SEARCH

SEARCH BY CITATION

Keywords:

  • thyroid cancer;
  • thyroglobulin;
  • adenovirus;
  • suicide gene therapy;
  • histone deacetylase inhibitor

Abstract

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

The successful use of tissue- or tumor-selective promoters in targeted gene therapy for cancer depends on high and selective activity. Tg is a thyroid-specific protein that is expressed in the normal thyroid and a majority of thyroid tumors. In the present study, we show, using a luciferase reporter assay, that a construct containing the putative Tg promoter and enhancer is active in 4 thyroid carcinoma cell lines (including 2 anaplastic thyroid carcinoma cell lines) and not in 5 cancer cell lines arising from nonthyroid tissues. Furthermore, both the activity and the specificity of this construct were increased by pretreatment with 8-Br-cAMP and the histone deacetylase inhibitor depsipeptide (FR901228). Expression of thymidine kinase in thyroid cancer cells infected with a recombinant adenovirus (Ad) carrying a Tg enhancer/promoter-thymidine kinase expression cassette (AdTg enhancer/promoter-TK) correlated with the level of Tg enhancer/promoter activity in these cells. Under similar conditions, TK expression was not observed in cancer cell lines arising from nonthyroid tissues. Cells infected with AdTg enhancer/promoter-TK demonstrated preferential GCV sensitivity, with up to a 100,000-fold increase in GCV sensitivity in thyroid cancer cell lines compared to cancer cell lines of nonthyroid origin. The construct described herein can be used to selectively target thyroid cancer cells, and its expression can be modulated to further increase its specificity and selectivity, especially in anaplastic thyroid carcinoma cells, using 8-Br-cAMP and depsipeptide. Published 2002 Wiley-Liss, Inc.

Thyroid cancer is one of the most common endocrine malignancies.1 In the United States in 1994, newly diagnosed thyroid carcinoma was reported in approximately 13,000 patients.2 The same year, approximately 1,000 patients died of this disease.3 Although papillary (80%) and follicular (11%) histologies account for the majority of thyroid carcinomas, about 2% are histologically undifferentiated or anaplastic.2 Conventional therapy consists of surgical resection and radioiodine (131I) therapy.4, 5 Anaplastic thyroid carcinoma is one of the most lethal neoplasms known,6, 7, 8 with a median survival of about 6 months.9 Palliative or debulking surgery, external radiation and chemotherapy have been tried, with limited success.10, 11, 12, 13, 14, 15 As the mortality data from the literature indicate, there has been little progress in extending the survival of patients with this disease, though some limited successes have been reported with various multimodality regimens.16 Anaplastic thyroid cancer is amenable to the development of gene therapy.

Successful gene therapy requires selectivity. To selectively target tumor cells, promoters that are tumor- (or tissue-) specific have been widely used.17 The Tg promoter has been employed in gene-therapy strategies for thyroid cancer.18, 19 Low expression from the promoters is a problem frequently encountered when a transcriptional targeting approach is used and results in insufficient therapeutic efficacy. In initial studies, we examined the possibility of exploiting expression of the Tg gene in the treatment of thyroid cancer.20 Utilizing follicular and anaplastic thyroid cancer cell lines as in vitro models, we observed that the putative promoter of the Tg gene mediated preferential expression of a firefly luciferase reporter gene in the thyroid cancer cells. In addition, we isolated an enhancer element of the Tg gene and placed it upstream of the Tg promoter. This strategy enhanced the activity and maintained the specificity of the Tg promoter for thyroid cancer cells. Transfectants in which the HSV-TK gene is driven by the Tg enhancer/promoter were significantly more sensitive to GCV than control vector transfectants. Furthermore, this sensitivity was augmented by pretreatment with 8-Br-cAMP in combination with the histone deacetylase inhibitor depsipeptide.

In this report, we describe experiments using an Ad containing the human Tg promoter to target genes to thyroid cancer cells.

