SEARCH

SEARCH BY CITATION

Keywords:

  • SEREX;
  • bladder cancer antigen;
  • lipoic acid synthetase;
  • kelch-like protein;
  • tumor reactive T cell

Abstract

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

To identify tumor antigens useful for the diagnosis and treatment of patients with bladder cancer, a lambda phage cDNA library constructed from a high-grade bladder cancer cell line was screened with autologous serum from a patient with metastatic bladder cancer. Forty-eight distinct antigens were isolated. By evaluating the immunogenicity and the tissue-specific expression, KU-BL-1 and KU-BL-2 were identified as immunogenic antigens with restricted tissue expression. KU-BL-1 was found to be a putative human lipoic acid synthetase with a metal-binding site, CXXXCXXC, that was expressed in bladder cancer cell lines and most bladder cancer tissues, as well as normal bladder mucosa and testis tissues. Immunoglobulin (Ig)G antibody to KU-BL-1 was detected in 2 of 28 patients with bladder cancer, but not in 30 healthy individuals. KU-BL-2 was found to be a putative human kelch-like protein that was homologous to Drosophilakelch, with a BTB/POZ domain and kelch repeats. KU-BL-2 was expressed in bladder cancer cell lines, most bladder cancer tissues, testis and heart, but not in normal bladder mucosa. IgG antibody to KU-BL-2 was detected in 8 of 28 patients with bladder cancer, but not in 16 healthy individuals. Tumor reactive T cells were induced from peripheral blood mononuclear cells (PBMC) by stimulation with one of the HLA–A24 binding KU-BL-2 peptides. Therefore, KU-BL-1 and KU-BL-2, which showed preferential expression in bladder cancer with restricted expression in normal tissues, as well as immunogenicity in multiple patients with bladder cancer, may be useful for the development of diagnostic and therapeutic methods for patients with bladder cancer. © 2003 Wiley-Liss, Inc.

Most superficial bladder cancer can be treated successfully by transurethral resection and the intravesical administration of antitumor substances, and locally advanced bladder cancer may be treated by radical surgery in combination with chemotherapy and irradiation.1, 2, 3 However, it has been difficult to treat patients with metastatic bladder cancer; thus, new therapeutic methods need to be developed. The intravesical administration of Bacillus Calmette-Guerin (BCG) is the most effective therapy for patients with high grade superficial bladder cancer with carcinoma in situ, as well as for preventing intravesical recurrence.4, 5 After repeated BCG administration, an increase in infiltrated CD4+ T cells and macrophages is observed along with major histocompatibility complex (MHC) class II expression on tumor and normal epithelial cells.6, 7, 8 Various cytokines, including interleukin (IL)-1, IL-2, IL-6 and interferon (IFN)-γ, are detected in the urine after BCG treatment.9, 10 These observations suggest that the antitumor effects of BCG may be partly mediated by local immunologic reactions. The augmentation of systemic immunity, including an increase in serum IL-2 and IFN-γ, as well as of BCG-induced killer cell activity in peripheral blood mononuclear cells (PBMCs), has also been reported.11 Expression of some of the cancer-testis antigens, including the MAGE family and NY-ESO-1, is frequently observed in advanced bladder cancer.12, 13, 14 In our recent clinical trial, a partial reduction in the metastasis of bladder cancer by immunization with autologous dendritic cells (DC) pulsed with the HLA-A24-restricted MAGE-3 epitope peptide was observed.15 These observations suggest that immunotherapy may be effective for patients with bladder cancer.

Human tumor antigens recognized by T cells have recently been identified in various tumors, particularly in melanoma.16 In melanoma, various tumor antigens, including tissue-specific proteins such as gp100,17 cancer-testis antigens such as MAGE18 and tumor-specific mutated antigens such as a mutated β-catenin19 have been identified by cDNA expression cloning techniques using tumor-reactive cytotoxic T lymphocytes (CTLs). Some of these melanoma antigens have already been applied clinically in various immunotherapy protocols, and tumor regression has been observed in some patients.20, 21, 22 However, to date, only a limited number of tumor antigens have been identified in bladder cancer cells, including cancer-testis antigens such as MAGE-1, -2, -3, -12 and NY-ESO-1.12, 13, 14 The mutated KIAA0205 peptide was also identified as a bladder cancer antigen recognized by HLA-B*4403 restricted CTLs; however, the same mutation was not found in 60 bladder cancers tested.23

