SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. References
  8. Supporting Information

Divalent metal-ion transporter-1 (DMT1) is required for iron uptake by the intestine and developing erythroid cells. DMT1 is also present in the liver, where it has been implicated in the uptake of transferrin-bound iron (TBI) and non-transferrin-bound iron (NTBI), which appears in the plasma during iron overload. To test the hypothesis that DMT1 is required for hepatic iron uptake, we examined mice with the Dmt1 gene selectively inactivated in hepatocytes (Dmt1liv/liv). We found that Dmt1liv/liv mice and controls (Dmt1flox/flox) did not differ in terms of hepatic iron concentrations or other parameters of iron status. To determine whether hepatocyte DMT1 is required for hepatic iron accumulation, we crossed Dmt1liv/liv mice with Hfe/ and hypotransferrinemic (Trfhpx/hpx) mice that develop hepatic iron overload. Double-mutant Hfe/Dmt1liv/liv and Trfhpx/hpx;Dmt1liv/liv mice were found to accumulate similar amounts of hepatic iron as did their respective controls. To directly assess the role of DMT1 in NTBI and TBI uptake, we injected 59Fe-labeled ferric citrate (for NTBI) or 59Fe-transferrin into plasma of Dmt1liv/liv and Dmt1flox/flox mice and measured uptake of 59Fe by the liver. Dmt1liv/liv mice displayed no impairment of hepatic NTBI uptake, but TBI uptake was 40% lower. Hepatic levels of transferrin receptors 1 and 2 and ZRT/IRT-like protein 14, which may also participate in iron uptake, were unaffected in Dmt1liv/liv mice. Additionally, liver iron levels were unaffected in Dmt1liv/liv mice fed an iron-deficient diet. Conclusion: Hepatocyte DMT1 is dispensable for hepatic iron accumulation and NTBI uptake. Although hepatocyte DMT1 is partially required for hepatic TBI uptake, hepatic iron levels were unaffected in Dmt1liv/liv mice, suggesting that this pathway is a minor contributor to the iron economy of the liver. (Hepatology 2013;58:788–798)

Abbreviations
Alb

albumin

cpm

counts per minute

Cre

cre recombinase

DMT1

divalent metal-ion transporter-1

gDNA

genomic DNA

IF

immunofluorescence

IHC

immunohistochemistry

IP

intraperitoneal

IV

intravenously

KO

knockout

mRNA

messenger RNA

NTBI

non-transferrin-bound iron

qRT-PCR

quantitative reverse-transcriptase polymerase chain reaction

SE

standard error

TBI

transferrin-bound iron

TfR

transferrin receptor

ZIP14

ZRT/IRT-like protein 14.

A typical adult male has roughly 4 g of total body iron, including approximately 1 g of iron stores.[1] Approximately 25%-50% of storage iron is found in the liver, mainly in hepatocytes and Kupffer cells. In iron overload disorders, such as HFE-related hereditary hemochromatosis, hepatic iron stores increase over time, with iron depositing predominantly in hepatocytes.[2, 3] Although hepatocytes comprise a major part of the iron storage system, exactly how these cells take up iron, particularly during iron overload, is not well understood. Under normal circumstances, hepatocytes in the liver can acquire iron from the plasma iron-transport protein, transferrin.[4] It is generally assumed that the uptake of transferrin-bound iron (TBI) by the liver involves the transferrin receptor (TfR)1 endocytosis pathway.[5] In this model, transferrin carrying up to two atoms of ferric iron (Fe3+) binds to TfR1 at the hepatocyte cell surface, initiating the internalization of the transferrin/TfR1 complex into endosomes. Subsequent endosomal acidification causes transferrin to release its Fe3+, which is then reduced to Fe2+ and transported into the cytosol by divalent metal-ion transporter-1 (DMT1).

DMT1 was first identified as a transmembrane iron-transport protein by Gunshin et al.[6] in 1997. Iron transport by DMT1 was demonstrated to be maximal at pH 5.5, and its expression was markedly induced in iron-deficient rat duodenum, suggesting that it functions in intestinal iron absorption. A common missense mutation in DMT1 was later found in the mk mouse and Belgrade rat,[7] two animal models characterized by impaired iron absorption, reduced iron assimilation by developing erythroid cells, and anemia. Given that erythroid precursor cells exclusively take up iron from transferrin,[8] it was proposed that DMT1 participates in TBI uptake.[7] Formal proof that DMT1 plays a role in intestinal iron absorption and developing erythroid cells was provided by studies of mice in which DMT1 was inactivated in intestinal epithelial cells (Dmt1int/int) and globally (Dmt1/).[9]

Because DMT1 is also expressed in the liver, it is often cited that DMT1 plays a role in hepatocyte iron metabolism,[5, 10-17] either through the uptake of TBI or non-transferrin-bound iron (NTBI), which appears in plasma during iron overload.[18] However, no studies have directly tested the in vivo role of hepatocyte DMT1 in liver iron metabolism. Therefore, we examined mice with the Dmt1 gene selectively inactivated in hepatocytes (Dmt1liv/liv) and evaluated their hepatic, as well as systemic, iron status. To determine whether DMT1 is required for hepatic iron accumulation during iron overload, we crossed Dmt1liv/liv mice with two genetic models of iron overload: Hfe knockout (KO) (Hfe/) mice[3] and hypotransferrinemic (Trfhpx/hpx) mice.[19] Using Dmt1liv/liv mice, we also directly assessed the requirement for DMT1 in hepatic uptake of TBI and NTBI. Additionally, we examined the effect of iron deficiency on hepatic TBI uptake and iron status in Dmt1liv/liv mice.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. References
  8. Supporting Information
Animals

