SEARCH

SEARCH BY CITATION

Keywords:

  • TNF;
  • NF-κB;
  • HPV-16 E6;
  • cytochrome c;
  • apoptosis

Abstract

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

In our study, we show that expression of HPV-16 E6 sensitizes TNF-induced cytotoxicity of human ovarian cancer cell line A2780. This effect is not related to a different number of TNF receptors present on cell membrane. The major induction of massive apoptosis induced by TNF is not p53- and p21waf-1-dependent but it is principally related to NF-κB inhibition in A2780/E6 cells. Consistently to NF-κB inhibition a rapidly release of cytochrome c and severe induction of DNA fragmentation are seen in A2780/E6 cells. Also in human colon cancer cell line HCT-116/E6 the expression of HPV-16 E6 enhances TNF-cytotoxicity. This effect is not present in the HCT-116/mu-p53 clone (transfected with a dominant-negative mutated p53 transgene). Thus, taken together all these observations suggest that HPV-16 E6 sensitizes A2780 and HCT-116 cells to TNF; this effect is not p53-dependent, but it is essentially mediated through an inhibition in activating NF-κB activities. © 2001 Wiley-Liss, Inc.

Resistance of tumors cells to antineoplastic drugs is a common clinical problem in human cancer. Chemoresistance may already exist before starting of treatment (i.e., MDR linked to overexpression of PgP protein or to MPR) or may develop in response to chemotherapy (acquired or inducible) by mostly unknown mechanisms.1–3 Biologically, cells die either by apoptosis (programmed cell death) or by necrosis.4–6 Apoptosis seems to be the main mechanism whereby drugs and radiation induce cell death. Among all the known physiological inducers of apoptosis in mammalian cells, TNF is perhaps the most potent and well studied.7 Different cell types respond quite differently to TNF that kills some cells types and induces proliferation of others. Activation of NF-κB-dependent genes regulates the survival and proliferative effects of TNF, whereas activation of caspases regulates the apoptotic effects.7, 8 TNF mediates its signaling through 2 different receptors, referred as p60 and p80.7, 9 The p60 form is expressed on all cell type, whereas the p80 is expressed primarily only on myeloid, lymphoid and endothelial cells.7, 9 These 2 receptors have similar ECD but different ICD. The ICD of the p60 form contains a region called death domain. The DD region is involved in protein-protein interactions upon binding of TNF to the p60 ECD; this interaction leads to activation of caspases.7, 10 During TNF induced apoptosis, caspase-8 is activated early and mediates the release of cytochrome c via the activation of the pro-apoptotic Bcl-2 family member Bid.10 However TNF is a potent inducer of NF-κB, the activation of which has been found to suppress TNF-induced apoptosis,7, 8, 11–15 perhaps through regulation of the expression of many proteins that associate with p60 TNF receptor such as TRAF 1, TRAF 2, cIAP1 and cIAP2. In different cell type, NF-κB transcription factor has a role in regulating the apoptotic program, either as essential for the induction of apoptosis or, more commonly, as blockers of apoptosis. Gene knock-out studies show that p65 (Rel A) NF-κB transactivator deficient mice are embryonic lethal due essentially to severe apoptosis of liver cells.13 However, when such mice are made double knockout by homozygous deletion for the p65 (Rel A) and TNF genes, their embryonic lethal phenotype is reversed.13 Another study showed that suppression of NF-κB in HT1080 fibrosarcoma cells potentiated TNF-induced apoptosis in vitro and tumor regression when tumor cells were transplanted in nude mice.14 These experiments clearly involve NF-κB in the mechanisms of suppression of TNF-induced apoptosis. The antiapoptotic role of NF-κB was also demonstrated from the observation that TNF had no effect (induction of apoptosis and activation of caspase-3) on HuT-78 cells, which constitutively express NF-κB.11 Inhibition of NF-κB as a consequence of the stable expression of a super repressor form of IκBα renders cells more susceptible to TNF-induced killing.15 Finally the E1A protein of adenovirus sensitizes cells to TNF by inhibiting NF-κB.16 Recently Patel et al.17 have reported that HPV16-E6 can inhibit the activation of NF-κB by CBP/p300 binding (NF-κB mediated transcription is co-activated by CBP/p300). The co-activators CBP and p300 bind a large number of cellular proteins, including transcriptional factors involved in growth control and differentiation.17–19 The E6 binding to CBP/p300 is independent of the E6 ability to bind p53.

In our work we examined the effect of HPV-16 E6 expression on apoptosis using the TNF sensitive A2780 human ovarian cancer cell line.20–22 as a model. We found that A2780/E6 cells were more sensitive to and more prone to TNF-induced apoptosis. We investigated the different possibilities that could enhance susceptibility to TNF by E6. Our results indicate that HPV-16 E6-enhanced susceptibility to TNF correlates with inhibition of NF-κB activation. This property is not p53- and p21waf-1-mediated. Our results therefore identify cytochrome c release as an early mediator of TNF-induced apoptosis in A2780/E6 cells.