MATERIAL AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

Cell lines

We utilized 9 cell lines: 2 follicular thyroid carcinoma lines (FTC 133 and FTC 236), 2 anaplastic thyroid carcinoma lines (KAT-4 and SW-1736), an adrenocortical carcinoma line (H295),21 a colon carcinoma line (SW-620), a renal cell carcinoma line (A498), a breast carcinoma line (MCF-7) and a hepatocarcinoma line (HepG2). FTC 133 and FTC 236 were derived from cultures obtained from the primary tumor (FTC 133) and a nodal metastasis (FTC 236) of a follicular thyroid carcinoma. Anaplastic thyroid carcinoma cell lines were derived from primary cultures of human anaplastic thyroid carcinoma tumors. SW-1736 was provided by Dr. N.-E. Heldin (Uppsala University, Uppsala, Sweden). KAT-4 was developed and maintained in the laboratory of Dr. K. Ain (University of Kentucky, KY). FTC 133, FTC 236, SW-620, KAT-4 and SW-1736 cells were cultured in RPMI-1640 (Biofluids, Rockville, MD) supplemented with 10% FBS. H295 was cultured in RPMI-1640 supplemented with 2% FBS, 10 mM HEPES, 0.1 mg/l insulin and 0.1 mg/l transferrin. A498, MCF-7 and HepG2 were cultured in IMEM (Biofluids) supplemented with 10% FBS. All cell cultures were incubated at 37°C in humidified 5% CO2/95% air.

Construction of reporter plasmids

The vectors used in our study are shown in Figure 1. The putative promoter of the Tg gene22 was isolated by PCR using DNA from FTC 236 cells. Primers used were as follows: 5′ (sense) –530GAGCTCTAAGAGGTTGTTAGAG–508 and 3′ (antisense) +18TTTCCTGGCCCTTCCTGGGAGGAA+41. The amplified fragment was subcloned into the pCRII TA vector (Invitrogen, La Jolla, CA) and its sequence confirmed. After digestion with KpnI and XhoI, the 540 bp promoter fragment was ligated to the pGL3-Basic luciferase vector (Promega, Madison, WI). This construct was designated Tg promoter-Luc.

thumbnail image

Figure 1. Schema showing vectors used in the study. Numbers indicate positions in the sequence of the Tg promoter and enhancer relative to a transcription start site of +1. (a) Plasmid vectors. (b) Recombinant Ad vectors.

Download figure to PowerPoint

The putative enhancer element of the Tg gene23 was amplified using PCR and the following primers: 5′ (sense) CGGGGTACC–2697 GTTCTCACGAGCTCAGTGGAG–2677 and 3′ (antisense) CGGACTAGT–2193CCCATTGCCCTAAAATGCATGC–2214. KpnI (sense) and SpeI (antisense) restriction sites flanked the Tg enhancer sequence. The amplified fragment was inserted into the Tg promoter-Luc plasmid digested with KpnI and SpeI. This construct was designated Tg enhancer/promoter-Luc. In addition, the CMV promoter was excised by digesting pRL-TK (Promega) with HindIII and BglII; this was subcloned into pGL3-Basic and designated CMV-Luc. CMV-Luc was used as the positive control.

Construction of recombinant Ads

Recombinant Ads were constructed using the Adenoquest kit (Quantum, Montreal, Quebec, Canada) according to the manufacturer's protocol. A transfer vector containing the Tg enhancer/promoter and TK cDNA was constructed as follows. First, a BglII-KpnI fragment containing the Tg enhancer/promoter region from the Tg enhancer/promoter-Luc vector was inserted into the pQBI-AdBN transfer vector. Second, a KpnI-NotI fragment containing the HSV-TK coding region from pRL-TK was ligated 3′ of the Tg enhancer/promoter region previously inserted in the pQBI-AdBN vector. ClaI cut genomic Ad DNA (QBI-viral DNA) and Tg-enhancer/promoter-TK in the transfer vector were cotransfected in 293 cells using calcium phosphate. Recombinant Ads, designated AdTg enhancer/promoter-TK produced by homologous recombination, formed plaques. Plaques were isolated and eluted in IMEM containing 5% serum, then grown in 293 cells in 24-well plates. Recombinant plaques were identified using PCR to detect the promoter and enhancer of the Tg gene.