Hfe/,[20] Dmt1flox/flox, and Dmt1liv/liv mice[9] were on the 129S6/SvEvTac background and Trfhpx/hpx mice were on the BALB/cJ background.[19] Animal protocols were approved by the institutional animal care and use committee at the University of Florida (Gainesville, FL). Mice were weaned at 3 weeks of age and given free access to water and standard diet containing 240 ppm of iron (Teklad 7912; Harlan Laboratories, Indianapolis, IN). To induce iron deficiency, weanling mice were fed a modified AIN-93G purified diet containing 2-6 ppm of iron (Harlan Laboratories) for 3 weeks. Mice were genotyped by extracting genomic DNA (gDNA) from snipped tail samples (DNeasy Blood & Tissue Kit; Qiagen, Valencia, CA) and subjecting it to polymerase chain reaction (PCR) analysis. To identify Dmt1flox/flox mice, we used the following primers: F1: 5'-ATGGGCGAGTTAGAGGCTTT-3' and R1: 5'-CCTGCATGTCAGAACCAATG-3'.[9] Cre-specific primers (forward: 5'-TTACCGGTCGATGCAACGAGT-3'; reverse: 5'- TTCCATGAGTGAACGAACCTGG-3') were used to detect integration of the cre recombinase (Cre) gene into the mouse genome and to identify Dmt1liv/liv mice. Primers F1 and R2: 5'-TTCTCTTGGGACAATCTGGG-3'[9] were used to confirm Cre-mediated excision in the liver. Trfhpx/hpx mice were identified at birth by their pallor and small size and, for survival, were injected intraperitoneally (IP) with human apo-transferrin (EMD Chemicals, Gibbstown, NJ), 0.1 mL of 6 mg/mL at 4 days of age, 0.2 mL in the second week, and 0.3 mL weekly until 14 weeks of age. Dmt1flox/flox and Dmt1liv/liv mice were crossed with Hfe/ and Trfhpx/hpx mice to produce double-mutant strains along with single-mutant strains on the same genetic background.

RNA Extraction and Quantitative Reverse-Transcriptase PCR

Total RNA was isolated from tissues by using RNAzol RT reagent (Molecular Research Center, Cincinnati, OH). Quantitative reverse-transcriptase PCR (qRT-PCR) was used to measure messenger RNA (mRNA) levels, as described previously.[21] Mouse Dmt1 mRNA levels were measured by using forward primer 5'- TCCTCATCACCATCGCAGACACTT -3' and reverse primer 5'- TCCAAACGTGAGGGCCATGATAGT -3', which recognize all four known Dmt1 transcript variants. Dmt1 mRNA levels were normalized to ribosomal protein L13a (Rpl13a) mRNA levels, measured by using forward primer 5'- GCAAGTTCACAGAGGTCCTCAA -3' and reverse primer 5'- GGCATGAGGCAAACAGTCTTTA -3'.

Western Blotting Analysis

Crude membrane fractions were isolated for the measurement of DMT1, TfR1, and TfR2 levels. Liver samples were homogenized by Dounce homogenization in ice-cold HEM buffer (20 mM of HEPES, 1 mM of ethylenediaminetetraacetic acid, and 200 mM of mannitol; pH 7.4) containing 1× cOmplete, Mini Protease Inhibitor Cocktail (Roche, Indianapolis, IN). The homogenate was centrifuged at 10,000×g for 10 minutes at 4°C to remove insoluble cell debris. The supernatant was then centrifuged at 100,000×g for 30 minutes at 4°C to pellet the membranes, which were resuspended in HEM buffer. For measuring ZRT/IRT-like protein 14 (ZIP14) levels, tissue homogenates were used. Western blotting analysis for DMT1, TfR1, and ZIP14 was performed, as described previously.[22] For TfR2, rabbit anti-TfR2 antibody (1:2,500; Santa Cruz Biotechnology, Santa Cruz, CA) was used.

Iron Status Parameters

Hemoglobin, plasma iron, transferrin saturation, and liver iron concentrations were determined as reported previously.[21, 23] Formalin-fixed liver sections were deparaffinized and stained for ferric iron deposits by using Perls' Prussian blue stain.

Measurement of TBI and NTBI Uptake

For TBI uptake, Dmt1liv/liv and Dmt1flox/flox mice were administered 150 µg of 59Fe-transferrin (2 µCi) intravenously (IV). After 2 hours, mice were sacrificed and whole-body counts per minute (cpm) were measured by using a PerkinElmer WIZARD2 gamma counter (PerkinElmer, Inc., Waltham, MA). Immediately thereafter, individual tissues were harvested and cpm were determined. Tissue uptake of 59Fe from transferrin was calculated as a percentage of whole-body cpm. NTBI uptake was determined by using the method of Craven et al.[24] Briefly, mice were administered 70 μg ferric citrate via tail vein injection to transiently saturate plasma transferrin. After 10 minutes, 59Fe-labeled ferric citrate (2 µCi) was administered IV. Two hours later, animals were sacrificed and whole-body and tissue cpm were determined to calculate percentage NTBI uptake.