MATERIAL AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

Cell culture and stable transfection

Human ovarian cancer cell line A2780 was obtained from ATCC (Rockville, MD). A2780 and A2780/E6 monolayers were maintained in RPMI 1640 supplemented with 10% FCS, without antibiotics. A2780/E6 cells were generated as described previously.23, 24 Human colon cancer cell line HCT-116 was grown in RPMI 1640 (Gibco BRL, Grand Island, NY) supplemented with 5% heat inactivated FBS (Gibco BRL, Grand Island, NY) and 2 mM glutamine. Cells transfected with either empty control vector (pCMV) or vector that contained a dominant-negative mutant p53 transgene [248R/W (Mu-p53)] or that contained HPV16-E6 (cloned into a pCMV plasmid) to inhibit p53 function were grown in the same medium. The generation and characterization of the HCT-116 transfectants have been described previously.25–27 Three clones, CMV-2, Mu-p53-2 and CMV-E6-2, were examined. After γ-irradiation only parental and control-transfectant CMV cells but not Mu-p53 or CMV-E6 cells were able to arrest in the G1 phase of the cell cycle and accumulate p53 or p21cyp1-waf-1 proteins. These experiments clearly showed that the functions of p53 in the transfected p53 mutated cells are disrupted. All system was a kind gift of Dr. PM O'Connor (Laboratory Molecular Pharmacology, NCI-NIH, Bethesda, MD).

Drugs

rHuTNF was obtained from KNOLL-BASF (Ludwigshafen, Germany). A stock solution of rHuTNF, containing 0.1 mg/ml of protein was stored at −80°C. Specific activity was 8.74 × 106 U/mg protein [1,000 U/ml ≃ 1.38 ng/ml (48 hr L929 bioassay without Actinomycin D, as determined in KNOLL-BASF Laboratory)].

TNF binding assay

Binding assays were carried out essentially as described previously.9 Briefly tumor cells (0.2 × 106 cells/well) were incubated in 0.5 ml complete medium containing 1 nM [125I]-labeled TNF (DuPont-NEN, Germany, specific activity 50.4 μCi/ml) with or without a 1,000-fold excess of unlabeled TNF at 37°C for 2 hr. To determine the number of receptors per cell, we calculated the amount of radioactivity displaced by cold TNF and determined the number of receptors for each bound TNF trimer. In some experiments cells were incubated with antiTNF receptor antibody (against either p60 or p80) (Bender, Medical System, Vienna, Austria) for 1 hr at 37°C. Thereafter, cells were washed with fresh ice-cold medium, and [125I]-labeled TNF binding examined as described earlier on both A2780 and A2780/E6 cells.

Determination of TNF and IL-6 production

The production of TNF or IL6 (after induction by TNF) was assayed by enzyme-linked immunoadsorbant assay (ELISA). The amount of TNF or IL6 in the culture surnatants collected from all cell lines after 1 day by plating was determined using a TNF or IL6 EIA system (Endogen, Vienna Austria). TNF or IL6 was measured in the range 0.0–2,000 pg/ml, sensibility limit 3 pg/ml.

Cytotoxicity assay and morphological assessment

Drug-induced cytotoxicity was determined by standard MTT assay (continuos exposure for 24 h). 0.5–1.0 × 104 cells/0.15 ml were plated into 96-well flat-bottomed microtiter Nunc plates and allowed to attach for 24 hr at 37°C then the old medium was discarded and replaced with 0.2 ml of fresh medium containing different drug concentrations. Cells were then incubated at 37°C for 24 hr. Cytotoxic effect was monitored with the MTT assay immediately, as described previously.28

The IC50 value represents the 50% inhibitory concentration and was calculated by linear interpolation of the values immediately higher and lower than 50% inhibition.

Morphological assessment was determined by staining the cell with DAPI, 106 cells were seeded on a slide 24 hr before treatment, after 24 hr treatment slides were washed twice in PBS, fixed for 5 min at room temperature in 95% ethanol, air dried and then dipped for 5 min in o 0.1 μg DAPI/ml in a methanol solution. Pictures were taken at ×400 magnification. The number of apoptotic cells was obtained scoring 1,000 cells for each slide.

Flow cytometry

Cells were plated in log phase in T75 flasks (2,700 cells/cm2) in complete medium for 24 hr, then treated with the IC50 or 1,000 U/ml rHuTNF and then counted before flow cytometry. Samples were prepared for flow cytometry essentially as described previously.26 Briefly, cells were washed with 1× PBS, pH 7.4, and then fixed with ice-cold 70% ethanol. Samples were washed with 1× PBS and stained with propidium iodide 60 μg/ml (Sigma Chemical Co., St. Louis, MO) containing RNase 100 μg/ml (Sigma Chemical Co.) for 30 min at 37°C. Cell cycle analysis was performed by using a Becton Dickinson Fluorescence-activated cell analyzer and Cell Quest version 1.2 software (Becton Dickinson Immunocitometry Systems, Mansfield, MA). For each sample at least 15,000 cells were analyzed and quantitation of the cell cycle distribution was performed using the ModFit LT Version 1.01 software (Verity Software House Inc., Topsham, ME).

