responsiveness. We also showed that endogenous AFP expression is reduced in the perinatal liver in the absence of β-catenin, indicating that this pathway also contributes to developmental AFP regulation.

Our data indicate that the canonical pathway involving β-catenin and TCF4 contributes to E3 and RGSe activity in cultured cells. The 340-bp E3 and 400-bp RGSe enhancers were both found to contain a single, highly conserved consensus TCF/LEF site that could bind TCF4. Both enhancers were activated by WT and the constitutively active S37A variant of β-catenin. These data provide strong evidence that the TCF/LEF sites in E3 and RGSe are essential for β-catenin-mediated regulation. When the TCF/LEF sites of E3 and RGSe were mutated, their basal activities increased in the absence of cotransfected β-catenin. Because TCF/LEF factors can bind the Groucho family of corepressors in the absence of β-catenin, it is not surprising that we saw a derepression of enhancer activity when TCF/LEF proteins and associated corepressors could no longer bind their cognate sites. These results raise the question of whether these corepressors also contribute to zonal gene regulation in the adult liver. In this regard, it is interesting that overexpression of the Groucho-related corepressor, Grg3, in H2.35 liver cells reduced endogenous AFP mRNA levels.35 At least one groucho-related protein, Grg5, is expressed in the adult mouse liver.36, 37

Mouse AFP enhancer E3 was originally defined as a 340-bp element by deletion analysis.38 Since then, research has focused on the 5′ end of E3 because it contains three important cis-acting sites in close proximity: one that binds Foxa and hepatocyte nuclear factor (HNF)-6 proteins; a second that binds CCAAT/enhancer-binding protein proteins; and a third site that binds several orphan nuclear receptors, including chicken ovalbumin upstream promoter transcription factors, retinoic-acid-receptor–related orphan receptor alpha, Rev-erbα, and Rev-erbβ.39, 40 In contrast to the 5′ end of E3, the role of the 3′ end has remained elusive. The TCF/LEF site identified here represents the fourth important factor-binding site in E3 and the first functional site in the 3′ end of this enhancer. In contrast to E3, RGSe has not been well characterized. Purification of rat liver nuclear proteins bound to RGSe identified signal transducer and activator of transcription 5 and TCF33; the TCF site identified in this earlier report is the one analyzed here.

Although our studies demonstrate an important role for β-catenin in the zonal activity of E3 and RGSe, they cannot rule out a role for other factors in the pericentral activity of these enhancers. Using Tg mice, we have found that mutating the E3 orphan receptor site resulted in increased E3 activity throughout the adult liver, suggesting that orphan receptors bound to this site might repress E3 activity in nonpericentral hepatocytes (J.E.B., E.L.C., and B.T.S., manuscript in preparation). Consistent with this result, deleting the orphan receptor HNF-4α gene in adult hepatocytes led to elevated expression of GS and other pericentral genes in periportal regions.41 This study, which also identified an HNF-4α site in the mouse GS upstream enhancer, argues that HNF-4α suppresses GS and other pericentral genes in periportal regions. This is consistent with studies in resident liver stemm cell mouse liver cells showing a correlation between HNF-4α expression and a periportal phenotype.42 How orphan receptors contribute to zonal control, and the possible interplay between these factors and β-catenin, will require further investigation.

The ability of β-catenin to control E3 activity raises the question of whether it also regulates AFP expression during liver development and in HCC. When the β-catenin gene was deleted early during hepatogenesis, AFP mRNA levels were reduced 4-fold.43 However, because liver development was severely disrupted in this study, changes in AFP mRNA could not be clearly attributed to direct or indirect effects of the absence of β-catenin. We found that AFP mRNA levels were significantly reduced in p1 livers when Alb-Cre was used to delete the β-catenin gene late during gestation. Because liver development occurs normally in these mice, our data indicate that β-catenin is required for normal developmental AFP expression. Several clinical studies have evaluated β-catenin and AFP levels in human HCC samples and have found no association between elevated AFP and β-catenin.44-46 In contrast, many pericentral genes, including GS, are highly expressed in liver tumors where β-catenin is activated.8, 47 Thus, AFP reactivation during hepatocarcinogenesis is likely the result of mechanisms that do not require β-catenin.

E3 is active in all hepatocytes in the fetal liver, and pericentral expression of E3-regulated transgenes is established during the perinatal period in a periportal-pericentral direction. This developmental transition is similar to what is observed with many pericentral enzymes, including GS, which are also expressed in all hepatocytes throughout the fetal liver. Interestingly, there are parallels between AFP shut-off and the establishment of pericentral gene expression; postnatal AFP silencing occurs in a periportal-pericentral direction, with pericentral hepatocytes being the last cells to express AFP before the gene is completely silenced.48 Our data, indicating that the activity of zonal enhancers in the adult liver and AFP expression in the perinatal liver are both regulated by β-catenin, are consistent with the idea that postnatal AFP silencing and establishment of pericentral gene expression are controlled by similar factors. Future studies on the regulation of well-defined zonally active enhancers will further elucidate this unique aspect of hepatic gene regulation.

Acknowledgements

The authors thank members of the Spear lab, Catherine Mao and Martha Peterson, for their helpful discussions and review of the manuscript for this article and also Dr. Jeffrey Davidson for his assistance with TCF/LEF site alignments.

Ancillary