Statistical Analysis

Data represent means ± standard error (SE). Means were compared by the Student unpaired t test or one-way analysis of variance with Tukey's post-hoc test, as appropriate (GraphPad Prism; GraphPad Software, Inc., La Jolla, CA). A P value < 0.05 was considered statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. References
  8. Supporting Information
Inactivation of Dmt1 Specifically in the Liver

Mice with Dmt1 inactivated specifically in hepatocytes (Dmt1liv/liv) were generated from an intercross of mice harboring a loxP-flanked (floxed) Dmt1 allele (Dmt1flox/flox)[9] and mice expressing an albumin (Alb)-Cre transgene under control of the liver-specific Alb promoter.[25] In the Dmt1flox/flox mice, the loxP recombination sites flanked exons 6-8 of the Dmt1 gene (Fig. 1A).[9] Cre-mediated excision of the loxP-flanked region specifically in the liver was confirmed by using PCR and primers F1, R1, and R2 (Fig. 1A,B). qRT-PCR analysis demonstrated that hepatic Dmt1 mRNA levels at 8 weeks of age were >90% lower in Dmt1liv/liv mice than in Dmt1flox/flox controls (Fig. 1C). By contrast, Dmt1 mRNA levels were unaffected in heart or kidney of Dmt1liv/liv mice, indicating that Dmt1 mRNA levels are not affected in extrahepatic tissues. Western blotting analysis of crude liver membrane detected DMT1 in Dmt1flox/flox mice, but not in Dmt1liv/liv mice (Fig. 1D), thus confirming inactivation of hepatic Dmt1. Similar to previous reports,[9] DMT1 in mouse liver was detected as a diffuse immunoreactive band at ∼70 kDa. Transcript levels of hepatic DMT1 were measured at 3, 4, 8, 12, and 16 weeks of age, and confirmed that liver Dmt1 was inactivated throughout the duration of the studies (data not shown).

image

Figure 1. Disruption of Dmt1 in mouse liver. (A) Schematic depictions of the loxP-flanked (floxed) Dmt1 allele and the allele after Cre recombinase-mediated excision. F1, R1, and R2 indicate forward (F) and reverse (R) primers used for PCR genotyping. Arrowheads denote loxP sites, and shaded boxes indicate exons located between positions 100238637 and 100234237 on chromosome 15. (B) PCR analysis of gDNA extracted from tissues of mice at 8 weeks of age. (C) Relative Dmt1 mRNA levels in liver, heart, and kidney as determined by using qRT-PCR with Rpl13a as an internal control gene. Values represent mean ± SE (n = 3-4): ***P < 0.001. (D) Western blotting analysis of DMT1 in crude membrane fractions isolated from livers of Dmt1flox/flox and Dmt1liv/liv mice. All analyses were performed on samples from 8-week-old mice.

Download figure to PowerPoint

Liver-Specific Inactivation of Dmt1 Has No Effect on Hepatic Iron Levels or Body Iron Status

Compared with Dmt1flox/flox mice, Dmt1liv/liv mice appeared normal and displayed no abnormalities in iron status parameters at 8 weeks of age (Table 1). Hepatic total iron levels as well as nonheme iron levels, an indicator of iron stores, were unaffected by liver-specific inactivation of Dmt1. Body weights, liver weights, and relative liver weights (% body weight) also did not differ between groups (data not shown).

Table 1. Iron Status Parameters of Dmt1flox/flox and Dmt1liv/liv Mice
ParameterUnitDmt1flox/floxDmt1liv/livnP Value
  1. TIBC, total iron-binding capacity. Hepatic iron (heme and non-heme) levels were determined by ICP-MS, and are reported as μg Fe/g of tissue dry weight. Hepatic non-heme iron levels were measured colorimetrically and are reported as μg Fe/g of tissue wet weight. Values are means ± SE. P values were obtained by using Student t test. Measurements were at 8 weeks of age.

Hemoglobing/dL15.30 ± 0.3315.18 ± 0.4760.843
Plasma ironμg/dL270.3 ± 17.72283.5 ± 14.4460.575
TIBCμg/dL372.6 ± 15.01375.0 ± 27.724-50.938
Transferrin saturation%72.36 ± 4.2573.88 ± 3.694-50.802
Hepatic ironμg Fe/g796.7 ± 65.08885.0 ± 12.6630.254
Hepatic non-heme ironμg Fe/g132.1 ± 22.24125.9 ± 26.2460.861
Liver-Specific Inactivation of Dmt1 in Hfe−/− Mice or Trfhpx/hpx Mice Does Not Affect Hepatic Iron Loading or Body Iron Status

To determine whether DMT1 is required for hepatic iron accumulation, we crossed Dmt1liv/liv mice with Hfe/ and Trfhpx/hpx mice to generate double-mutant Hfe/;Dmt1liv/liv and Trfhpx/hpx;Dmt1liv/liv mice, along with their respective controls (Hfe/;Dmt1flox/flox and Trfhpx/hpx;Dmt1flox/flox mice). Hepatic Dmt1 mRNA levels in double-mutant Dmt1liv/liv mice were >90% lower than in the Dmt1flox/flox controls (data not shown). To allow for development of iron overload, double-mutant mice were examined at 16 weeks of age along with sets of single-mutant Dmt1flox/flox and Dmt1liv/liv mice generated on the same genetic background. We found that hepatic nonheme iron concentrations were ∼3-fold higher in Hfe/;Dmt1flox/flox mice than Dmt1flox/flox mice (Fig. 2A). However, hepatic nonheme iron concentrations in Hfe/; Dmt1liv/liv mice did not differ from those in Hfe/;Dmt1flox/flox mice (Fig. 2A), indicating that DMT1 is dispensable for hepatic iron accumulation in Hfe/ mice. Liver-specific inactivation of Dmt1 also had no effect on elevated plasma iron concentrations and transferrin saturations in Hfe/ mice (Fig. 2B,C). Perls' Prussian blue staining of liver sections revealed prominent stainable iron in periportal hepatocytes in Hfe/ mice, but no differences between Hfe/;Dmt1flox/flox and Hfe/;Dmt1liv/liv mice (Fig. 2D). Notable iron staining was also sometimes observed in hepatocytes surrounding the central vein (data not shown), similar to a previous study of Hfe/ mice.[26] These observations indicate that DMT1 is dispensable for iron accumulation in hepatocytes in Hfe/− mice.