DNA secondary fragmentation assay

Apoptosis associated DNA fragmentation was analyzed by filter binding assay as described previously.29 A filter-binding assay was performed under non deproteinizing conditions using protein-adsorbing filters (vinyl/acrylic copolymers filters, Metricel membrane, 0.8 μm pore size, 25 mm diameter; Gelman; Sciences) according to Bertrand et al.29 0.5 × 106 prelabeled cells with 0.02 μCi/ml [14C]thymidine were loaded onto PVC filters and washed with 5 ml Hank's balanced salt solution. Cell were then lysed with 5 ml of solution containing 0.2% sodium sarkosyl-2 M NaCl-0.04 M EDTA (pH 10.0). After the lysing solution had dripped through by gravity, it was washed from the filter with 5 ml of 0.02 M EDTA (pH 10.0). Filters were then processed as in the case of alkaline elution.30 Radioactivity was counted by liquid scintillation spectrophotometry in each fraction (loading fraction, wash, lysing solution + EDTA wash, filter). DNA fragmentation (apoptosis) was determined as the fraction of [14C]-labeled DNA in the lysis fraction + EDTA washes relatively to total intracellular [14C]-labeled DNA. Results are expressed as the percentage of DNA fragmented in treated cells compared with DNA fragmented in control untreated cells (background) using the formula:

  • equation image

where F and F0 represent DNA fragmentation in treated and control cells, respectively.

Preparation of mitochondria-free cytosolic extracts and whole cell extracts

Cytosolic extracts were prepared as described previously.31 In brief, A2780 or A2780-E6 cells were harvested by gently scraping and were incubated in a buffer containing 220 nM mannitol and 60 mM sucrose on ice for 30 min. Then cells were broken in a Dounce homogenizer by 70 gentle strokes of a type B pestle. The homogenates were centrifuged at 16,000g for 15 min, and the mitochondria-free supernatants were frozen at −70°C until further analysis. Exstracts of the pellets as well as whole cells extracts were obtained by dissolving in lysis buffer, followed by repetitive vortexing and freeze-thawing. After centrifugation at 16,000g, the supernatants were stored at −70°C.

Protein extraction and Western blot analysis

Attached cells were collected for immunoblot analysis in Hank's balanced salt solution. Proteins were extracted according to Vikhanskaya et al.32 Equivalent cell extracts were electrophoresed on 10% polyacrylamide gels, transferred to nitrocellulose filters (Hybond-ECL, Amersham, UK) and then assessed for p53 or p21waf1 protein levels by immunoblot analysis using anti-p53 (clone 1801, Oncogene Science, Paris, France), or anti plyclonal antibodies against p21waf-1 (Santa Cruz Biotechnology, Santa Cruz, CA). Cytochrome c release was detected using an anti-cytochrome c antibody (7H8.2C12) (PharMingen, San Diego, CA). As a control, immunoblots were reprocessed for expression of actin using specific antibodies (Boeringer, Mannheim, Germany) or for Top II using specific antibodies (AB-1, Oncogene Science, Glostrop, DK). To control for similar protein loading or contamination of cytosolic extracts with mitochondria, the immunoblots were stripped and reprobed with anti-actin antibodies (diluted 1:3,000) or anti-cytochrome c oxidase antibodies (diluted 1:300) (COX Vb, Boeringer, Mannheim-Germany). Immune complexes were detected with the ECL (enhanced chemiluminescence) reagent system (Amersham, Aylesbury, UK) after addition with the appropriate immunoglobulin (IgG).

Gel mobility shift assay

Nucleic extracts were prepared according to Scheiber et al.33 Briefly, 5 × 105 cells were collected, washed in PBS and pelleted. Pellet is resuspended in 400 ml of hypotonic buffer (20 mM HEPES pH=7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT and 0.5 mM PMSF). The cells are allowed to swell on ice for 15 min, after which 25 μL of 18% solution of Nonidet NF-40 is added, and the tubes is vigorously vortexed for 10 sec. The homogenate is centrifuged for 30 sec in a microfuge. The nuclear pellet is resuspended in 50 μL ice-cold buffer (20 mM HEPES pH=7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT and 1 mM PMSF) and the tube is vigorously rocked at 4°C for 15 min. Nucleic extracts are centrifuged for 5 min in a microfuge at 4°C and the surnatant is frozen at aliquots at −70°C; 1–3 mg of each cell treatment were incubated on ice for 30 min in 15 ml of buffer containing 10 mM TRIS pH=7.5, 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 3 μg poly(dI-dC), 2 ml of pab65 (Santa Cruz Biotechnology, INC), or non specific antibodies, 1 ng of 32[ P] end labeled ologonucleotide, part of the enhancer sequence from the HIV LTR region (ENH7 from −115 to −81: GCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCC) was added for another 15 min at room temperature. DNA-protein complexes were separated by electrophoresis through 5% native polyacrilamide gel, dried and visualized.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

Characterization of the human ovarian cancer A2780 isogenic system

Previoulsly, we reported the isolation and characterization of the human isogenic ovarian cell system that consisted of A2780 parental cells and A2780 cells transfected with a DNA encoding for the E6 protein of the human HPV virus under the control of a CMV promoter.23, 24 The HPV16-E6 gene presence in A2780/E6 but not in A2780 cells was confirmed by PCR analysis.24

We have previously demonstrated the inactivation of wt p53 in A2780/E6 by measuring the inability of the clone to induce p53 and p21waf-1 expression after paclitaxel treatment.23 These experiments clearly showed that the functions of p53 in the A2780/E6 cells are impaired by stable transfection.

Expression of HPV-16 E6 sensitizes A2780 cells to TNF-induced cytolisys

As shown in Figure 1, A2780 cells exhibited decreased viability in response to rHuTNF in a dose-dependent manner (IC50 = 180 ± 9.5 U/ml), and the susceptibility to rHuTNF was enhanced in A2780/E6 cells (IC50 = 28.6 ± 1.5 U/ml); however the TNF sensitivity was equal at higher concentrations, 1,000 U/ml were about equal to IC75 in both 2 cell types.