AdCMVTK was constructed as a positive control. A BglII and HindIII cassette of the CMV immediate-early promoter and enhancer from a pcDNA3.1 vector (Invitrogen) was ligated into the corresponding sites of the pQBI-AdBN transfer vector, and AdCMVTK was obtained using the same procedure as described above. AdNull, which contains no insert, was also constructed as a negative control.

Viral stocks generated by infecting 293 cells were negative for the E1a gene using PCR and E1a-specific primers. Viral stocks were purified using CsCl gradient centrifugation, followed by dialysis against 10 mM TRIS (pH 7.4), 1 mM MgCl2 and 10% glycerol buffer for 24 hr at 4°C. Titration was determined using the tissue culture ID50 method.

Transfection and luciferase assays

Transient transfections used a liposome-mediated method. For all cell lines, 3 × 104 cells were plated in a 6-well dish for 24 hr prior to transfection. Plasmid DNA (0.5 μg) and TransFast (4.5 μl, Promega) mixed with 200 μl of medium were added to each well. After incubating 1 hr in the above mixtures, cells were cultured in the presence or absence of various agents for 2 days. The agents used and their concentrations were as follows: 8-Br-cAMP, 0.3 mM; depsipeptide (FR901228, NSC630176), 1 ng/ml. After harvesting, total protein concentration was measured using the Bio-Rad (Richmond, CA) Protein Assay. Firefly luciferase activity was assessed using the Luciferase Assay System (Promega), with all results normalized to protein content. All transfections were performed in triplicate. In all experiments, CMV-Luc and pGL3-Basic were used as positive and negative controls, respectively. The result with the CMV-Luc vector was assigned a value of 100%, and all other values were expressed relative to this as relative luciferase units.

Immunoblot analysis

Subconfluent cells in 6-well plates were infected with recombinant Ad at 30 pfu/cell in serum-free medium for 2 hr, followed by incubation in regular medium with serum for 2 days in the absence or presence of 0.3 mM 8-Br-cAMP and 1 ng/ml depsipeptide. Cells were then scraped into cell lysis buffer containing 10 mM TRIS (pH 7.4), 150 mM NaCl, 1% NP40, 1 mM EDTA, 20 μg/ml aprotinin and 100 μg protein and separated on a 10% SDS-PAGE gel. Electroblotting to Immobilon P transfer membrane (Millipore, Bedford, MA) was performed, and nonspecific protein binding was blocked using 10% milk in TNE buffer [2 mM TRIS (pH 7.4), 2 mM NaCl, 1 mM EDTA, 0.15% Tween-20] for 1 hr. The membrane was incubated for 1 hr with a rabbit polyclonal antibody for HSV-TK (provided by Dr. W.C. Summers, Yale University, New Haven, CT), diluted 1:1,000 in 5% milk and 0.02% sodium azide in TNE. After washing, antirabbit Ig horseradish peroxidase–linked secondary antibody (Amersham, Arlington Heights, IL) was added for 1 hr. After washing, the membrane was developed using enhanced chemiluminescence Western blotting detection reagents (Amersham).

Cell viability

The MTT assay was performed to determine sensitivity to GCV. Cells in 6-well plates were maintained in the presence or absence of 0.3 mM 8-Br-cAMP and 1 ng/ml depsipeptide for 2 days, then infected with either AdNull, AdCMVTK or Ad Tg-enhancer/promoter-TK at 5 pfu/cell for 2 hr in serum free medium followed by incubation in medium containing serum overnight. Infected cells were seeded in 96-well plates (6,000 cells/well) and incubated in various concentrations of GCV for 5 days. Cells were estimated in a colorimetric assay, which measures the formazan reduction product of MTT, produced by the mitochondrial activity of viable cells. The reduction product was dissolved in DMSO and absorbance quantitated using a plate reader spectrophotometer.