Although cDNA expression cloning with tumor-reactive T cells is a powerful technique, it is not applicable to tumors for which tumor-reactive T cells and tumor cell lines are difficult to establish. Sahin et al.24 developed a method called SEREX (serologic identification of recombinant cDNA expression cloning) to isolate cDNAs that encode tumor antigens recognized by a patient's serum IgG antibodies. SEREX is a cDNA expression cloning technique in which a lambda phage cDNA library is screened by the serum IgG from patients with cancer. It is expected that helper CD4+ T cells responded to the same antigens isolated with the serum IgG antibodies in the SEREX procedure. In addition, extensive studies by the Pfreundschuh and Old groups24, 25, 26 revealed that CD8+ CTLs also recognize some of the SEREX-identified antigens. Several tumor antigens, including MAGE, NY-ESO-1 and tyrosinase, have been identified by cDNA expression cloning with both tumor-reactive T cells and patients' sera.

In our present study, we applied SEREX to identify tumor antigens that may induce T cell response in bladder cancer. We identified 2 antigens, KU-BL-1, a putative human lipoic acid synthetase, and KU-BL-2, a putative human kelch-like protein, both of which showed preferential expression in bladder cancers with restricted expression in normal tissues. These newly identified antigens may be useful for the development of diagnostic and therapeutic methods for patients with bladder cancer.

MATERIAL AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

Cell lines and tissues

Human bladder transitional cell carcinoma (TCC) cell lines, FY,15 KU-1,27 KU-7,27 KU-19-19,28 NBT-229 and T-2430 were cultured in RPMI 1640 supplemented with 10% FBS, 100 IU/ml penicillin and 100 μg/ml streptomycin. FY and KU-19-19 were established from metastases of invasive bladder cancers (TCCs, grade 3). NBT-2 and T24 were established from invasive bladder cancer tissues (TCCs, grade 3). KU-1 and KU-7 were also established from human bladder TCCs (grade 2 and grade 1, respectively). Human melanoma cell lines Skmel23, 888mel, A375mel, 1363mel, 1362mel, 928mel, 624mel, 586mel, 526mel, 501mel and 397mel; lung cancer cell lines K1S, Lu99, EBC1 and RERF-LC-MA; colon cancer cell lines COLO 201, DLD-1, SW837, LoVo, WiDr, RCM-1 and CCK-81; leukemia cell lines HL60, Kasumi-1, K562 and Molt-4; renal cell carcinoma cell lines KU-19-20, RCC6, RCC7 and RCC8; breast cancer cell lines MDA231and HS578 and prostate cancer cell lines PC3 and JCA1 were cultured in 10% FBS RPMI 1640. The human glioma cell lines U87MO and T98G and the esophageal cancer cell lines TE8 and TE10 were cultured in 10% FBS DMEM. The pancreatic cancer cell lines PK1, PK8 and PK59 were cultured in RPMI 1640 supplemented with 10% FBS, 2 mM L-glutamine, 10 mM HEPES, 6 μg/l epidermal growth factor (EGF), 150 U/l insulin, 0.5 mg/l hydrocortisone, 10 mg/l transferrin, penicillin and streptomycin. Tumor-infiltrating T lymphocytes were cultured in Iscove's DMEM supplemented with 10% human AB serum, 6,000 IU/ml rIL2, penicillin and streptomycin. EBV-B cells were cultured in 10% FBS RPMI 1640. Skin fibroblasts were cultured in 10% FBS RPMI1640. Normal bladder mucosa, bladder cancer tissues and renal cell carcinoma tissues were obtained from surgical specimens from informed patients and stored at –80°C until use.

Profile of the patient whose tumor and serum were used for screening the cDNA library

Muscle invasive bladder cancer was diagnosed in a 76-year-old Japanese female patient, who was treated by radical cystectomy in March, 1996. The histologic diagnosis was high grade (grade 3), high stage (pT3), nonpapillary transitional cell carcinoma with components of squamous cell carcinoma, adenocarcinoma and sarcomatoid carcinoma. Five months after the cystectomy, metastasis developed in the right inguinal and paraaortic lymph nodes. Biopsy of inguinal lymph nodes was performed and the histologic diagnosis was transitional cell carcinoma (grade 3). A bladder cancer cell line, FY, was established from the biopsy specimen of the inguinal lymph node metastasis and found to express MAGE-1, -2 and -3 antigens. After the development of metastasis, this patient was first treated with chemotherapy and radiotherapy, and then with autologous DC pulsed with HLA-A24-restricted MAGE-3 epitope peptide (IMPKAGLLI). Serum from this patient, which was used for screening the cDNA library, was obtained 8 months before the DC immunization. This patient later died of a perforation of the small intestine 2 months after the DC vaccination. The complete remission of lymph node metastases was confirmed by autopsy.15