Figure 1. Time-course sensitivity to rHuTNF in A2780 cell line system after 24 hr of treatment. Each point represents the mean ± SE of at least 3 independent experiments performed in duplicate.

Download figure to PowerPoint

thumbnail image

Expression of HPV-16 E6 potentiates A2780 cells to TNF-induced-apoptosis

The evaluation of DNA secondary fragmentation was performed using filter binding assay under non-deproteinizing conditions. This assay allows an accurate and reliable quantitation of DNA fragmentation during apoptosis.29 The method exploits the observation that apoptosis is usually accompanied by DNA fragmentation; this can be quantitated by the passage of radiolabeled double-strand DNA fragments through a filter. High level of radioactivity in the loading fraction in the filter binding assay might be suggestive of necrosis rather than apoptosis,29 since at late stage of necrosis the rupture of nucleus is accompanied by the disintegration of the plasma membrane and the labeled DNA is dispersed in the medium.

As shown in Figure 2, DNA fragmentation was detectable both in A2780 and A2780/E6 cells treated with different concentrations of rHuTNF. In both cells DNA fragmentation appeared after 12 hr of treatment and was maximum after 24 hr. The effect of rHuTNF on DNA integrity was more severe in A2780/E6 cells than in A2780 cells. After 12 hr of treatment, 700 U/ml of rHuTNF induced 50% of DNA fragmentation in A2780/E6, after 24 hr the same effect was induced by 180 U/ml. In A2780 cells, 50% of DNA fragmentation was reached after 24 hr and at high concentration of rHuTNF (1,000 U/ml). However, in both cell lines the DNA fragmentation was ascribed to an apoptotic event rather than through necrosis, since no DNA was present in the loading fraction (Fig. 2).

Figure 2. Induction of DNA secondary fragmentation (apoptosis-related), evaluated by filter binding assay induced by rHuTNF (after 12 and 24 hr). LF: loading fraction. Each point represents the mean ± SE of at least 3 independent experiments performed in duplicate.

Download figure to PowerPoint

thumbnail image

The induction of apoptosis was also assessed by morphological examination (DAPI staining). A2780 cells and A2780/E6 cells were treated with 1,000 U/ml of rHuTNF for 24 hr. As shown in Figure 3 treated A2780/E6 cells exhibited a reduction in cell volume, condensation of nuclear chromatin and nuclear fragmentation in some cells. Minor morphological alterations were observed in treated A2780 cells. Apoptag experiments confirmed these observations (data not shown). Table I substantially confirmed the major induction of apoptosis in A2780/E6 than in A2780 cells.

Figure 3. DAPI staining of A2780 (left side) and A2780/E6 (right side) evaluated after treatment with rHuTNF 1,000 U/ml for 24 hr (bottom).

Download figure to PowerPoint

thumbnail image
Table I. Effect of rHuTNF Treatment (1,000 U/ml for 24 hr) on Apoptosis-Induced in A2780 and A2780/E6 Cells1
 A2780 (% apoptotic cells)A2780/E6 (% apoptotic cells)
  • 1

    Results are the mean ± SE from duplicate experiments performed at least in duplicate. 1,000 cells were scored for each slide.

  • 2

    Statistically significant (p < 0.001) vs. their own control, according to Student's t-test.

  • 3Statistically significant (p < 0.001) versus parental treated cells, according to Student's t-test.

Controls10.1 ± 3.27.1 ± 1.4
TNF37.2 ± 1.8258.1 ± 5.22,3

Expression of HPV-16 E6 does not upregulate cell surface expression of TNF receptors

To determine the receptor number and affinity both A2780 and A2780/E6 cells were subjected to Schatchard analysis of receptor binding characteristics by incubating them with variable amounts of 125[I-labeled] TNF in the absence or presence of a 1,000-fold excess of unlabeled rHuTNF. Table II shows that the number of TNF-R was fairly the same in the 2 cells lines.

Table II. TNF-Receptor Expression on A2780 and on A2780/E6 Cells1
Celln. TNF-R/cellKd
  • 1

    Results are the mean ± SE from duplicate experiments performed at least in duplicate.

A27803,829 ± 4521.19 × 10−10 M
A2780/E64,438 ± 2081.48 × 10−10 M

These results indicated that the more TNF sensitivity observed in A2780/E6 cells are not related to the number of TNF receptors.

Expression of HPV-16 E6 does not upregulate the p60 form of TNF receptors

TNF exerts its effects by binding 2 different TNF receptors with molecular masses of about 60 kDa (p60) and 80 kDa (p80).9 Most cells express both receptors and their relative abundance varies among different cell types. The p60 form of the TNF receptor is more prevalent in epithelial cells. A2780 cells express primarily p60 form of the TNF receptors. Like A2780 cells its variant A2780/E6 also expressed primarily p60 receptors (Fig. 4). No alterations in their amount was observed between the 2 cell types.

Figure 4. Characterization of TNF receptor forms (p60 or p80) in A2780 and A2780/E6 cells.