Quantitative PCR amplification of TTF-1, Pax-8 and Tg

Quantitative RT-PCR for TTF-1 and Pax-8 was performed as previously described.24, 25 Total RNA was extracted using RNA STAT-60 (Tel-Test, Friendswood, TX). Single-stranded oligo(dT)-primed cDNA was generated using MMLV reverse transcriptase (Life Technologies, Eggenstein, Germany).

Oligonucleotide primers for human TTF-1 and Pax-8 mRNA amplification were as follows: TTF-1 5′ (sense) 1ATGTCGATGAGTCCAAAGCACA22 and TTF-1 3′ (antisense) 518ACCTGCGCCTGCGAGAAGAGCA497, Pax-8 5′ (sense) 277GGGGACTACAAACGCCAGAAC297 and Pax-8 3′ (antisense) 982CGGAGCTAGATAAAGAGGAAG.962

The expected human TTF-1 product from a cDNA template is 519 bp, and the Pax-8 product is 705 bp. The amplification reaction was carried out for 30 cycles. Each cycle consisted of 94°C for 20 sec, 64°C for 30 sec and 72°C for 60 sec. The last cycle was followed by a final 10 min elongation at 72°C. All quantitations were performed by densitometry. Quantitations were based on measured β-actin levels. Oligonucleotide primers for human β-actin RNA amplification were as follows: β-actin 5′ (sense) 207TGGGCATGGGTCAGAAGGAT226 and β-actin 3′ (antisense) 507GAGGCGTACAGGGATAGCAC488.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

To investigate the specificity and strength of the transcriptional activity of the Tg enhancer/promoter sequence as well as the ability to modulate its expression using various agents, luciferase assays were performed. Figure 2 shows the luciferase activity of the Tg enhancer/promoter-Luc vector in a panel of 9 cell lines. In the absence of 8-Br-cAMP or depsipeptide, luciferase activities approximately 0.5–3% that of the CMV promoter luc construct were observed in all cell lines. Treatment with 0.3 mM 8-Br-cAMP and 1 ng/ml of depsipeptide had no or very little effect on the 5 cell lines not of thyroid origin. However, these agents had a marked effect on the 4 thyroid carcinoma cell lines, increasing luciferase activities to values that were 26.5–80.5% that of the CMV promoter luciferase construct. Previously, 0.3 mM 8-Br-cAMP was shown to be an optimal concentration,26 while 1 ng/ml depsipeptide was chosen as a concentration that was not cytotoxic.20, 27 Thus, the luciferase activity of the Tg enhancer/promoter-Luc construct was higher in the 4 thyroid cancer cell lines than in the 5 nonthyroid cancer cell lines, and this preference was increased further by treatment with 8-Br-cAMP and depsipeptide.

thumbnail image

Figure 2. Luciferase activity in 9 different cancer cell lines after transient transfection. All cancer cell lines transfected with the Tg enhancer/promoter-Luc construct were incubated for 48 hr in the absence or presence of 0.3 mM 8-Br-cAMP and 1 ng/ml depsipeptide. The level of luciferase activity is shown relative to the luciferase activity in cells transfected with CMV-Luc. All cell lines were transfected with CMV-Luc as the control, and activity is shown as the percentage of CMV-Luc. Means were calculated after normalization to protein.

Download figure to PowerPoint

With the ultimate goal of generating a clinically useful reagent, the putative Tg enhancer and promoter was cloned into an Ad vector proximal to the HSV-TK gene. Following its isolation and titration, infections were performed using the same panel of cell lines used in the previous experiments. Figure 3 presents an immunoblot examining HSV-TK expression following Ad infection in the 4 thyroid cancer cell lines and the 5 additional cell lines of diverse origin. All cell lines were infected with the negative control AdNull, the positive control AdCMVTK and AdTg enhancer/promoter-TK. Expression of HSV-TK was not detected in all noninfected cells or cells infected with AdNull. In contrast, AdCMVTK infection resulted in high levels of expression of HSV-TK in all cell lines. However, following infection with AdTg enhancer/promoter-TK, expression of HSV-TK was observed only in the 4 thyroid cancer cell lines, with no detectable expression in the 5 other cell lines. Furthermore, in the 2 anaplastic thyroid cancer cell lines, KAT-4 and SW-1736, expression of HSV-TK protein could be further induced by 8-Br-cAMP in combination with depsipeptide.

thumbnail image

Figure 3. Expression of HSV-TK protein in 9 different cancer cell lines. Cells plated in 6-well plates were infected with either AdNull (negative control), AdCMVTK (positive control) or AdTg enhancer/promoter-TK with 30 pfu/cell in serum-free medium for 2 hr.