Construction of cDNA library

Total RNA was isolated from the FY cell line by guanidine isothiocyanate and CsCl2 gradient ultracentrifugation. Poly (A)+ RNA was purified twice with latex beads coated with oligo-dT (Oligotex-dT30 super, TAKARA, Kyoto, Japan). A cDNA library was constructed with 5 μg of Poly(A)+ RNA. First-strand synthesis was performed using an oligo (dT) primer. The cDNA was ligated to EcoRI adaptors and digested with Xho I. The cDNA fragments were directionally inserted into the bacteriophage expression vector (ZAP express, Stratagene, La Jolla, CA), packaged into phage particles and used to infect E. coli, resulting in 2.3 × 106 primary recombinants in the library. This library was amplified once before screening.

cDNA expression cloning with autologous serum

Briefly, approximately 1.0 × 104 plaques per 15-cm plate from the FY cDNA lambda phage library were transferred to each nitrocellulose membrane (Hybond-C, Amersham, Buckinghamshire, UK) and recombinant proteins were expressed with isopropyl-thio-galactoside. To remove the antibodies against E. coli and lambda phages, the autologous serum was first absorbed with E. coli cell lysate (strain XL1-Blue MRF') and with cDNA insert-lacking bacteriophage proteins on the nitrocellulose membranes. The nitrocellulose membranes were then incubated with a 1:100 dilution of the patient's serum for 8 hr at room temperature. After 3 washes with TBS containing 0.05% Tween 20, the membranes were incubated with a 1:4,000 dilution of alkaline phosphatase-conjugated goat anti-human Fcγ antibodies (Cappel, Aurora, OH). Positive plaques were identified by reaction with 5-bromo-4-chloro-3-indolyl phosphate (SIGMA, St. Louis, MO) and nitroblue tetrazolium (Roche Diagnostics GmbH, Mannheim, Germany). Positive plaques were picked from the plates and purified through secondary and tertiary rounds of screening. The cDNA inserts in the PCR products amplified with T3 primer (5′-AATTAACCCTCACTAAAGGG) and T7 primer (5′-GTAATACGACTCACTATAGGGC) from the recombinant phages or the pBK CMV plasmid converted from phages by in vivo excision were sequenced using the Big Dye Terminator Cycle Sequencing Ready Reaction Kit on an ABI Prism 310 genetic analyzer (PE Biosystems, Branchburg, NJ). The sequenced DNAs were analyzed by BLAST search of genetic databases at the National Center for Biotechnology Information.

Detection of antigen-specific IgG antibodies in sera from patients with various cancers and healthy individuals

Screening of IgG antibodies specific for each antigen in sera from patients with various cancers and healthy individuals was performed by an immunoscreening method similar to that used for the isolation of antigens. Each phage containing each antigen clone was mixed 1:1 with negative control phages that did not contain cDNA insert to clarify the positive signals.

RT-PCR and Northern blot analyses

Total RNAs were isolated from cell lines and tissue samples by the guanidine isothiocyanate-CsCl2 gradient ultracentrifugation method. RNA from normal tissues except normal bladder was purchased from Clontech Laboratories, Inc. (Palo Alto, CA). Normal bladder tissues (mucosa) were obtained from surgical specimens from informed patients. Reverse transcription was performed using Super Script II reverse transcriptase (Gibco BRL, Rockville, MD) and PCRs were performed at an appropriate annealing temperature for each primer set with Ex-Taq DNA polymerase (TAKARA). Gene-specific primers were designed to amplify 5′ fragments of SEREX-defined antigens. The primers for KU-BL-1 were 5′-GGAAATGTCTCTACGCTGCG (forward) and 5′-AACATGATCGTGGCTGTGGC (reverse). Primers for KU-BL-2 were 5′-GGTGGAGAAGAGCAGCAAGAAG as forward and 5′-GGTCCTCTGGAGACAGTAGATG as reverse.