Download figure to PowerPoint

thumbnail image

Expression of HPV-16 E6 downregulates the secretion of TNF-induced IL-6 proteins

Since it has reported that overexpression of IL-6 in human basal cell carcinoma cell lines increases anti-apoptotic activity,34 the IL-6 secretion was evaluated both in A2780 and A2780/E6 cells. A2780 and A2780/E6 did not secrete endogenous TNF or endogenous IL-6 (detection limit 3.00 pg/ml). After rHuTNF treatment for 24 hr [180 U/ml (IC50) or 1,000 U/ml] A2780 cells secreted high level of IL-6 in a dose-dependent manner (detection limit 3.00 pg/ml). A2780/E6 cells, under the same experimental conditions [28.6 U/ml (IC50) or 1,000 U/ml for 24 hr), have significantly decreased levels of IL-6 secretion when compared with parental cells (Fig 5).

Figure 5. Secretion of IL-6 after treatment with different concentrations of rHuTNF for 24 hr in A2780 and A2780/E6 cells. Each point represents the mean ± SE of at least 3 independent experiments performed in duplicate.

Download figure to PowerPoint

thumbnail image

Sensitization by HPV-16 E6 is p53-independent and cell cycle-independent

The major role of HPV-16 E6 oncoprotein is to promote the degradation of the cellular tumor suppressor p53 and thereby to disrupt the p53-mediated cellular response to DNA damage.35 To further evaluate a possible role of p53 in TNF-induced apoptosis, the effect of TNF on p53 accumulation was examined in A2780 and A2780/E6 cells. As shown in Figure 6a, 24 hr treatment with rHuTNF (1,000 U/ml) induced an increase in the level of p53 in A2780 cells but did not affect its level in A2780/E6 cells. Induction of p53 has been shown to result in transactivation of several genes that participate and coordinate the cell cycle inhibitory activities of p53,4, 5 one of the most important of these is p21waf-1, rHuTNF upregulated the induction of p21 waf-1 in A2780 cells but not in A2780/E6 cells. When both cells were treated with the respective IC50 for 24 hr similar results were obtained (Fig. 6B). Up-regulation of p53 proteins led to G1 or to G2-M phase arrest.4, 5 Figure 7a,b shows that rHuTNF treatment (IC50 or 1,000 U/ml) induced an increase in the G2-M phase of the cell cycle both in A2780 and A2780/E6 cells, suggesting a p53-independent effect.

Figure 6. Level of p53 and p21waf-1 in response to rHuTNF [1,000 U/ml or IC50 for 24 hr] treatment in A2780 and A2780/E6 cell lines. Cells were treated for 24 hr. M, markers. Controls, topoisomerase II and c-myc.

Download figure to PowerPoint

thumbnail image

Figure 7. Analysis of cell cycle perturbation induced by rHuTNF [IC50 (a) or 1,000 U/ml (b)] in A2780 cell line system after 24 hr exposure. Each point represents the mean ± SE of at least 3 independent experiments, performed in duplicate.

Download figure to PowerPoint

thumbnail image

Expression of HPV-16 E6 retards the induction of NF-κB complexes after TNF treatment

The appearance of NF-κB complexes in A2780 and A2780/E6 cells after treatment with TNF were analyzed as a function of time. A specificity of NF-κB complexes bound to a consensus NF-κB binding site oligonucleotide was confirmed with antibodies specific for NF-κB in comparison with unspecific antibodies (lanes 11–14 of Fig. 7). A clear supershift with antibodies p65 in TNF (1,000 U/ml) treated A2780 cells was observed (Fig. 7). NF-κB complexes appeared after 30 min (lane 12, Fig. 7) of TNF treatment and at 6 hr (lane 4) became almost invisible in A2780 cells. At the same time in A2780/E6 cells induction of NF-κB complexes were much slower. At 1 hr (lane 7 of Fig. 7), there were no complexes, which appeared only after 3 hr (lane 8 of Fig. 8) and continuously increased until 6 hr (lane 9 of Fig. 7). This finding indicated that the kinetic of NF-κB induction after TNF treatment in these 2 isogenic cell lines is different. After transfection with HPV16-E6 the formation of NF-κB complexes is going more slowly.

Expression of HPV-16 E6 increased cytochrome c release from mitochondria upon treatment with TNF

To assess whether HPV-16 E6 potentiates TNF apoptosis by inducing the release of cytochrome c from the mitochondrial intermembrane space into the cytosol,36 subcellular fractionation of A2780 and A2780/E6 cells was performed at various time points following TNF treatment (1,000 U/ml). Cytochrome c release into the cytosolic fraction of A2780/E6 treated cells was detected as early as 3 hr after treatment, this corresponded with a depletion of the mitochondria-containing pellet fraction from cytochrome c [completed in 12–24 hr (Fig. 8)]. In A2780 cells, the release of cytochrome c appeared only after 12 hr of TNF treatment and after 48 hr the depletion of the mitochondria-containing pellet fraction from cytochrome c was completed (Fig. 8).