image

Figure 2. Hepatic iron accumulation, plasma iron levels, and transferrin saturation are not affected by liver-specific inactivation of Dmt1 in Hfe KO (Hfe/) mice. (A) Hepatic nonheme iron concentrations were determined colorimetrically after acid digestion of tissues. (B) Plasma iron and (C) transferrin saturation were determined by using standard methods. Values represent mean ± SE (n = 6). Means without a common superscript differ significantly (P < 0.05). (D) Histological examination of iron loading in the liver by using Perls' Prussian blue to stain for iron. Branches of the portal vein (P) are indicated. All analyses were performed on samples from 16-week-old mice.

Download figure to PowerPoint

Hypotransferrinemic mice (Trfhpx/hpx) represent a more severe form of iron overload than Hfe/ mice.[19] At 16 weeks of age, hepatic nonheme iron concentrations in Trfhpx/hpx;Dmt1flox/flox mice were ∼11-fold higher than those in control Dmt1flox/flox mice (Fig. 3A) and at least 2 times the level in Hfe/ mice (Fig. 2A). Similar to Hfe/;Dmt1liv/liv mice, inactivation of Dmt1 in Trfhpx/hpx mice had no effect on hepatic nonheme iron accumulation (Fig. 3A) or stainable iron in the liver (Fig. 3D). Hemoglobin and plasma iron levels also did not differ between Trfhpx/hpx; Dmt1liv/liv and Trfhpx/hpx;Dmt1flox/flox mice (Fig. 3B,C).

image

Figure 3. Hepatic iron accumulation, hemoglobin levels, and plasma iron levels are not affected by liver-specific inactivation of Dmt1 in hypotransferrinemic (Trf hpx/hpx) mice. (A) Hepatic non-heme iron concentrations were determined colorimetrically after acid digestion of tissues. (B) Hemoglobin and (C) plasma iron levels were determined by using standard methods. Values represent mean ± SE (n = 6), except for hemoglobin levels in (Trfhpx/hpx) mice (n = 3-4). Means without a common superscript differ significantly (P < 0.05). (D) Histological examination of iron loading in the liver by using Perls' Prussian blue to stain for iron. All analyses were performed on samples from 16-week-old mice.

Download figure to PowerPoint

Effect of Liver-Specific Inactivation of Dmt1 on NTBI and TBI Uptake by the Liver

To determine whether hepatic DMT1 is required for the uptake of NTBI or TBI by the liver, we injected 59Fe-labeled NTBI or 59Fe-transferrin IV into Dmt1liv/liv and Dmt1flox/flox mice and measured 59Fe uptake by the liver 2 hours later. As negative controls, we measured 59Fe uptake by other organs that are known to take up NTBI. Similar to previous studies,[27] NTBI was taken up most avidly by the liver, followed by the kidney, pancreas, and heart (Fig. 4A). However, NTBI uptake by livers of Dmt1liv/liv mice did not differ from that of control Dmt1flox/flox mice, indicating that hepatocyte DMT1 is dispensable for NTBI clearance by the liver. By contrast, uptake of TBI by the liver was 40% lower in Dmt1liv/liv mice, compared with Dmt1flox/flox mice (Fig. 4B), revealing that hepatocyte DMT1 is partially required for hepatic uptake of iron from plasma transferrin. The effect was specific for the liver because TBI uptake was unaffected in kidneys, pancreas, or hearts of Dmt1liv/liv mice. To determine whether lower hepatic TBI uptake by Dmt1liv/liv mice represents a delay in clearance of plasma TBI, which may resolve at a later time, we measured the percentage of 59Fe in plasma 2 and 24 hours after injection. By 2 hours, the percentage of 59Fe in plasma did not differ between Dmt1flox/flox and Dmt1liv/liv mice (P = 0.11) (Fig. 4C), and by 24 hours, very little 59Fe was detectable in plasma. These data indicate that lower hepatic TBI uptake by Dmt1liv/liv mice does not represent a delay in clearance of plasma TBI. The percentage of 59Fe in the blood and spleen also did not differ at either time point, suggesting that iron uptake into developing erythroid cells was unaffected in Dmt1liv/liv mice.

image

Figure 4. Tissue uptake of 59Fe from NTBI or TBI injected into plasma of Dmt1flox/flox and Dmt1liv/liv mice. (A) NTBI uptake by liver (n = 10), kidney (n = 5), pancreas (n = 5), and heart (n = 5). Mice were injected with ferric citrate to transiently saturate plasma transferrin, and then 59Fe-labeled ferric citrate was injected 10 minutes later. After 2 hours, mice were sacrificed and whole-body and tissue 59Fe cpm were measured by gamma counting. Tissue uptake of 59Fe from NTBI was calculated as a percentage of whole-body cpm. (B) TBI uptake by liver (n = 14), kidney (n = 6), pancreas (n = 6), and heart (n = 6). Mice were injected with 59Fe-transferrin and sacrificed after 2 hours. Whole-body and tissue 59Fe cpm were determined by gamma counting. Tissue uptake of 59Fe from TBI was calculated as a percentage of whole-body cpm. (C) Distribution of 59Fe among liver, plasma, blood, and spleen 2 and 24 hours after injecting mice with 59Fe-transferrin (n = 5-6 at each time point). Results are expressed as mean ± SE. All measurements were performed on mice at 7-8 weeks of age.

