SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Hepatitis C virus (HCV) infection usually induces chronic hepatic inflammation, which favors the initiation and progression of hepatocellular carcinoma (HCC). Moreover, microRNA-155 (miR-155) plays an important role in regulating both inflammation and tumorigenesis. However, little is known about whether and how miR-155 provides the link between inflammation and cancer. In this study we found that miR-155 levels were markedly increased in patients infected with HCV. MiR-155 transcription was regulated by nuclear factor kappa B (NF-κB), and p300 increased NF-κB-dependent miR-155 expression. The overexpression of miR-155 significantly inhibited hepatocyte apoptosis and promoted cell proliferation, whereas miR-155 inhibition induced G0/G1 arrest. Up-regulated miR-155 resulted in nuclear accumulation of β-catenin and a concomitant increase in cyclin D1, c-myc, and survivin. Gain-of-function and loss-of-function studies demonstrated that miR-155 promoted hepatocyte proliferation and tumorigenesis by increasing Wnt signaling in vitro and in vivo, and DKK1 (Wnt pathway inhibitor) overexpression inhibited the biological role of miR-155 in hepatocytes. Finally, adenomatous polyposis coli (APC), which negatively regulates Wnt signaling, was identified as the direct and functional target of miR-155. Conclusion: HCV-induced miR-155 expression promotes hepatocyte proliferation and tumorigenesis by activating Wnt signaling. The present study provides a better understanding of the relationship between inflammation and tumorigenesis, and thus may be helpful in the development of effective diagnosis and treatment strategies against HCV-HCC. (HEPATOLOGY 2012;56:1631–1640)

Hepatocellular carcinoma (HCC) is one of the most common cancers worldwide, and the incidence is increasing in East Asia and the United States.1, 2 Ninety percent of these tumors result from the biological consequences of persistent viral infection. HCV is a major cause of acute and chronic liver diseases.3 HCV infection usually induces chronic hepatic inflammation, which favors the development of liver cancer.4 However, the molecular mechanisms underlying this process are not well understood.

MicroRNAs (miRNAs) are noncoding RNAs that have been highly conserved during evolution and have emerged recently as potent regulators of gene expression, inflammation, and cancer.5-7 Our previous studies showed that down-regulated miR-152 induced aberrant DNA methylation in HBV-HCC by targeting DNA methyltransferase 1 (DNMT1),8 and that miR-143 enhanced hepatocarcinoma metastasis by repressing fibronectin expression.9 miR-155 has been reported to be substantially up-regulated in some solid tumors, including lung, breast, stomach, and prostate tumors and in HCC.10, 11 miR-155 functions as an oncomiR by targeting the suppressor of the cytokine signaling 1 (SOCS1) gene in breast cancer.12 Specifically, Wang et al.10 showed that up-regulated miR-155 promoted the growth of HCC cells by reducing the expression of CCAAT/enhancer binding protein beta (C/EBPβ). However, these data only demonstrated aberrant expression of miRNAs in tumor cell and the role of “tumor-miRNAs” in regulating cancer cell growth. Little is known about how miRNAs promote cell transformation from a normal cell to a cancerous cell.

Chronic inflammation is a key factor in tumorigenesis.13 Recent studies have also implicated miRNAs in the regulation of inflammation. Baltimore and colleagues14 demonstrated that miR-155 promotes autoimmune inflammation by enhancing inflammatory T-cell development. In addition, these authors found that miR-155 is a common target of a broad range of inflammatory mediators, and speculated about a potential role for miR-155 in linking inflammation and cancer.5

Based on these findings, we tested how miR-155 provides the link between inflammation and tumorigenesis. We demonstrated that HCV infection resulted in nuclear factor kappa B (NF-κB)-dependent up-regulation of miR-155 expression, which promoted tumorigenesis by increasing Wnt signaling. Adenomatous polyposis coli (APC) was identified as the functional target of miR-155.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Cells and Samples.