For Northern blot analysis, nylon membranes containing 2 μg of poly (A)+ RNA per lane from various normal tissues (Human Multiple Northern Blot I and IV) were purchased (Clontech), and for other tissues and cell lines, 20 μg of total RNA was fractionated by electrophoresis in a 1.0% formaldehyde agarose gel and transferred to a nylon membrane (Hybond-N+, Amersham). 32P-labeled probes were prepared using the High Prime DNA-Labeling Kit (Roche Diagnostics GmbH). Prehybridization and hybridization with the radioisotope-labeled probes were performed using Quick Hyb solution (Stratagene). Briefly, prehybridization was performed at 68°C for 20 min, and hybridization with the probes was performed at 68°C for 2 hr. The membranes were washed at high stringency as described in the manufacturer's instructions. Radioactive signals were detected using a Molecular Imager Fx (BIO RAD, Hercules, CA). After the exposure, the membranes were stripped and rehybridized with a human β-actin cDNA control probe (Clontech).

Real-time PCR

To determine the expression level of B2 in normal and cancer tissues, the Taqman real-time PCR method was performed as previously described.31 Primers and probes (forward primer, 5′TCAAGGAGATGACAGACGTGC; reverse primer, 5′-GACCCAGGACTTTGGTTTCGA; probe, 5′[FAM]CAAAGTGGTGAAGGAGGTGGCCAA-[TAMRA]) were designed using Primer Express software (PE Biosystems). Real-time PCR amplification and data analysis were performed using an ABI Prism 7700 Sequence Detector System (PE Biosystems). Experiments were performed in duplicate. Each PCR run included 5 standards.

5′-RACE

To identify the 5′ end of the mRNA transcripts, a RACE protocol was performed using the Marathon TM cDNA Amplification Kit (Clontech) according to the manufacturer's instructions. Briefly, 1 μg of poly (A)+ RNA from the FY cell line was reverse transcribed using a modified locking oligo(dT) primer and Avian myeloblastosis virus (AMV) reverse transcriptase. The second strand synthesis was accomplished with a mixture of E. coli DNA polymerase I, RNase H and T4 DNA ligase. The double-stranded cDNA was blunt-ended with T4 DNA polymerase and ligated to the Marathon cDNA adaptor 1 using T4 DNA ligase. The anchor-ligated cDNAs were then subjected to PCR with an adaptor primer 1 and a KU-BL-1-specific primer (5′-TCGTGGCTGTGGCGGTGGCATATTCTCC). The diluted products were subjected to a second round of 20-cycle PCR with a nested adaptor primer 2 and a nested KU-BL-1-specific primer (5′-GGCATATTCTCCACCTCCCCAACACTC). The final products were subcloned into a pGEM-T plasmid (Promega Inc., Madison, WI) and the insert cDNA was sequenced.

Induction of CTL by stimulation with synthetic peptides

Generation of DCs was performed as previously described.32 Briefly, PBMC were isolated by Lymphoprep (AXIS-SHIELD PoC AS, Oslo, Norway) density gradient from healthy donors. Nonadherent cells recovered from 30 min culture of PBMC in surface modified dishes (Primaria, Falcon, Beckton-Dickinson, Franklin Lakes, NJ) were frozen and later used as responder cells. The remaining adherent cells were cultured overnight in RPMI1640 medium containing 10% FCS. After removal of nonadherent cells, cells were cultured with recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF; 50 ng/ml) and recombinant human interleukin-4 (IL-4; 50 ng/ml) in RPMI1640 medium containing 10% FCS for an additional 7 days. For DC maturation, anti-CD40 mAb (500 ng/ml), IFN-γ (500 IU/ml) and LPS (0.4 ng/ml) was added at day 5.

Possible HLA-A24 binding peptides from KU-BL-1 and KU-BL-2 were predicted by using the HLA peptide binding prediction program provided by Bioinformatics and Molecular Analysis Section (BIMAS). Two each highest binding peptides (KU-BL-189–97: NYNKLKNTL and KU-BL-1352–360: SYKAGEFFL, KU-BL-2338–346: VYILGGSQL, KU-BL-2207–215: VYDAAVRML) were selected and synthesized with a peptide synthesizer by Fmoc chemistry, purified by reversed-phase high-performance liquid chromatography and evaluated by mass spectrometry. For CTL induction, 2 × 106 autologous nonadherent cells were cultured with 5 × 105 DC pulsed with 20 μg/ml of the synthetic peptide in Iscove's DMEM with 10% human serum, and 50 IU/ml of recombinant human interleukin-2 (IL-2) (Shionogi, Osaka, Japan) was added at day 3. After 7 days of culture, recovered cells were restimulated with 2 × 106 irradiated peptide-pulsed autologous PBMC, and IL-2 was added on day 10 and 12. Two additional restimulations were performed and cells recovered 7 days after the last restimulation was evaluated for their antigen specific recognition by using IFN-γ release assay as previously described.16 HLA-A24 transfected T2 cells (T2-A24 cells) were used as indicator cells for the peptide specific T cell recognition.