Download figure to PowerPoint

To further evaluate the selectivity of the Ad constructs and to assess their potential utility as suicide vectors, we compared the effect of the various Ad constructs on the GCV sensitivity of the 4 thyroid cancer cell lines and the 5 other cell lines not of thyroid origin (Fig. 4, Table I). In all cell lines, sensitivity to GCV was not affected by infection with AdNull compared to noninfected cells (only AdNull data shown), while infection with AdCMVTK resulted in marked GCV sensitivity. When the cell lines were infected with 3 pfu/cell Ad Tg-enhancer/promoter-TK, sensitivity to GCV was not increased in the nonthyroid cancer cell lines, in contrast to the thyroid cancer cell lines, in which the IC50 for GCV was reduced to values as low as 0.01–9.77 μM. Consistent with the observations made by immunoblot, maximum sensitivity to GCV was achieved in follicular cancer cells even in the absence of other agents, while greater cytotoxicity was obtained in anaplastic cancer cells treated with depsipeptide plus 8-Br-cAMP. With this combination, sensitization as high as 100-fold could be achieved in the anaplastic thyroid cancer cell lines KAT-4 and SW-1736 compared to the Ad results without these agents. Overall, in the 4 thyroid cancer cell lines, GCV sensitivity was increased as much as 100,000-fold when cells were infected with Ad Tg-enhancer/promoter-TK. To evaluate the infection efficiency, a recombinant virus containing the lacZ gene under the control of the CMV promoter was used. Using this Ad (300 pfu/cell), lacZ gene expression was detected in fewer than 30% of cells in the 4 thyroid cancer cell lines (FTC 236, 28.5%; FTC 133, 28.1%; KAT-4, 22.3%; SW-1736, 18.8%). However, nearly 100% growth inhibition was observed in all thyroid cancer cell lines infected with the Ad Tg-enhancer/promoter-TK construct. Nearly complete growth inhibition, exceeding the infection efficiency, was observed in follicular cells infected with the Ad Tg-enhancer/promoter-TK alone, while in the 2 anaplastic thyroid cell lines (KAT-4 and SW-1736) nearly complete growth inhibition was observed after infection with the Ad Tg-enhancer/promoter-TK construct and treatment with depsipeptide in combination with 8-Br-cAMP. This latter observation is consistent with the immunoblot observation demonstrating enhanced TK expression in anaplastic thyroid carcinoma cells treated with 8-Br-cAMP and depsipeptide.

thumbnail image

Figure 4. Sensitivity to GCV of infected cells. Cells plated in 6-well plates were infected with either AdNull (negative control), AdCMVTK (positive control) or AdTg enhancer/promoter-TK at 5 pfu/cell for 2 hr in serum-free medium, followed by incubation in medium containing serum overnight. Infected cells were then exposed to a range of GCV concentrations in 96-well plates for 4 days, after which time MTT assays were performed. Points represent means of triplicate determinations, and bars are SDs.

Download figure to PowerPoint

Table I. IC50 values of GCV in Ad-TK–infected cells
 AdNullAdCMV-TKAdTg-enhancer/promoter-TKAdTg-enhancer/promoter-TK (+ 8-Br-cAMP + depsipeptide)
  1. IC50 values (μM) for GCV of Ad-infected cells. Growth inhibition was determined by MTT assay. Values are means of triplicate experiments.