The study was approved by the Committee for the Protection of Human Subjects and Animal Care Committee at the Second Military Medical University (Shanghai, China). Human hepatic tissues were obtained with informed consent from patients at the Eastern Hepatic Biliary Hospital (Second Military Medical University). Healthy controls (n = 7), patients with nonalcoholic steatohepatitis (NASH, n = 12), patients with chronic HCV infection (n = 34), and patients with HCV-HCC (n = 10) were enrolled in our study. The patients' characteristics are detailed in Supporting Tables 1 and 2. Female athymic nude mice (5 weeks old) were purchased from the Chinese Academy of Sciences (Shanghai, China). Huh7 cells were cultured in minimum essential medium (Gibco, Carlsbad, CA) with 10% fetal bovine serum (FBS; Gibco). Primary hepatocytes were isolated as described by Hengstler et al.15

Reverse-Transcription Reaction and Quantitative Real-Time Polymerase Chain Reaction (PCR).

Total RNA was extracted using Trizol reagent (Invitrogen), and the reverse-transcription reactions were carried out using an M-MLV Reverse Transcriptase kit. The gene-specific stem-loop reverse transcriptase (RT) primers for miR-155 released by the Sanger Institute were designed according to Chen et al.16 RT reactions for target genes were performed by using the Oligo dT primer. Real-time PCR was performed using a standard protocol from the SYBR Green PCR kit (Toyobo, Osaka, Japan) on a Rotor-Gene RG-3000A (Corbett Life Science, Sydney, NSW, Australia). U6 and β-actin were used as references for miR-155 and RNAs, respectively. ΔCt values were normalized to U6 or β-actin levels. Each sample was analyzed in triplicate. Primers are listed in Supporting Table 3.

Cell Transfection and Stimulation.

Recombinant vectors, human miR-155 (UUAAUGCUAAUCGUGAUAGGGGU) or 2′-O-methyl modified miR-155 inhibitor (ACCCCUAUCACGAUUAGCAUUAA) were transfected into hepatocytes and Huh7 cells using jetPEI-Hepatocyte (Polyplus Transfection, Illkirch, France) according to the manufacturer's protocol, and the function was assayed as described.8

HCV-RNA and HCV-ORN were prepared as described.17 Briefly, HCV-RNA was extracted from the Huh7 culture supernatant using the AxyPrep viral RNA miniprep kit (Axygen, USA), concentrated, and quantified using spectrophotography. HCV-ORN (RNA oligonucleotides, CCGGCUGUGUACCUUGUGUC) containing more than 60% G/U within the single-strand RNA (ssRNA) sequence of HCV were identified and synthesized (Genepharma, Shanghai, China).

Western Blot Analysis.

Western blot analysis was performed to assess p300, β-catenin, cyclin D1, c-myc, survivin, GSK3β, Axin, and APC protein expression as described.18 The antibodies for the above-mentioned proteins were purchased from Cell Signaling Technology (Beverly, MA) and Santa Cruz Biotechnology (Santa Cruz, CA).

Measurement of Cell Proliferation.

Primary hepatocytes were seeded in complete medium as described.15 After cell spreading, FBS was removed from the culture medium and proliferation was induced with 50 ng/mL EGF (Sigma, St. Louis, MO). Cell proliferation assays were performed with a Cell Counting Kit-8 (Dojindo, Japan). Cells were plated in 24-well plates in triplicate at ≈1-2 × 105 cells per well and cultured in the growth medium. The cells were then treated with miR-155 mimics, miR-155 inhibitor or recombinant vectors, and the numbers of cells per well were measured by the absorbance (450 nm) of reduced WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-isulfophenyl)-2H-tetrazolium, monosodium salt) at the indicated timepoints.

Flow Cytometric Analysis.

Hepatocytes transfected with miR-155 or its inhibitor (5 × 105 cells) were plated in 6-well plates. After 48 hours of incubation, the cultures were stained with annexin V-fluorescein isothiocyanate and the apoptosis rates were analyzed using a flow cytometer (FACSCalibur; BD Biosciences, Rockville, MD). Flow cytometry was performed and the percentage of cells in G0-G1, S, and G2 phase was determined using CellQuest (BD Biosciences).

Statistical Analysis.

All data are expressed as mean ± standard deviation (SD) from at least three separate experiments. The differences between groups were analyzed using Student's t test. Differences were deemed statistically significant at P < 0.05.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

MiR-155 Levels Were Markedly Increased After HCV Infection.