Figure 8. Gel mobility shift analysis of NF-kB complexes. Nucleic extracts of the cells treated with TNF during 0–24 hr were incubated with labeled probe containing a NF-kB site and in indicated lanes (13,14) with designed antibodies. The position of NF-kB complex and free oligo is shown at left. Lanes: 1–5 extracts from A2780 cells (lane 1: control, lane 2: rHuTNF 1,000 U/ml for 1 hr, lane 3: rHuTNF 1,000 U/ml for 3 hr, lane 4: rHuTNF 1,000 U/ml for 6 hr, lane 5: rHuTNF 1,000 U/ml for 24 hr); lanes 6–10 extracts from A2780/E6 cells (lane 6: control, lane 7: treated with rHuTNF 1,000 U/ml for 1 hr, lane 8: rHuTNF 1,000 U/ml for 3 hr, lane 9: rHuTNF 1,000 U/ml for 6 hr, lane 10: rHuTNF 1,000 U/ml for 24 hr); lanes 11–14 extracts from A2780 cells with specific and unspecific antibodies after 30 min of rHuTNF 1,000 U/ml treatment (lane 11: control, lane 12: TNF, lane 13: TNF+a/b p65, lane 14 TNF+a/b nsp).

Download figure to PowerPoint

thumbnail image

TNF-induced cytolisys is p53-independent

To further investigate the role of HPV-16 E6 in TNF-increased susceptibility, some experiments are performed in a second isogenic cell system that consists of the human colon cancer HCT-116 line and 2 transfected clones 1 with a dominant-negative mutated p53 transgene (Mu-p53 clone) and 1 with HPV-16 E6 gene (HCT-116/E6-2 clone) to disrupt p53 function. As shown in Figure 9, HCT-116 cells (CMV-2 clone, transfected with the empty pCMV vector) exhibit decreased viability in response to TNF (rHuTNF) in a dose-dependent manner (IC50 = 320 ± 11.5 U/ml), while the susceptibility to TNF is enhanced in HCT-116/E6-2 clones (IC50 = 48.7 ± 3.2 U/ml). In the Mu-p53-2 clone however the TNF sensitivity is almost equal to parental cell line (IC50 = 270 ± 18.2 U/ml). These data support the hypothesis that the TNF-increased sensitivity is related to the presence of HPV 16 E6.

Figure 9. Cytochrome c release from the mitochondrial intermembrane space to cytosol. A2780 and A2780/E6 cells were treated with rHuTNF (1,000 U/ml) for different times (0, 3, 12, 24 and 48 hr). Cytosolic extracts were obtained as described in Material and Methods. Controls: actin (pellet) and cytochrome c-oxidase (COX Vb) in pellet and cytosol.

Download figure to PowerPoint

thumbnail image

Figure 10. Time-course sensitivity to rHuTNF in HCT-116 cell line system after 24 hr of treatment. Each point represents the mean ± SE of at least 3 independent experiments performed in duplicate.

Download figure to PowerPoint

thumbnail image

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

In our article we show that expression of HPV-16 E6 sensitizes TNF-induced cytotoxicity of human ovarian cancer cell line A2780. This effect is not related to a different number of TNF receptors present on cell membrane. Importantly we demonstrate that the major induction of massive apoptosis induced by TNF is not p53- and p21waf-1-dependent but it is principally related to NF-κB inhibition in A2780/E6 cells. Consistently to NF-κB inhibition, a rapidly release of cytochrome c and severe induction of DNA fragmentation are seen in A2780/E6 cells.

The major role of HPV-16 E6 oncoprotein is to promote the degradation of the cellular tumor suppressor p53 and thereby to disrupt the p53-mediated cellular response to DNA damage.35 Although the major function of E6 protein is to inactivate p53, additional cellular proteins with the potential to interact with the HPV-16 E6 are identified, some of which may be involved in p53-independent functions.35 At this impressive list of interacting cellular proteins, it is possible now to add the transcriptional coactivator CBP/p300.17, 18, 37 The coactivators CBP/p300 are highly conserved proteins that bind a large number of cellular proteins, including transcription factor involved in growth control, differentiation and transcription (i.e., hystone acetylase). In addition, CBP/p300 have intrinsic histon acetyltransferase activity, which is mediated by a region called the HAT domain and is important in acetylating histones and transcription factors such as p53.17, 18 Thus, HPV E6 proteins possess 2 distinct mechanisms by which to abrogate p53 function: the repression of p53 transcriptional activity by targeting p53 coactivator CBP/p300, and the removal of cellular p53 protein through the proteosome degradation pathway. Recent studies show that the CBP/p300 can enhance the transcriptional activity of p6518, 19 In general, the designation NF-κB refers to the most frequently occurring heterodimeric complex between the p50 and p65 subunits. The mammalian NF-κB/Rel family of proteins consists presently of 5 members, namely, Rel (c-Rel), p65 (Rel A), Rel B, p50 (NFKB1) and p52 (NFKB2)8, 12 The interaction between CBP/p300 and NF-κB occurs through multiple domains in both proteins and can be regulated, in part, trough phosphorilation of Rel A by IκB-associated protein Kinase A. In addition, RelA transactivation can also be regulated by the cyclin-dependent kinase inhibitor p21waf-1, a result that correlates with the direct activation of CBP/p300 with specific cyclin-cyclin dependent kinase complexes. This mechanisms imply a subset of conditions where NF-κB activation occurs simultaneously with the induction of p21waf-1. As a consequence p53 could indirectly stimulate NF-κB activity. However, p53 and NF-κB play a divergent role: activation of NF-κB is associated with resistance to apoptosis (promoting cell survival), while p53 plays an important role in cell cycle arrest or apoptosis in response to various type of stress.4, 5, 8, 12 In parental A2780 cell line TNF induce p21waf-1 and consequently activation of NF-κB, while in A2780/E6 cells p21waf-1 is not induced. It is possible to suggest that there might be mechanisms that integrate the activities of these regulators factors. Nuclear competition for CBP provides a new mechanism for altering the balance between the expression of NF-κB-dependent survival genes and p53-dependent genes involved in cell cycle arrest and apoptosis. It is important to note that HPV16-E6 can inhibit the activation of NF-κB17, 37 by CBP/p300 binding and resulting abrogation of the coactivation function.