Statistical analysis

The unpaired t-test was performed for evaluation of the significance.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

Isolation of bladder cancer antigens recognized by autologous serum by SEREX

A lambda phage cDNA library constructed from a bladder cancer cell line, FY, established from a high-grade transitional cell carcinoma was screened using autologous serum. This cell line expressed the MAGE-1, -2 and –3 antigens, and the patient responded to immunization with DC pulsed with MAGE-3 peptide IMPKAGLLI.15 By screening a total of 1.2 × 106 recombinant phage clones, 78 positive cDNA clones were isolated. These represented 48 distinct antigens (B1 to B48), including 36 previously characterized proteins (Table I) and 12 uncharacterized proteins (Table II). For 8 of these 12 cDNAs, partial sequences were found to be registered in Unigene clusters in the Genbank database. Seven genes, including high density lipoprotein binding protein33 (B13), negative cofactor 2 α-subunit (B16), pinch protein (B48), B1, B3, B4 and B15 were isolated more than twice. High-density lipoprotein binding protein, B3 and B4 were the most frequently detected.

Table I. Previously Characterized Molecules that were Isolated by Serex
CloneNo. of isolated clonesIdentityChromosome
B21Transcription factor tat-CT119q13
B51Golgin-8414q
B61α-enolase1p36.3-p36.2
B71Laminin receptor 13p21.3
B81Mitosin1q32-q41
B91PM5 protein16p13.11
B101EBNA-2 coactivator7q31.3
B111Hsp70-16p21.3
B121α-actin 419q13
B138High-density lipoprotein binding protein2q37
B141Lbc protooncogene15q24-q25
B162Negative cofactor 2 α subunit11q13.3
B171Nitric oxide synthase 37q36
B181Kinectin 114q22.1
B201STE20-like kinase12q24.2
B211Follistatin-related protein3q13.33
B231Tyrosyl-tRNA synthetase1p34.3
B241Initiation factor 4B12q12
B251Elongation factor-1α6q14.1
B261Translation factor CA1505q31
B271Thrombospondin 115q15
B281Translocon-associated protein δXq28
B291C-terminal binding protein 210q26.13
B301Protective protein for β-galactosidase20q13.1
B321Lens epithelium-derived growth factor9p22.1
B351Histone macro H2A1.25q31.3-q32
B371Annexin VIII10q11.2
B381Ribosomal protein L2819q13.4
B401Pyruvate dehydrogenase-α subunitXp22.2-p22.1
B411Ribosomal protein L1917q11.2-q12
B421Ribosomal protein L37a2
B431Ribosomal protein S69p21
B451Succinate dehydrogenase complex subunit A5p15
B461Protein tyrosine phosphatase receptor type U1p35.3-p35.1
B471Pinch-2 protein2q14-q21
B482Pinch protein2q12.2
Table II. Previously Uncharacterized Genes that were Isolated by Serex
CloneNo. of isolated clonesIdentityUnigeneChromosome
B12Putative lipoic acid synthetaseHs.535316p21.3
B38Hypothetical proteinHs.264817p21.3
B47KIAA0603Hs.17380213q21.33
B152KIAA0782Hs.2126411q13.3
B191ESTHs.2888972q36.1
B221ESTHs.1732596q25.3
B311ESTHs.214862p11.2
B331EST 
B341EST 
B361Hypothetical protein6
B391EST 
B441Hypothetical proteinHs.883622q13.2