Previous studies have demonstrated that miR-155 expression levels are up-regulated in many types of human cancers and miR-155 is an oncogenic miRNA, but little is known about whether miR-155 is increased before HCC formation and whether miR-155 plays an important role in linking inflammation and tumorigenesis. In this study, we first assayed miR-155 levels in patients infected with HCV. Figure 1A shows that miR-155 levels were significantly increased in patients infected with HCV compared with healthy control and NASH patients. We then investigated the potential link between miR-155 and HCV. Patients with chronic HCV infection display elevated IP-10 plasma concentrations, which correlate with the degree of liver inflammation.19, 20 In this study a significant positive correlation was observed between IP-10 plasma concentration and circulating miR-155 expression levels before treatment (r2 = 0.3, P = 0.0032, Fig. 1B). Importantly, circulating miR-155 levels were significantly decreased in 12 patients who successfully cleared the virus by treatment with PEGylated interferon-alpha (IFN-α) 2a and ribavirin, whereas a moderate decrease of miR-155 level was found in patients who fail to clear the virus after treatment (Fig. 1C). These data indicate that up-regulated miR-155 levels are related to HCV infection.

thumbnail image

Figure 1. MiR-155 levels were markedly increased in liver tissue of patients infected with HCV compared with healthy control and NASH patients. (A) Total RNA was extracted from tissues and was subjected to real-time PCR analysis. ΔCt values were normalized to U6 levels. Relative expression was calculated with respect to a healthy control tissue. The results were expressed as Log10 (2−ΔΔCt). *P < 0.05. (B) Positive correlation between baseline IP-10 plasma concentrations and the circulating miR-155 expression levels in 30 samples from HCV-infected patients before treatment (r2 = 0.3, P = 0.0032). MiR-155 relative expression was calculated with respect to a HCV-infected specimen. The results were expressed as Log10 (2−ΔΔCt). (C). The analysis of miR-155 expression level was performed in 12 patients who had successfully cleared virus and in 18 patients who failed to clear virus after treatment. Each sample was analyzed in triplicate. The 2−ΔΔCt method was used to quantify the relative gene expression levels.

Download figure to PowerPoint

HCV Infection Induced MiR-155 Expression In Vitro and In Vivo.

We next investigated whether HCV infection increased miR-155 expression. Our previous study showed that HCV-RNA can activate inflammatory responses.17 In this study we further demonstrated that HCV-RNA induced NF-κB activation and miR-155 expression in hepatocytes and Kupffer cells (Fig. 2A,B). To determine whether similar changes in miR-155 levels would also occur in vivo, Balb/C mice were inoculated intraperitoneally with 20 μg of HCV-ORNs.17 A comparative analysis showed that the expression of miR-155 was also up-regulated in hepatocytes after stimulation with HCV-ORNs (Fig. 2C). Similarly, miR-155 expression levels were higher in HCV-transfected Huh7/JFH-1 cells than in Huh7 control cells (Fig. 2D). Sustained activation of NF-κB induced by inflammatory mediators is critical for inflammation-related cancer. We then examined whether miR-155 transcription was regulated by NF-κB. Figure 2E shows that transfection of the NF-κB encoding sequence into Huh7 cells resulted in significantly increased miR-155 levels (Fig. 2E, left), whereas NF-κB inhibitor (PDTC) treatment inhibited miR-155 expression induced by HCV-RNA (Fig. 2E, right). RelA is associated with the p300 transcriptional coactivators, and the overexpression of p300 can enhance NF-κB activation. In previous studies, up-regulated expression of p300 was observed in the majority of HCCs.21 In this study we assayed p300 protein levels in HCV-infected patient samples. We found that p300 protein levels were increased in patients with liver inflammation and that overexpression of p300 contributed to NF-κB-induced miR-155 expression (Fig. 2F). Importantly, PDTC suppressed miR-155 expression in p300/NF-κB-treated Huh7 cells (Fig. 2F, right). These results strongly suggest that miR-155 up-regulation is due to the enhanced transcriptional activity of NF-κB.