FTC 236>1,0000.01 ± 0.0040.01 ± 0.0060.01 ± 0.011
FTC 133>1,0000.05 ± 0.0240.09 ± 0.0160.04 ± 0.002
KAT-4>1,0000.08 ± 0.0119.77 ± 0.980.06 ± 0.006
SW-1736>1,0000.03 ± 0.0521.11 ± 0.0490.09 ± 0.003
MCF-7>1,0000.02 ± 0.001>1,000>1,000
HepG2>1,0000.07 ± 0.036>1,000>1,000
H295>1,0000.08 ± 0.013>1,000>1,000
A498>1,0000.05 ± 0.011>1,000>1,000
SW-620>1,0000.03 ± 0.016>1,000>1,000

Finally we investigated the expression of 2 putative thyroid-specific transcription factors that might modulate the expression of the Ad vectors utilized. Figure 5 shows the results of RT-PCR analysis examining the expression of TTF-1 and Pax-8 in the 9 cell lines before and after treatment with 8-Br-cAMP and depsipeptide. As can be seen, TTF-1 expression was not detected in any of the cell lines of nonthyroid origin and Pax-8 expression was detected only in A498 cells. In contrast, both TTF-1 and Pax-8 were detected in all 4 thyroid cell lines. Furthermore, although Pax-8 levels were not modulated by addition of 8-Br-cAMP and depsipeptide, this treatment resulted in increased TTF-1 expression in the 4 thyroid cell lines.

thumbnail image

Figure 5. Semiquantitative PCR analysis for expression of transcription factors interacting with the TG promoter in thyroid and nonthyroid cell lines. Cells were treated with 0.3 mM 8-Br-cAMP and 1 ng/ml depsipeptide for 72 hr prior to harvesting RNA. Numbers below each panel represent a semiquantitative estimate of relative expression levels. In each case, the highest level (FTC 236 treated with 8-Br-cAMP and depsipeptide) has been assigned a value of 100.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES

Retroviruses and Ads are, at present, the most efficient vectors available for gene delivery. Retroviruses allow for stable gene integration into the chromosomes of target cells; however, they are limited by relatively low titers and dependence on target cell replication. By comparison, Ad-mediated gene transduction has been demonstrated in a broad spectrum of eukaryotic cells and is independent of cell replication, but gene expression is transient. Furthermore, induction of an immune response can prevent repeated Ad administration.28, 29

In gene therapy of cancer, several approaches have been used: (i) replacement of missing or defective genes,30, 31, 32(ii) a suicide gene therapy strategy33, 34, 35 and (iii) antisense and cytokine gene therapy.36, 37 Regardless of the vector used, successful suicide gene therapy requires a strong and specific promoter. Examples of tumor-directed transcriptional targeting include α-fetoprotein for hepatoma and carcinoembryonic antigen for gastrointestinal carcinomas.38, 39, 40, 41

Because of their unique properties, endocrine malignancies are attractive models in which to pursue suicide gene therapy strategies. Thyroid cancers arise from a unique cell that possesses at least 4 genes which can be potentially exploited: (i) Tg, (ii) thyroid peroxidase, (iii) the thyroid-stimulating hormone receptor and (iv) the sodium/iodide symporter. In the present study, we describe the construction of a recombinant Ad with a preference for cells of thyroid origin, in which expression of the suicide gene HSV-TK is regulated by sequences from the putative Tg enhancer and promoter. We employed the Tg enhancer/promoter because numerous studies have shown Tg expression in a majority of thyroid tumors42 and the promoter activity of Tg is stronger than that of thyroid peroxidase.43

Nagayama et al.44 reported a suicide gene therapy strategy for thyroid cancer in which enhanced activity of the Tg promoter was achieved with the Cre-loxP system. Based on initial studies demonstrating that luciferase and HSV-TK expression were enhanced by treatment with the histone deacetylase inhibitors depsipeptide and sodium butyrate in combination with 8-Br-cAMP, we selected the approach described herein.20 Whereas 8-Br-cAMP targets the cAMP/protein kinase A pathway, histone deacetylase inhibitors target histone deacetylase(s) and their ability to modify histones as well as indirectly other transcription factors. Because these agents have different targets, they could potentially be used in combination. Luciferase activity of the Tg enhancer/promoter-Luc vector was higher in thyroid cancer cell lines than in cancer cell lines originating from tissues other than the thyroid. Furthermore, luciferase activity was enhanced following treatment with 8-Br-cAMP in combination with depsipeptide only in cells of thyroid origin. Our approach exploits the ability to modulate the endogenous expression of the Tg gene by these agents using sequences from the Tg enhancer/promoter in our suicide constructs.