To identify antigens that could be useful for the development of diagnostic and therapeutic methods for patients with bladder cancer, proteins that were previously known or suspected to have an association with cancer development and uncharacterized proteins that were either novel or had preferential expression in cancer and restricted normal tissues, as predicted by the cDNA sources registered in the corresponding Unigene clusters, were carefully evaluated in this analysis. Among the 36 known proteins, 9 were reported to have some association with cancer phenotypes. These were Golgin-8434 (B5), α-enolase35, 36 (B6), laminin receptor 137 (B7), mitosin38, 39 (B8), PM5 protein40 (B9), α-actinin441 (B12), LBc protooncogene42 (B14), thrombospondin-143 (B27) and AnnexinVIII44 (B37). Among the uncharacterized antigens, preferential expression in cancer cells was predicted for some antigens by identifying the tissue from which the registered cDNA in the corresponding Unigene cluster was derived. For example, cDNA sequences in the Unigene cluster (Hs.53531) for B1 were derived from cancers (neuroblastoma: GenBank accession AL528261, retinoblastoma: BE782979, germ cell tumors: BF056778 and AI341095, melanoma: BE622338, lymphoma: BF796995, melanoma: BG761639), a benign tumor (bladder transitional cell papilloma: BG28897) and restricted normal tissues (fetal heart: W76202, total fetus: AI075753, placenta: AL551531, melanocyte: N24845), suggesting its preferential expression in cancer cells and limited normal tissues. The cDNAs in the Unigene cluster (Hs.26481) for B3 were derived from cancers (neuroblastoma: AL521477, lung cancer: AI829079 and BE786124, melanoma: BF690972 and BF571396, skin squamous cell cancer: BG679612, renal cancer: BG168844 and BG168927, germ cell tumor: AI954716) and mixtures of tissues containing fetal tissues (fetal heart and testis: AI37795, fetal heart, pregnant uterus and melanocyte: AA478899), suggesting its preferential expression in cancer cells and limited normal tissues. By excluding ubiquitously expressed proteins through gene database analysis, 36 antigens were finally selected for the next evaluation of immunoreactivity.

Evaluation of specific immunogenicity of the identified antigens

To identify antigens that could be useful for the diagnosis and treatment of cancer, we first screened the selected 36 antigens for the presence of IgG antibody against them in the sera of 16 healthy individuals. It is less likely that antigens for which IgGs were detected in healthy individuals would be cancer-specific in either their expression or immunogenicity. For 24 of the antigens, IgG antibodies were not detected or detected in only 1 of the 16 sera from healthy individuals (Table III). These antigens were selected for the next analysis of IgG detection in the sera from 28 bladder cancer patients. For 13 of the 24 antigens, IgGs were detected in the sera from more than 2 patients with bladder cancer (Table III). The remaining 11 antigens only reacted with the autologous serum used for screening the cDNA library. B3 was the antigen that was most frequently recognized by the sera of the bladder cancer patients (8 of 28 patients). B1, B2 (Tat-CT1), B4, B6 (α-enolase), B7 (laminin receptor 1), B8 (mitosin), B9 (PM5 protein), B11 (Hsp70), B13 (HDLBP), B16 (negative cofactor 2 α-subunit), B18 (kinectin 1) and B22 were also recognized by multiple patients with bladder cancer.

Table III. Presence of IGG Antibodies Specific for the Serex-identified Antigens in Sera from Patients with Various Cancers and Healthy Individuals
CloneHealthy individuals n = 16Bladder cancer n = 28Prostate cancer n = 14Melanoma n = 10Brain cancer n = 10Pancreatic cancer n = 10Renal cancer n = 10Esophageal cancer n = 10Colon cancer n = 7Testicular cancer n = 6
  • 1

    n = 30.

B101200000000
B20200000000
B30800001000
B40310100100
B50100000000
B60400000000
B70300000000
B81511140011
B90500010000
B100100000000
B110400000000
B120101001010
B130401001000
B140120003100
B150100000000
B160200000000
B180210000000
B200130000000
B220300000000
B280100000000
B290100000000
B300100000000
B331101111000
B440100000000

These antigens were also evaluated with the sera from patients with other types of cancer, including prostate cancer, melanoma, brain tumor, pancreatic cancer, renal cancer, esophageal cancer, colon cancer and testicular cancer (Table III). Fourteen of the 24 antigens were not reactive with any sera from other cancer patients tested. For most of the antigens, IgG was not frequently detected in patients with other cancers. Only B8 (mitosin), B14 (LBc protooncogene) and B20 (STE20-like kinase) were recognized by multiple patients with other cancers including pancreatic cancer, renal cancer and prostate cancer. IgG specific for B3 was detected in sera from 8 of the 28 bladder cancer patients and one patient with renal cell cancer (RCC), but not in any other cancer patients or healthy individuals tested. IgG specific for B1 was detected in sera from 2 of the 28 bladder cancer patients, but not from any other cancer patients or healthy individuals tested.