In our study, we have shown that in the A2780/E6 cells the activation kinetics of NF-κB by TNF is slower than in A2780 cells and, conversely, the release of cytochrome c is faster in A2780/E6 than in A2780 cells. The consequence is a more severe induction of apoptosis induced by TNF in the HPV 16 E6 transfected line.

Interestingly, binding sites for NF-κB are present in various promoters including those for IL-612 Normal cervical cells constitutively secreted interleukins, such as IL-1, IL-6, IL-8 and TNF, however, when immortalized by HPV 16 DNA, the secretion of these cytokines is significantly reduced.38 Also A2780 cells secretes IL-6 after treatment with TNF for 24 hr. A2780/E6 cells do not produce IL-6 both in the presence or in the absence of TNF. Recently it has been reported that overexpression of IL-6 in human basal cell carcinoma cell lines increases anti-apoptotic activity.30

To further study the role of p53, we investigate the response to TNF in a second isogenic cell line system that consists of a human colon cancer HCT-116 cell line. HCT-116 cells were transfected with an empty control pCMV vector (CMV-2 clone), with HPV-16 E6 (CMV-E6-2 clone) or with a dominant-negative mutated p53 transgene (Mu-p53-2 clone) to disrupt p53 function.25–27 Only the E6 clone was more sensitive to TNF than the other 2 clones, suggesting that the observed effect is related to the specific activity of HPV-16 E6. This activity is not related to the ability of HPV16 E6 proteins to remove p53 transcriptional activity through the proteosome degradation pathway.

Thus, taken together all these observations suggest that HPV-16 E6 sensitizes A2780 cells to TNF; this effect is not p53 and p21waf-1 -dependent, but it is essentially mediated through an inhibition in activating NF-κB different activities. In application to clinic our results indicate that tumors expressing HPV-E6 should be sensitive to TNF-treatment.

Acknowledgements

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

The technical assistance of Dr. G. Cimoli and D. Arzani (Laboratory Experimental Oncology, Genova, Italia) in performing some TNF binding assays or in Western blotting experiments was very much appreciated. This work was partially supported by the TENDER number 2000/S 118-076796 “Induction of conformational changes in p53 mutants and modulation of sensitivity to selective anti-cancer drugs,” awarded by European Community, Ispra (Varese), Italy (2001) to PR.