thumbnail image

Figure 2. HCV infection induced up-regulation of miR-155 expression in vitro. Hepatocytes (A) or Kupffer cells (B) were treated with HCV-RNA (or TNF-α), and miR-155 expression was analyzed by real-time PCR. Relative miR-155 levels were calculated with respect to the control. *P < 0.05. (C) Hepatocytes were isolated from mice injected with HCV-ORN, and relative miR-155 levels were assessed by real-time PCR and calculated with respect to the control. *P < 0.05. (D) An analysis of miR-155 levels was performed in HCV-transfected Huh7/JFH-1 and in Huh7 control cells. Relative miR-155 levels were calculated with respect to the Huh7 control. *P < 0.05. (E) RT-PCR of miR-155 in Huh7 cells transfected with either Myc-NF-κB or the Myc tag alone (left). Huh7 cells were treated with HCV-RNA and PDTC, and miR-155 expression was analyzed. Relative miR-155 levels were calculated with respect to the PBS control. *P < 0.05 (right). (F) Western blot analysis of p300 in healthy controls and patients with hepatic inflammation (left), and analysis of miR-155 expression levels after p300/CBP or NF-κB overexpression in Huh7 cells (right). *P < 0.05.

Download figure to PowerPoint

MiR-155 Promotes Hepatocyte Proliferation and Inhibits Cell Apoptosis.

To study the role of miR-155 in cell biology, hepatocytes transfected with miR-155 were analyzed. MiR-155 overexpression had no significant effect on cell migration (data not shown). We then evaluated whether miR-155 contributed to cell proliferation. Compared with the miR control, cell proliferation was significantly increased in hepatocytes transfected with miR-155 mimics (Fig. 3A). In addition, miR-155 overexpression inhibited hepatocyte apoptosis compared with the mock or miR control treatments, whereas anti-miR-155 (miR-155 inhibitor) treatment increased hepatocyte apoptosis (Fig. 3B). To further demonstrate the role of miR-155 in cell proliferation, miR-155 was overexpressed or inhibited, and the cell cycle was analyzed by flow cytometry. Figure 3C shows that miR-155 promoted cell proliferation, and that an obvious accumulation of cells in G0/G1 phase was detected after miR-155 inhibition compared with the miR control cells. The quantitative analysis revealed a 20% decrease in the cell population in G0/G1 phase in cells transfected with miR-155 compared with the miR control cells (Fig. 3D). These data suggest that up-regulated miR-155 promotes cell proliferation and reduces apoptosis in hepatocytes.

thumbnail image

Figure 3. MiR-155 promotes hepatocyte proliferation and inhibits cell apoptosis. (A) Overexpression of miR-155 promoted hepatocyte proliferation compared with the miR control. Hepatocytes were transfected with miR-155 mimics (50 mM) or miR control (left), and proliferation was assayed 12, 24, 36, 48, and 72 hours later by using CCK-8 according to the manufacturer's protocol (right). The results show data from at least three independent experiments, expressed as the mean ± SD. *P < 0.05. (B) miR-155 inhibited cells apoptosis. Hepatocytes were treated with miR-155 or its inhibitor. Forty-eight hours later the cultures were stained with annexin V-fluorescein isothiocyanate for fluorescence-activated cell sorting analysis. Profiles are representative of at least three independent experiments. (C) Hepatocytes were treated with miR-155 or its inhibitor. Forty-eight hours later, the relative cell numbers in each cell cycle phase after propidium iodide staining were determined by FACS analysis. The data are from one of three independent experiments. (D) The histograms were analyzed and the percentage of cells in each phase of the cell cycle is shown. The results are presented as mean ± SD for three experiments.

Download figure to PowerPoint

MiR-155 Promotes Cell Proliferation by Activating Wnt Signaling.

The NF-κB, p53, and Wnt pathways are three important signaling factors implicated in the control of cell apoptosis and proliferation.22-24 miR-155 did not affect p53 activation in hepatocytes and Huh7 cells (data not shown). We also investigated whether miR-155 affected NF-κB activity. Our studies showed that a crucial adaptor molecule that links the TRAF molecules to activate TAK1, MAP3K7IP2 (TAB2), is a target of miR-155 in the NF-κB pathway (Supporting Fig. 1A,B). Additionally, SOCS-1 and SHIP-1 are targets of miR-155.25, 26 However, miR-155 did not change the transcription activity of NF-κB in hepatocytes and Huh7 cells (Supporting Fig. 1C).