Evaluation of the specific expression of the identified antigens

The tissue-specific expression of the 24 selected antigens was evaluated by RT-PCR analysis. Although most antigens were ubiquitously expressed in various normal tissues, 3 antigens (B1, B2 and B3) were expressed in some cancer cell lines and in restricted normal tissues, including the testis, as assessed by 25-cycle RT-PCR analysis (data not shown). B1 was expressed in 4 of 6 bladder cancer cell lines (FY, KU-7, T-24 and KU-19-19) and in normal testis. It was weakly expressed in some normal tissues, including the bladder, brain, smooth muscle and testis. It was also expressed in various cancer cell lines and in all 23 bladder cancer, 3 gastric cancer and 10 RCC tissues tested (Table IV). By Northern blot analysis, B1 was an approximately 1.7-kb band and was expressed strongly in 4 bladder cancer cell lines (FY, KU-7, T-24 and KU-19-19), 6 bladder cancer tissues and normal bladder tissues, similar to the results of the RT-PCR analysis (Fig. 1). Although B1 was also expressed in normal bladder mucosa, B1 appeared to be expressed strongly in cancer tissues, which were carefully separated from normal mucosa parts. It was also expressed in normal testis and very weakly in the heart and liver. Thus, B1 is an interesting immunogenic antigen that is strongly expressed in bladder cancer and normal bladder mucosa, but not in other normal tissues except for the testis. We named it “KU-BL-1” and performed further characterization.

Table IV. Expression of KU-BL-1 in Various Cancer Cell Lines Evaluated by RT-PCR
CancerPositive/total
  1. Cell lines (25 cycle), tissues (30 cycle).–Parentheses, tumor tissues; ND, not done.

Melanoma11/11
Bladder cancer4/6 (23/23)
Breast cancer1/2
Colon cancer5/7
Esophageal cancer1/2
Gastric cancerND (3/3)
Glioma1/2
Hematological cancer4/4
Lung cancer1/4
Prostate cancer1/2
Pancreatic cancer3/3
Renal cancer2/4 (10/10)
thumbnail image

Figure 1. Preferential expression of KU-BL-1 in bladder cancer and normal bladder epithelium. The expression of KU-BL-1 mRNA in various cell lines and tissues was evaluated by Northern blot analysis. Bands of approximately 1.7 kb corresponding to KU-BL-1 were clearly detected in 4 of 6 bladder cancer cell lines and all 6 bladder cancer tissues, as well as normal bladder epithelium and testis. The commercially obtained membranes (upper side) contained 2 μg of poly (A)+ RNA per lane, and the other membranes for other tissues and cell lines contained 20 μg of total RNA per lane (lower side).

Download figure to PowerPoint

Although only 3 bladder cancer cell lines were positive for B2 (Tat-CT1), and all the other tumor cell lines and normal tissues were negative, as assessed by 25-cycle RT-PCR, various normal tissues were positive, including the testis, colon, small intestine, prostate, PBMCs, spleen and thymus, as assessed by 35-cycle PCR (data not shown). Northern blot analysis showed ubiquitous expression in various normal tissues, although higher expression in bladder cancer tissues than that in normal bladder tissue was seen (data not shown). Real-time PCR analysis showed a higher expression of B2 in bladder cancer tissues than in normal bladder tissues, but the level of the expression in bladder cancer tissues was equivalent to that in some of the B2-positive normal tissues, including heart and kidney. Thus, B2 may be useful for the immunohistochemic analysis of bladder cancer specimens, but it does not appear to be useful for immunotherapy.