Download figure to PowerPoint

Effect of Liver-Specific Inactivation of Dmt1 on Levels of Hepatic TfR1, TfR2, and ZIP14

Although lower hepatic TBI uptake in Dmt1liv/liv mice appears to directly result from inactivation of Dmt1, it is possible that it results from a secondary effect on other proteins implicated in TBI uptake. It is equally possible that the lack of an effect of hepatic Dmt1 inactivation on NTBI uptake is the result of compensatory responses in other proteins involved in NTBI uptake. Therefore, we measured levels of TfR1, TfR2, and ZIP14, which may also participate in TBI/NTBI uptake.[28, 29] Western blotting analysis revealed that levels of these proteins did not differ between Dmt1flox/flox and Dmt1liv/liv mice (Fig. 5A-C).

image

Figure 5. Effect of liver-specific inactivation of Dmt1 on hepatic levels of TfR1, TfR2, and ZIP14. (A-C) Western blotting analyses of TfR1, TfR2, and ZIP14 in Dmt1liv/liv mice and controls (Dmt1flox/flox). Blottings were stripped and reprobed for SR-B1 as a lane-loading control. Relative band intensities determined by densitometry and normalized to SR-B1. Values represent mean ± SE (n = 6). All analyses were performed on samples from 8-week-old mice. SR-B1, scavenger receptor class B type 1.

Download figure to PowerPoint

Effect of Liver-Specific Inactivation of Dmt1 On Iron Status and TBI Uptake During Iron Deficiency

To determine whether hepatocyte DMT1 is required to maintain iron status during iron deficiency, we compared iron status parameters of Dmt1flox/flox and Dmt1liv/liv mice that were fed iron-deficient diets. After 3 weeks, mice became iron deficient, as compared to control (Dmt1flox/flox) mice fed a standard diet (Fig. 6A-D). However, no differences were observed between iron-deficient Dmt1flox/flox and Dmt1liv/liv mice. TBI uptake by livers of Dmt1flox/flox mice was higher in iron-deficient animals, compared to controls (36% versus 30%, respectively; P < 0.05) (Fig. 6E). By contrast, TBI uptake by livers of Dmt1liv/liv mice was not higher in iron-deficient animals, compared to controls, suggesting that DMT1 is required for enhanced TBI uptake into an iron-deficient liver.

image

Figure 6. Effect of liver-specific inactivation of Dmt1 on iron status and TBI uptake during iron deficiency. Dmt1flox/flox and Dmt1liv/liv mice were fed an iron-deficient diet for 3 weeks to induce iron deficiency. Control values were obtained from age-matched Dmt1flox/flox mice fed with a standard rodent diet for 3 weeks. Iron status was assessed by measuring (A) hepatic nonheme iron concentrations, (B) plasma iron concentrations, (C) transferrin saturation, and (D) hemoglobin. (E) TBI uptake by the liver in normal and iron-deficient conditions. Mice were injected with 59Fe-transferrin and sacrificed after 2 hours. Whole-body and tissue 59Fe cpm were determined by gamma counting. Tissue uptake of 59Fe from TBI was calculated as a percentage of whole-body cpm. Values represent mean ± SE (n = 3). All analyses were performed on mice at 6 weeks of age.

Download figure to PowerPoint

Localization of DMT1 in Liver

Confocal immunofluorescence (IF) microscopy was used to localize DMT1 in the liver. Human liver was used instead of mouse liver because IF staining of mouse tissue was too weak to allow for reliable localization. In hepatocytes, DMT1 displayed intracellular punctate staining with little, if any, staining of plasma membrane (Supporting Fig. 1).

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. References
  8. Supporting Information

The finding that liver iron levels were unaffected in Dmt1liv/liv mice indicates that hepatocyte DMT1 is dispensable for the overall iron economy of the liver. In addition, the observation that hepatic iron accumulation and deposition of iron in hepatocytes were unaffected in double-mutant Hfe/;Dmt1liv/liv and Trfhpx/hpx;Dmt1liv/liv mice demonstrates that hepatocyte DMT1 is not required for development of hepatic iron overload characteristic of hemochromatosis or hypotransferrinemia. Furthermore, no alterations were found in levels of plasma iron, total iron-binding capacity, transferrin saturation, or hemoglobin in single- or double-mutant Dmt1liv/liv mice, suggesting that inactivation of hepatocyte DMT1 does not affect systemic iron metabolism.

The first clue that DMT1 was dispensable for hepatic iron accumulation was provided by studies of the Dmt1/ mouse, which found that Dmt1/ neonates had 3 times normal liver iron levels.[9] However, this observation was confounded by the fact that the Dmt1/ mice had severe anemia and prominent extramedullary erythropoiesis in the liver. Hepatic iron accumulation in Dmt1/ mice was directly investigated by administering a single IP dose of 5 mg of iron dextran.[9] The iron dextran injection resulted in a large increase in levels of liver iron, in hepatocytes as well as macrophages. Although these observations indicated that an IP injection of a pharmacologic dose of iron (in a nonphysiological form) could load iron into the liver in the absence of DMT1, it is unclear how relevant these data are to usual pathways of hepatic iron uptake and accumulation. Therefore, in the present study, we assessed the role of DMT1 in hepatic iron uptake by IV administering physiologic forms of iron—transferrin or ferric citrate as NTBI18—and by using animal models of human disorders of iron overload.