We then assayed whether miR-155 regulated Wnt signaling activity. To test this hypothesis, hepatocytes were transiently transfected with the Wnt signaling reporter TOPFlash or the negative control FOPFlash, along with miR-155 or miR control. In cells transfected with the miR control, treatment with Wnt3a caused a modest increase in TOPFlash activity. However, Wnt3a increased TOPFlash activity by 2.5-fold in cells treated with miR-155, indicating that Wnt signaling was potentiated (Fig. 4A). In the converse experiment, when hepatocytes were transfected with miR-155 inhibitor, Wnt3a was unable to significantly increase TOPFlash activity (Fig. 4B). Importantly, the inhibition of Wnt signaling by DKK1 overexpression markedly decreased miR-155-induced hepatocyte proliferation (Fig. 4C). DKK1 also reduced miR-155-induced hepatoma cell proliferation (Fig. 4D). We coexpressed miR-155 and DKK1 in hepatocytes and cell apoptosis was analyzed by flow cytometry. Figure 4E shows that coexpression of DKK1 with miR-155 significantly increased cell apoptosis compared with miR-155 treatment alone, although miR-155 inhibited cell apoptosis (Fig. 3B).

thumbnail image

Figure 4. MiR-155 promotes hepatocyte proliferation by activating Wnt signaling. (A) Luciferase activity of TOPFlash/FOPFlash in hepatocytes treated with 50 nM miR-155 mimic and Wnt3a. (B) Luciferase activity of TOPFlash/FOPFlash in hepatocytes treated with 50 nM miR-155 inhibitor and Wnt3a. Inhibition of Wnt signaling by Wnt inhibitor factor 1 (WIF-1) markedly decreased miR-155-induced hepatocyte proliferation (C) or hepatoma cell proliferation (D). These results show data from at least three independent experiments, expressed as the mean ± SD. *P < 0.05. (E) WIF-1 and miR-155 were coexpressed in hepatocytes and the cells were analyzed for apoptosis by flow cytometer 48 hours later.

Download figure to PowerPoint

Nuclear localization of β-catenin is a hallmark of canonical Wnt signaling activation. To further investigate the relationship between miR-155 and Wnt signaling in HCV infection and HCC formation, we analyzed β-catenin nuclear accumulation in healthy control and in patients with HCV infection and HCC. Total β-catenin expression was higher in tissues of hepatic inflammation and HCC compared with healthy controls, and β-catenin in the healthy controls was mainly in the cytoplasmic fraction (Fig. 5A). Figure 5A also shows that little nuclear accumulation of β-catenin was observed in the healthy controls, but nuclear β-catenin was very obvious in the HCV-infected group and HCC group (Fig. 5A). In vitro, miR-155 overexpression also resulted in nuclear localization of β-catenin in Huh7 cells (Fig. 5B). Axin2 is the standard marker to assess β-catenin activation. Real-time PCR analysis showed that Axin2 mRNA levels were significantly increased after miR-155 treatment in Huh7 cells (Fig. 5C). These results demonstrate that miR-155 promotes hepatocyte proliferation by activating Wnt/β-catenin signaling.

thumbnail image

Figure 5. MiR-155 overexpression results in nuclear localization of β-catenin. (A) Western blot analysis of cytoplasmic or nuclear β-catenin in 7 healthy control patients, 10 patients infected with HCV and 10 patients with HCV-HCC. β-Actin and Lamin A were used as internal controls. (B) Western blot analysis of total β-catenin and nuclear β-catenin expression in Huh7 cells treated with miR-155. β-Actin and Lamin A were used as internal controls. (C) Huh7 cells were treated with miR-155 and relative Axin2 mRNA expression was analyzed by real-time PCR. Relative Axin2 levels were calculated with respect to the control. *P < 0.05 versu mock or miR control.

Download figure to PowerPoint

MiR-155 Activates Wnt/β-Catenin Signaling by Inhibiting APC.