Using luciferase assays and a vector in which luciferase expression is controlled by the Tg enhancer/promoter, we examined the tissue specificity of the Tg enhancer/promoter using the CMV promoter as a control. The CMV promoter is very strong but lacks tissue specificity. In transient transfections, the Tg enhancer/promoter construct was shown to be active exclusively in cells of thyroid origin, with greater activity in follicular carcinoma cells compared to anaplastic cells. However, the activity of the Tg enhancer/promoter was at best only about 3% that of the CMV promoter. In contrast, after treatment with 8-Br-cAMP and the histone deacetylase inhibitor depsipeptide, promoter activity was increased 30- to 100-fold in all thyroid cancer cell lines. This drug-mediated enhancement was not found in the nonthyroid cell lines. Furthermore, when cells were infected with an Ad construct in which expression of TK is under the control of the Tg enhancer/promoter, protein levels of TK were higher in anaplastic thyroid carcinoma cells treated with 8-Br-cAMP and depsipeptide.

Cells expressing HSV-TK are killed by administration of GCV. Furthermore, this toxicity can be transmitted to adjacent cells lacking HSV-TK, a phenomenon referred to as the bystander effect.45 In the latter, it is thought that intercellular transfer of GCV metabolites occurs through gap junction channels. We believe that killing of bystander cells occurred in our models. Although this evidence should be considered preliminary, it includes observations made using a recombinant virus containing the lacZ gene under the control of the CMV promoter. From a clinical standpoint, the concentrations of GCV yielding 50% growth inhibition in thyroid cancer cell lines infected with Ad Tg-enhancer/promoter-TK were under 1 μM. This compares with nontoxic levels of GCV in serum of as much as 25.9 μM.46

Expression of the TG gene is restricted to the thyroid gland, and TG is expressed in most differentiated thyroid carcinomas. However, TG expression is lower and often undetectable in anaplastic carcinomas.47 Reduced expression of the endogenous TG gene and, in turn, reduced transactivation of the TG enhancer/promoter constructs may have been responsible for the lower TK levels and reduced cytopathic effects in the anaplastic cell lines KAT-4 and SW-1736. Shimura et al.48 showed that TTF-1 could reactivate the TG promoter in rat FRT cells. We could induce overexpression of TTF-1 by treating thyroid cancer cell lines with 8-Br-cAMP and depsipeptide, resulting in enhanced TK expression and GCV toxicity. The observation that this enhancement coincided with an increase in TTF-1 expression provides a possible explanation for the effect observed with these agents. Treatment with histone deacetylase inhibitors such as depsipeptide (FR901228) can increase expression of CAR and Ad-mediated transgene expression.49 While we cannot exclude that in our experiments depsipeptide may have had an effect on CAR and, in turn, transgene expression, especially in anaplastic cell lines, there is evidence to suggest that this is not the only effect. Specifically, when a plasmid containing the luciferase gene under the control of the Tg enhancer/promoter was transfected into thyroid cancer cells, depsipeptide added after the transfection was able to increase luciferase expression markedly (Fig. 2 and data not shown).20

In conclusion, we have constructed a recombinant Ad vector using a putative Tg enhancer and promoter to generate thyroid cell-specific constructs. HSV-TK expression using this Ad vector was observed exclusively in thyroid cancer cell lines. Expression of HSV-TK by this vector could be modulated by 8-Br-cAMP and the histone deacetylase inhibitor depsipeptide, suggesting that these agents can be used to enhance the magnitude and specificity of HSV-TK expression. This Ad vector may be useful for suicide gene therapy of thyroid cancer cells.

REFERENCES

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. REFERENCES