Similar to HFE-related hemochromatosis patients, Hfe/ mice hyperabsorb dietary iron and deposit the excess in hepatocytes, starting with periportal hepatocytes.[3] Here, we observed a similar pattern of iron deposition in the liver of Hfe/ mice lacking hepatocyte DMT1 (Hfe/;Dmt1liv/liv), indicating that DMT1 is dispensable for hepatocyte iron accumulation in this animal model. Also, similar to hemochromatosis patients, Hfe/ mice have elevated levels of plasma NTBI, even when transferrin is not fully saturated.[12] Most plasma NTBI is rapidly cleared by hepatocytes and is therefore believed to be a significant contributor to hepatic iron deposition.[11, 12] If so, our studies suggest that hepatocyte DMT1 is not required for NTBI uptake because hepatic iron levels were similar in Hfe/ mice with or without hepatocyte DMT1. The likelihood that hepatocyte DMT1 is dispensable for the hepatic uptake of NTBI is strongly supported by our observation that hepatic iron accumulation and iron deposition in hepatocytes were unaffected in Trfhpx/hpx mice lacking hepatocyte DMT1 (Trfhpx/hpx;Dmt1liv/liv mice). As a result of a mutation in the Trf locus, Trfhpx/hpx mice do not express normal transferrin mRNA and therefore have effectively no plasma transferrin.[19] As a consequence, most iron in plasma of Trfhpx/hpx mice is NTBI.

NTBI has been recognized as a contributor to hepatic iron overload for more than 25 years,[24] but the molecular mechanisms involved have proved elusive.[11] A possible role for DMT1 in hepatic NTBI uptake was first proposed in 2000 by Trinder et al.,[17] who found by using immunohistochemistry (IHC) that DMT1 was present on rat hepatocyte plasma membranes and that DMT1 levels were elevated in iron overload. DMT1 levels were also reported to be up-regulated in isolated hepatocytes from Hfe/ mice, which had elevated levels of plasma NTBI.[12] Support for DMT1 in NTBI uptake has been additionally provided by cell-culture studies showing that transfection of hepatoma cells with DMT1 complementary DNA increased DMT1 levels at the plasma membrane and enhanced the uptake of NTBI.[15] Since these initial reports, numerous studies[14, 30, 31] and recent reviews[5, 11, 13] cite DMT1 as the major mediator of hepatic NTBI uptake.

In the present study, we formally tested the hypothesis that hepatocyte DMT1 plays a role in NTBI uptake by measuring the hepatic uptake of radiolabeled NTBI injected into Dmt1liv/liv mice. Our finding that NTBI uptake into the liver was unaffected in Dmt1liv/liv mice provides clear evidence that hepatocyte DMT1 is dispensable for hepatic NTBI uptake; it also demonstrates that at least one alternative hepatic NTBI uptake pathway must exist. Other proteins that have been implicated in NTBI uptake include ZIP14,[28, 32] ZIP8,[33] TfR2,[34] L-type voltage-gated calcium channels,[35] and lipocalin 2.[36] The observation that hepatic levels of ZIP14 and TfR2 were unaffected in Dmt1liv/liv mice suggests that NTBI uptake in the absence of hepatocyte DMT1 does not result from a compensatory up-regulation of either of these proteins.

Although hepatocyte DMT1 is not required for hepatic uptake of NTBI, we found that it is partially required for uptake of TBI, as revealed by the 40% lower TBI uptake by livers in Dmt1liv/liv mice. The diminished TBI uptake likely reflects impaired uptake into hepatocytes, because transferrin iron is taken up nearly exclusively by hepatocytes, rather than other cell types, of the liver.[37] Yet, despite the lower TBI uptake, liver iron concentrations in Dmt1liv/liv mice were not lower than those in control animals. This observation suggests that DMT1-mediated iron uptake from plasma transferrin is not a major contributor to the normal pool of hepatic iron. Ferrokinetic studies of internal iron exchange in the rat have found that approximately 20% of iron from IV injected 59Fe-transferrin was taken up into the liver by 5 hours.[4] Our studies in mice found a similar percentage of iron uptake from transferrin (i.e., approximately 25% by 2 hours postinjection). The apparently minor contribution of DMT1-mediated transferrin-iron uptake to total hepatic iron levels is consistent with the low overall expression level of DMT1 in the liver, compared to other tissues.[6] The expression of TfR1 is also much lower in the liver than in other tissues.[38] Indeed, TfR1 is likely to be a minor contributor as well to hepatic iron levels because TfR1-binding sites on hepatocytes are saturated under normal physiologic concentrations of transferrin[39] and because transferrin iron is well known to be readily taken up by hepatocytes using a TfR1-independent pathway.[40] On the other hand, hepatic DMT1 (and TfR1) would seem to become more important during iron deficiency, when their expression is up-regulated.[22, 41] Consistent with this possibility, hepatic TBI uptake was higher in iron-deficient Dmt1flox/flox mice, compared to controls. A role for DMT1 in this enhanced TBI uptake during iron deficiency is supported by the observation that no such increase in hepatic TBI uptake was observed in iron-deficient Dmt1liv/liv mice. However, the increase in hepatic uptake of TBI during iron deficiency was small (∼6%) in Dmt1flox/flox mice and hepatic nonheme iron concentrations did not differ between iron-deficient Dmt1flox/flox and Dmt1liv/liv mice. Therefore, it appears that DMT1 is not required for the overall economy of the liver, even during iron deficiency.

Studies of DMT1 in the iron-deficient liver are inconsistent. Trinder et al.[17] reported that DMT1 became undetectable in iron-deficient rat liver, whereas we found that DMT1 is markedly up-regulated in iron deficiency.[22] The opposite results may reflect quantitation differences between IHC[17] and western blotting,[22] but this seems unlikely. Trinder et al.[17] also concluded that hepatocyte DMT1 localizes to the plasma membrane, whereas others report a predominantly cytosolic localization.[15, 31] Our IHC results indicate that DMT1 in human liver sections is intracellular and vesicular, and not readily detectable at the plasma membrane. The intracellular distribution of hepatocyte DMT1 suggests that the defect in TBI uptake by Dmt1liv/liv mouse liver is due to the lack of endosomal DMT1.