miR-155 overexpression increased Wnt/β-catenin transcriptional activity (Fig. 4A) and resulted in the accumulation of β-catenin in the nuclei of hepatocytes (Fig. 5B). Consistent with these observations, the endogenous levels of β-catenin/Tcf4 regulated proteins (cyclin D1, c-Myc, and survivin) were increased after 48 hours of treatment with miR-155 in hepatocytes but not after mock or miR control treatments (Fig. 6A). These three proteins are commonly known to be overexpressed in HCC tissues, and the up-regulation of these proteins contributes to tumorigenesis.27 To further reveal the molecular mechanisms of miR-155-activated Wnt/β-catenin signaling, we assayed the protein expression levels of negatively regulated Wnt/β-catenin signaling. APC, GSK3β, and Axin are three major proteins that negatively regulate Wnt/β-catenin signaling. Figure 6B shows that miR-155 markedly suppressed protein levels of APC but did not affect GSK3β and Axin expression in hepatocytes and Huh7 cells. We constructed luciferase reporter vector containing 3′-untranslated region (UTR) of APC, GSK3β, or Axin (Fig. 6C; Supporting Fig. 1D). The reporter assay showed that miR-155 was able to significantly repress the luciferase expression of pGL3-APC-3′UTR (Fig. 6D, left) and that the mutation of four nucleotides in the miR-155-binding site in APC-3′UTR led to the complete abrogation of the suppressive effect (Fig. 6D, right). Consistent with the above observations, miR-155 did not repress the luciferase expression of pGL3-GSK3β-3′UTR and pGL3-Axin-3′UTR (Fig. 6D). Importantly, a significant negative correlation was also observed between APC mRNA levels and the miR-155 expression levels in vivo (r2 = 0.18, P = 0.0092, Fig. 6E). These data suggest that miR-155 activates Wnt/β-catenin signaling by inhibiting APC.

thumbnail image

Figure 6. MiR-155 activates Wnt/β-catenin signaling by inhibiting APC. (A) Western blot analysis of Wnt/β-catenin signaling target genes (cyclin D1, c-Myc, and survivin) after miR-155 overexpression in hepatocytes. (B) Western blot analysis of Wnt/β-catenin signaling-suppressor genes (APC, GSK3β, and Axin) after miR-155 overexpression in hepatocytes (left) or Huh7 cells (right). β-Actin was used as an internal control. (C) Firefly luciferase reporters that contained ≈300 bp of the 3′-UTR and a 3′-UTR mutation of APC. (D) The 3′UTR reporter assay was carried out in 293 cells that overexpressed miR-155. PGL3-APC-3′UTR, PGL3-GSK3β-3′UTR or PGL3-Axin-3′UTR was cotransfected with pRL-TK using Lipofectamine 2000. Luciferase assays were performed 48 hours after transfection using the Dual-Luciferase Reporter Assay System. Firefly luciferase activity was standardized to the Renilla luciferase control (left). PGL3-APC-3′UTR or its mutation was cotransfected with pRL-TK. Luciferase assays were performed 48 hours after transfection using the Dual-Luciferase Reporter Assay System. Firefly luciferase activity was standardized to the Renilla luciferase control (right). An asterisk indicates a significant difference from the miR control (P < 0.05). (E) Positive correlation between APC mRNA levels and the miR-155 expression levels in 18 samples from patients infected with the HCV (r2 = 0.73, P = 0.0092).

Download figure to PowerPoint

MiR-155 Promotes HCC Tumor Growth by Repressing APC and Activating Wnt/β-Catenin Signaling.

Our data provided direct evidence that miR-155 promotes cell proliferation by repressing APC and activating Wnt/β-catenin signaling. On the basis of the increased effects of miR-155 on the proliferation of hepatoma cells, we investigated the growth of Huh7 clones after injection into athymic mice. Compared with Huh7 control cells, Huh7 cells stably expressing miR-155 contributed to tumor growth in a nude mouse model (Fig. 7A). Most important, forced stable expression of DKK1 in cells stably expressing miR-155 could effectively prevent tumor growth (Fig. 7A). These observations confirm that miR-155 contributes to hepatocyte proliferation and HCC growth by activating Wnt/β-catenin signaling.

thumbnail image

Figure 7. MiR-155 promotes HCC tumor growth by regulating Wnt/β-catenin signaling. (A) Huh7 clones stably transfected with pcDNA-miR155 (Huh7/pc-miR-155) showed significantly increased tumor growth compared with control groups. More important, stable expression of DKK1 in cells stably expressing miR-155 could effectively prevent tumor growth. *P < 0.05. (B) The HCV/NF-κB/miR-155/Wnt regulatory network that regulates the development of HCV-HCC.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

MiR-155 is induced during the macrophage inflammatory response, and chronic inflammation contributes to ≈25% of all cancer cases worldwide.5, 17, 28 Meanwhile, many studies have reported that levels of miR-155 are significantly increased in tumors from Burkitt's lymphoma, lung cancer, and HCC.10, 29, 30 These investigations have demonstrated that miR-155 has a potential role in promoting cell proliferation and tumorigenesis. However, the link between inflammation and cancer and the molecular mechanisms underlying this process are not well understood.