REFERENCES

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES
  • 1
    Borst P, Evers R, Kool M, et al. A family of drug transporters: the multidrug resistance-associated proteins. J Natl Cancer Inst 2000;92: 1295302.
  • 2
    Silverman JA. Multidrug-resistance transporters. Pharmacol Biotechnol 1999;12: 35386.
  • 3
    Larsen AK, Escargueil AE, Skladanowski A. Resistance mechanisms associated with altered intracellular distribution of anticancer agents. Pharmacol Ther 2000;85: 21729.
  • 4
    Schmitt CA, Lowe SW. Apoptosis and therapy. J Pathol 1999;187: 12737.
  • 5
    Blagosklonny MV. Cell death beyond apoptosis. Leukemia 2000;14: 15028.
  • 6
    Foster JR. Cell death and cell proliferation in the control of normal and neoplastic tissue growth. Toxicol Pathol 2000;28: 4416.
  • 7
    Rath PC, Aggarwal BB. TNF-induced signaling in apoptosis. J Clin Immunol 1999;19: 35064.
  • 8
    Mayo MW, Baldwin AS. The transcription factor NF-kappaB: control of oncogenesis and cancer therapy resistance. Biochim Biophys Acta 2000;270: M55M62.
  • 9
    Higuchi M, Aggarwal BB. TNF induces internalization of the p60 receptor and shedding of the p80 receptor. J Immunol 1994;152: 35508.
  • 10
    Gross A, Yin XM, Wang K, et al. Caspase cleaved BID targets mitochondria and is required for cytochrome c release, while BCL-XL prevents this release but not tumor necrosis factor-R1/Fas death. J Biol Chem 1999;274: 115663.
  • 11
    Giri DK, Aggarwal BB. Constitutive activation of NF-kB causes resistance to apoptosis in human cutaneous T cell lymphoma HuT-78 cells. J Biol Chem 1998;273: 1400814.
  • 12
    Barkett M, Gilmore TD. Control of apoptosis by Rel/NF-kB transcription factor. Oncogene 1999;18: 691024.
  • 13
    Doi TS, Marino MW, Takahashi T, et al. Absence of tumor necrosis factor rescues RelA-deficient mice from embryonic lethality. Proc Natl Acad Sci USA 1999;96: 29949.
  • 14
    Wang C-Y, Cusack JC, Liu R, et al. Control of inducible chemoresistance: enhanced anti-tumor therapy through increased apoptosis by inhibition of NF-κB. Nat Med 1999;5: 4127.
  • 15
    Javelaud D, Wietzerbin J, Delattre O, et al. Induction of p21waf1/cip1 by TNFα requires NF-κB activity and antagonizes apoptosis in Ewing tumor cells. Oncogene 2000;19: 618.
  • 16
    Shao R, Hu MC, Zhou BP, et al. E1A sensitizes cells to tumor necrosis factor-induced apoptosis through inhibition of IkappaB kinases and nuclear factor kappaB activities. J Biol Chem 1999;274: 2149598.
  • 17
    Patel D, Huang S-M, Baglia LA, et al. The E6 protein of human papillomavirus type 16 binds to and inhibits co-activation by CBP and p300. EMBO J 1999;18: 506172.
  • 18
    Wadgaonkar R, Phelps KM, Haque Z, et al. CREB-binding protein is a nuclear integrator of nuclear factor-κB and p53 signaling. J Biol Chem 1999;274: 187982.
  • 19
    De Bosscher K, Berghe WV, Vermeulen L, et al. Glucocorticoids repress NF-kBdriven genes by disturbing the interaction of p65 with the basal transcription machinery, irrespective of coactivator levels in the cell. Proc Natl Acad Science USA 2000;97: 391924.
  • 20
    Valenti M, Cimoli G, Parodi S, et al. Potentiation of Tumor Necrosis Factor-mediated cell killing by VP16 on human ovarian cancer cell lines. [“in vitro” results and clinical implications]. Eur J Cancer 1993; 29A: 115761.
  • 21
    Valenti M, Cimoli G, Mariani GL, et al. Potentiation of TNF-mediated cell killing by Mitoxantrone: relationship to DNA single-strand breaks formation. Biochem Pharmacol 1993;46: 1199206.
  • 22
    Debernardis D, Stanzione S, Ottoboni C, et al. Endogenous TNF enhances topoisomerase II inhibitors activity in human ovarian cancer cell lines. J Pharmacol Exp Ther 1996;279: 8490.
  • 23
    Vikhanskaya F, Vignati S, Beccaglia P, et al. Inactivation of p53 in a human ovarian cancer cell line increases the sensitivity to taxol by inducing G2 arrest and apoptosis. Exp Cell Res 1998;241: 96101.
  • 24
    Cimoli C, Valenti M, Ottoboni C, et al. HPV-16-E6 enhances mitoxantrone sensitivity in a human ovarian cancer cell line: an isolated instance or a trend? Int J Oncol 2001;in press.
  • 25
    Fan S, Chang JK, Smith ML, et al. Cell lacking CIP1/WAF1 genes exhibit preferential sensitivity to cisplatin and nitrogen mustrd. Oncogene 1997;14: 212736.
  • 26
    Russo P, Ottoboni C, Crippa A, et al. The non peptidomimetic farnesyltransferase inhibitor RPR-115135 increases cytotoxicity of 5-FU: role of p53. J Pharmacol Exp Ther 2001;in press.
  • 27
    Ottoboni C, Crippa A, Falugi C, et al. Induction of micronuclei by a new nonpeptidic mimetic farnesyltransferase inhibitor RPR-115135: role of gene mutations. Mutagenesis 2001;16: 1. 23–4.30.
  • 28
    Debernardis D, Graniela Sirè E, de Feudis P, et al. p53 status does not affect sensitivity of human ovarian cancer cell lines to Paclitaxel. Cancer Res 1997;57: 87074.
  • 29
    Bertrand R, Pommier Y. Assessment of DNA damage in mammalian cells by filter elution methodology in cell growth and apoptosis: a pratical approach. In: Studzinski GP, ed. Oxford: Oxford University Press, 1996. 97117.
  • 30
    Russo P, Poggi L, Parodi S, et al. Production of protein-associated DNA breaks by 8- methoxycaffeine, caffeine and 8-chlorocaffeine in isolated nuclei from L1210 cells: comparison with those produced by topoisomerase II inhibitors. Carcinogenesis 1991;12: 178190.
  • 31
    Bossy-Wetzel E, Green DR. Assays for cytochrome c release from mitochondria during apoptosis. Methods Enzymol 2000;32: 2357.
  • 32
    Vikhanskaya F, Clerico L, Valenti M, et al. Mechanism of resistance to cisplatin in a human ovarian carcinoma cell line selected for resistance to Doxorubicin. Possible role of p53. Int J Cancer 1997;72: 1559.
  • 33
    Shreiber E, Matthias P, Muller MM, et al. Rapid detection of octamer binding proteins with “mini-extracts”, prepared from a small number of cell. Nucl Acids Res 1989;15: 641921.
  • 34
    Jee S-H, Shen S-H, Chiu H-C, et al. Overexpression of interleukin-6 in human basal cell carcinoma cell lines increases anti-apoptotic activity and tumorigenic potency. Oncogene 2001;20: 198208.
  • 35
    Rapp L, Chen JJ, The papillomavirus E6 proteins. Biochim Biophys Acta 1998;1378: F1F19.
  • 36
    Von Ahsen O, Waterhouse NJ, Kuwana T, et al. The “harmless” release of cytochrome c. Cell Death Diff 2001;7: 11929.
  • 37
    Zimmermann H, Degenkolbe R, Bernard HU, et al. The human papillomavirus type 16 E6 oncoprotein can down-regulate p53 activity by targeting the transcriptional coactivator CBP/p300. J Virol 1999;73: 620919.
  • 38
    Woodworth CD, Simpson S. Comparative lymphokine secretion by cultured normal human cervical keratinocytes, papillomavirus-immortalized, and carcinoma cell lines. Am J Pathol 1993;142: 154455.