In conclusion, these studies reveal that hepatocyte DMT1 is not required for the overall iron economy of the liver, hepatic iron accumulation in genetic iron overload, or NTBI uptake by the liver. However, hepatocyte DMT1 does appear to be partially required for the liver to take up TBI. Further research will be needed to identify the molecular mechanisms of hepatic NTBI uptake and how they contribute to hepatic iron accumulation in iron overload disorders.

Acknowledgment

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. References
  8. Supporting Information

The authors are grateful to Dr. Roniel Cabrera (University of Florida School of Medicine, Gainesville, FL) for help with identifying liver structures.

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. References
  8. Supporting Information
  • 1
    Bothwell TH, Charlton RW, Cook JD, Finch CA. Iron Metabolism in Man. Oxford, UK: Blackwell Scientific; 1979:576.
  • 2
    Pietrangelo A. Hereditary hemochromatosis: pathogenesis, diagnosis, and treatment. Gastroenterology 2010;139:393-408.
  • 3
    Zhou XY, Tomatsu S, Fleming RE, Parkkila S, Waheed A, Jiang J, et al. HFE gene knockout produces mouse model of hereditary hemochromatosis. Proc Natl Acad Sci U S A 1998;95:2492-2497.
  • 4
    Cheney BA, Lothe K, Morgan EH, Sood SK, Finch CA. Internal iron exchange in the rat. Am J Physiol 1967;212:376-380.
  • 5
    Graham RM, Chua AC, Herbison CE, Olynyk JK, Trinder D. Liver iron transport. World J Gastroenterol 2007;13:4725-4736.
  • 6
    Gunshin H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 1997;388:482-488.
  • 7
    Fleming MD, Romano MA, Su MA, Garrick LM, Garrick MD, Andrews NC. Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci U S A 1998;95:1148-1153.
  • 8
    Jandl JH, Inman JK, Simmons RL, Allen DW. Transfer of iron from serum iron-binding protein to human reticulocytes. J Clin Invest 1959;38:161-185.
  • 9
    Gunshin H, Fujiwara Y, Custodio AO, Direnzo C, Robine S, Andrews NC. Slc11a2 is required for intestinal iron absorption and erythropoiesis but dispensable in placenta and liver. J Clin Invest 2005;115:1258-1266.
  • 10
    Anderson GJ, Vulpe CD. Mammalian iron transport. Cell Mol Life Sci 2009;66:3241-3261.
  • 11
    Brissot P, Ropert M, Le Lan C, Loreal O. Non-transferrin bound iron: a key role in iron overload and iron toxicity. Biochim Biophys Acta 2012;1820:403-410.
  • 12
    Chua AC, Olynyk JK, Leedman PJ, Trinder D. Nontransferrin-bound iron uptake by hepatocytes is increased in the Hfe knockout mouse model of hereditary hemochromatosis. Blood 2004;104:1519-1525.
  • 13
    Garrick MD, Garrick LM. Cellular iron transport. Biochim Biophys Acta 2009;1790:309-325.
  • 14
    Mackenzie B, Ujwal ML, Chang MH, Romero MF, Hediger MA. Divalent metal-ion transporter DMT1 mediates both H+-coupled Fe2+ transport and uncoupled fluxes. Pflugers Arch 2006;451:544-558.
  • 15
    Shindo M, Torimoto Y, Saito H, Motomura W, Ikuta K, Sato K, et al. Functional role of DMT1 in transferrin-independent iron uptake by human hepatocyte and hepatocellular carcinoma cell, HLF. Hepatol Res 2006;35:152-162.
  • 16
    Sohn YS, Ghoti H, Breuer W, Rachmilewitz E, Attar S, Weiss G, The role of endocytic pathways in cellular uptake of plasma non-transferrin iron. Haematologica 2012;97:670-678.
  • 17
    Trinder D, Oates PS, Thomas C, Sadleir J, Morgan EH. Localisation of divalent metal transporter 1 (DMT1) to the microvillus membrane of rat duodenal enterocytes in iron deficiency, but to hepatocytes in iron overload. Gut 2000;46:270-276.
  • 18
    Grootveld M, Bell JD, Halliwell B, Aruoma OI, Bomford A, Sadler PJ. Non-transferrin-bound iron in plasma or serum from patients with idiopathic hemochromatosis. Characterization by high performance liquid chromatography and nuclear magnetic resonance spectroscopy. J Biol Chem 1989;264:4417-4422.
  • 19
    Trenor CC, 3rd, Campagna DR, Sellers VM, Andrews NC, Fleming MD. The molecular defect in hypotransferrinemic mice. Blood 2000;96:1113-1118.
  • 20
    Levy JE, Montross LK, Cohen DE, Fleming MD, Andrews NC. The C282Y mutation causing hereditary hemochromatosis does not produce a null allele. Blood 1999;94:9-11.
  • 21
    Nam H, Knutson MD. Effect of dietary iron deficiency and overload on the expression of ZIP metal-ion transporters in rat liver. Biometals 2012;25:115-124.
  • 22
    Nam H, Wang CY, Zhang L, Zhang W, Hojyo S, Fukada T, Knutson MD. ZIP14 and DMT1 in the liver, pancreas, and heart are differentially regulated by iron deficiency and overload: implications for tissue iron uptake in iron-related disorders. Haematologica 2013;In Press.
  • 23
    Knutson MD, Walter PB, Ames BN, Viteri FE. Both iron deficiency and daily iron supplements increase lipid peroxidation in rats. J Nutr 2000;130:621-628.