Iliopoulos et al.7 first investigated the role of miRNAs in the link between inflammation and cancer. These authors showed that the STAT3 transcription factor was activated by IL6 and that it contributed to miR-21 and miR-181b-1 expression. MiR-21 and miR-181b-1 inhibited PTEN and CYLD tumor suppressors, respectively, leading to increased NF-κB activity required for maintaining the transformed state. The IL6/STAT3/miR-21/PTEN/NF-κB (or IL6/STAT3/miR-181b/CYLD/NF-κB) regulatory network provides the link between inflammation and cancer. In the present study we found that there is a pathway mediated by NF-κB/miR-155 that promotes HCV-HCC formation. Activation of NF-κB, a hallmark of inflammatory responses, may constitute a missing link between inflammation and cancer by increasing miR-155 expression. A specific complex network, which contains several key molecules, controls the development of HCV-HCC (Fig. 7B). NF-κB/miR-155 is a critical member of this network. NF-κB can be significantly induced by HCV infection and is critically involved in tumor formation as a result of its transcriptional regulation of proliferation-related factors. Importantly, miR-155 expression was increased after NF-κB activation. Up-regulated miR-155 promoted hepatocyte proliferation and HCC formation by activating Wnt/β-catenin signaling in vivo and in vitro. APC, a tumor suppressor gene that inactivates Wnt/β-catenin signaling, was a direct target of miR-155. Thus, the novel HCV/NF-κB/miR-155/Wnt pathway is an important component in the network linking inflammation and cancer. To identify the binding site for the NF-κB transcription factor on miR-155, we performed a computational screen (http://microrna. sanger.ac.uk; http://jaspar.genereg.net), but there are no NF-κB binding sites in the promoter of miR-155/BIC. Therefore, NF-κB may indirectly regulate miR155.

Previous studies have demonstrated that miRNAs play important roles in cancer cell proliferation and cancer progression.8-10 These investigations observed that miRNAs are abnormally expressed in tumor tissues and identified the miRNA-mediated molecular mechanisms controlling cancer cell proliferation. Wang et al.10 showed for the first time that miR-155 expression levels are increased in HCC samples and that up-regulated miR-155 promotes growth of HCC cells by reducing expression of CCAAT/enhancer binding protein beta (C/EBPβ).10 However, miRNA expression changes may occur prior to tumor formation, with abnormal expression of miRNA resulting in cellular transformation. In the present study we found that miR-155 expression levels were up-regulated in HCV-induced liver inflammation and that up-regulated miR-155 promoted hepatocyte proliferation and inhibited cell apoptosis, whereas the inhibition of miR-155 induced G0/G1 arrest. MiR-155 overexpression also resulted in nuclear accumulation of β-catenin and a concomitant increase in cyclin D1, c-myc, and survivin. Gain-of-function and loss-of-function studies demonstrated that miR-155 promoted hepatocyte proliferation and tumorigenesis by increasing Wnt signaling in vitro and in vivo. Additionally, APC, which negatively regulates Wnt signaling, was identified as the direct and functional target of miR-155.

In conclusion, the up-regulated expression of miR-155 induced by inflammation after HCV infection promotes hepatocyte proliferation and tumorigenesis by activating Wnt signaling. The present study provides a better understanding of the relationship between inflammation and tumorigenesis and thus may be helpful in the development of new diagnosis and treatment strategies for HCV-HCC.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

We thank Zhongtian Qi and Ping Zhao for providing the HCVcc and for technical assistance.

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
HEP_25849_sm_SuppFig1.tif2806KSupporting Information Figure 1
HEP_25849_sm_SuppInfo.doc31KSupporting Information
HEP_25849_sm_SuppTab1.doc24KSupporting Information Table 1
HEP_25849_sm_SuppTab2.doc30KSupporting Information Table 2
HEP_25849_sm_SuppTab3.doc24KSupporting Information Table 3

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.