  • 24
    Craven CM, Alexander J, Eldridge M, Kushner JP, Bernstein S, Kaplan J. Tissue distribution and clearance kinetics of non-transferrin-bound iron in the hypotransferrinemic mouse: a rodent model for hemochromatosis. Proc Natl Acad Sci U S A 1987;84:3457-3461.
  • 25
    Postic C, Shiota M, Niswender KD, Jetton TL, Chen Y, Moates JM, et al. Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell-specific gene knock-outs using Cre recombinase. J Biol Chem 1999;274:305-315.
  • 26
    Fleming RE, Holden CC, Tomatsu S, Waheed A, Brunt EM, Britton RS, et al. Mouse strain differences determine severity of iron accumulation in Hfe knockout model of hereditary hemochromatosis. Proc Natl Acad Sci U S A 2001;98:2707-2711.
  • 27
    Bradbury MW, Raja K, Ueda F. Contrasting uptakes of 59Fe into spleen, liver, kidney, and some other soft tissues in normal and hypotransferrinaemic mice. Influence of an antibody against the transferrin receptor. Biochem Pharmacol 1994;47:969-974.
  • 28
    Liuzzi JP, Aydemir F, Nam H, Knutson MD, Cousins RJ. Zip14 (Slc39a14) mediates non-transferrin-bound iron uptake into cells. Proc Natl Acad Sci U S A 2006;103:13612-13617.
  • 29
    Zhao N, Gao J, Enns CA, Knutson MD. ZRT/IRT-like protein 14 (ZIP14) promotes the cellular assimilation of iron from transferrin. J Biol Chem 2010;285:32141-32150.
  • 30
    Bergmann OM, Mathahs MM, Broadhurst KA, Weydert JA, Wilkinson N, Howe JR, et al. Altered expression of iron regulatory genes in cirrhotic human livers: clues to the cause of hemosiderosis? Lab Invest 2008;88:1349-1357.
  • 31
    Bardou-Jacquet E, Island ML, Jouanolle AM, Detivaud L, Fatih N, Ropert M, et al. A novel N491S mutation in the human SLC11A2 gene impairs protein trafficking and in association with the G212V mutation leads to microcytic anemia and liver iron overload. Blood Cells Mol Dis 2011;47:243-248.
  • 32
    Pinilla-Tenas JJ, Sparkman BK, Shawki A, Illing AC, Mitchell CJ, Zhao N, et al. Zip14 is a complex broad-scope metal-ion transporter whose functional properties support roles in the cellular uptake of zinc and nontransferrin-bound iron. Am J Physiol Cell Physiol 2011;301:C862-C871.
  • 33
    Wang CY, Jenkitkasemwong S, Duarte S, Sparkman BK, Shawki A, Mackenzie B, Knutson MD. ZIP8 is an iron and zinc transporter whose cell-surface expression is up-regulated by cellular iron loading. J Biol Chem 2012;287:34032-34043.
  • 34
    Graham RM, Reutens GM, Herbison CE, Delima RD, Chua AC, Olynyk JK, Trinder D. Transferrin receptor 2 mediates uptake of transferrin-bound and non-transferrin-bound iron. J Hepatol 2008;48:327-334.
  • 35
    Otto-Duessel M, Brewer C, Wood JC. Interdependence of cardiac iron and calcium in a murine model of iron overload. Transl Res 2011;157:92-99.
  • 36
    Huang H, Akira S, Santos MM. Is the iron donor lipocalin 2 implicated in the pathophysiology of hereditary hemochromatosis? Hepatology 2009;49:1012-1016.
  • 37
    Morgan EH, Smith GD, Peters TJ. Uptake and subcellular processing of 59Fe-125I-labelled transferrin by rat liver. Biochem J 1986;237:163-173.
  • 38
    Fleming RE, Migas MC, Holden CC, Waheed A, Britton RS, Tomatsu S, et al. Transferrin receptor 2: continued expression in mouse liver in the face of iron overload and in hereditary hemochromatosis. Proc Natl Acad Sci U S A 2000;97:2214-2219.
  • 39
    Trinder D, Morgan E, Baker E. The mechanisms of iron uptake by fetal rat hepatocytes in culture. Hepatology 1986;6:852-858.
  • 40
    Trinder D, Zak O, Aisen P. Transferrin receptor-independent uptake of differic transferrin by human hepatoma cells with antisense inhibition of receptor expression. Hepatology 1996;23:1512-1520.
  • 41
    Masaratana P, Patel N, Latunde-Dada GO, Vaulont S, Simpson RJ, McKie AT. Regulation of iron metabolism in Hamp (−/−) mice in response to iron-deficient diet. Eur J Nutr 2012.

Supporting Information

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. References
  8. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
hep26401-sup-0001-suppfig1.tif3224KFigure S1. Localization of DMT1 in liver. (A) DMT1 immunofluorescence (Alexa Fluor 488, green) and 4',6-diamino-2-phenylindole (DAPI)-stained nuclei (blue) in human liver section. DMT1 was detected by using a rabbit anti-human DMT1 antibody (Prestige Antibodies, HPA032140, Sigma-Aldrich) that was raised against an epitope shared by all known DMT1 isoforms. (B) Human liver section incubated with secondary antibody alone as a negative control. Images were obtained by using an Olympus IX81-DSU spinning disk confocal fluorescent microscope, original magnification × 20.
hep26401-sup-0002-suppinfo.doc37KSupplementary Information

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.