By 25-cycle PCR, most tumor cell lines were positive for B3, including 4 of 6 bladder cancer cell lines (FY, KU-7, T-24 and KU-19-19), as were some normal tissues, including brain, heart, lung and testis (data not shown). Northern blot analysis with a probe made by PCR from the SEREX-isolated B3 fragment demonstrated a weak 3.2-kb band corresponding to the isolated KU-BL-2 cDNA in heart and testis, and a weak 1.0-kb band in testis in the purified mRNA of various normal tissues. Faint 2.0-kb bands were also ubiquitously detected (Fig. 2a). The 3.2-kb bands were observed in 3 of 6 bladder cancer cell lines (FY, KU-7 and KU-19-19) and most bladder cancer tissues, but not in normal bladder mucosa (Fig. 2b). Together with the observation that B3 was immunogenic in many patients with bladder cancer, these results suggest that B3 may be a useful antigen for diagnosis and treatment of patients with bladder cancer. Thus, we named B3 “KU-BL-2” and performed further characterization.

thumbnail image

Figure 2. Preferential expression of KU-BL-2 in bladder cancer and limited normal tissues. The expression of KU-BL-2 mRNA in various cell lines and tissues was evaluated by Northern blot analysis using a probe made by PCR from the SEREX-isolated B3 fragment. The weak 3.2-kb band corresponding to the isolated KU-BL-2 cDNA was detected in heart and testis, and the weak 1.0-kb band was detected in testis in purified mRNA of various normal tissues. Faint 2.0-kb bands were also ubiquitously detected (a). The 3.2-kb binds were observed in 3 of 6 bladder cancer cell lines (FY, KU-7 and KU-19-19) and all bladder cancer tissues, but not in normal bladder epithelium (b). The commercially obtained membranes (a) contained 2 μg of poly (A)+ RNA per lane and the other membranes contained 20 μg of total RNA per lane (b).

Download figure to PowerPoint

Isolation and characterization of the full-length KU-BL-1 cDNA

The longest cDNA among the SEREX-isolated KU-BL-1 clones was a 1,603-bp fragment. Because no stop codon was found in the 5′ end of this clone, 5′-RACE was performed to identify further 5′ sequences. A 1,668-bp cDNA corresponding to the 1.7-kb band detected in the Northern blot analysis was detected (Fig. 3). This cDNA contained a 1,116-bp open reading frame (ORF) (underlined) with a Kozak sequence and a stop codon in the region 5′ upstream of the putative first ATG, suggesting that this was a full-length cDNA encoding the KU-BL-1 protein, which consists of 372 amino acids. We performed a nucleotide homology search and found KU-BL-1 to be a close match with a partial sequence of putative human lipoic acid synthetase (LAS) (AJ224162) and human cDNA clone FLJ22636 (AK026289, UniGene number: 53531). Thus, KU-BL-1 appears to be human LAS. The KU-BL-1 gene is 18 bp longer at its 5′ end and 65 bp shorter at its 3′ end than the FLJ22636 clone, and it contains a single base difference at position 1077, at which Lys is substituted for Arg, at codon 333. As shown in Figure 4, by homology search with a protein BLAST at the National Center for Biotechnology Information, KU-BL-1 was found to be 87% identical to Mus musculus LAS (NP_077791) from mouse mammary tumor. It was also homologous to the probable LAS (O13642) (59% identical) from Schizosaccharomyces pombe, LAS precursor (BAA21430) (67% identical) from Schizosaccharomyces pombe, Lip 5p45 (NP_014839) (56% identical) derived from Saccharomyces cerevisiae and other LASs (T44259, BAB56059, BAB44157, AAG20343, CAC08341 and CAB64575). The amino acid sequence comparison with Mus musculus LAS (NP_077791) and Lip 5p (NP_014839) is shown in Figure 4. KU-BL-1 shared a unique motif (CXXXCXXC) for a metal-binding site (iron-sulfur cluster) with other LASs. This structure is reported to be involved in the introduction of sulfur into lipoic acid.46

thumbnail image

Figure 3. Nucleotide sequence of the KU-BL-1 cDNA. Nucleotide sequence of a 1,668-bp KU-BL-1 cDNA containing a 1,116-bp ORF (underlined) encoding a 372-amino acid protein, with a Kozak sequence and a stop codon in the region 5′ upstream of the putative first ATG.

Download figure to PowerPoint

thumbnail image

Figure 4. Comparison of the amino acid sequence of KU-BL-1 with other lipoic acid synthetases. The amino acid sequence of KU-BL-1 was compared to other lipoic acid synthetases (LAS). KU-BL-1 is 87% identical to Mus musculus LAS (NP_077791) (MLAS), from a mouse mammary tumor, and 56% identical to Lip 5p (NP_014839) from Saccharomyces cerevisiae. The motif (CXXXCXXC) for a metal-binding site (iron-sulfur cluster) is lined.

Download figure to PowerPoint

Characterization of KU-BL-2

One of the 8 clones isolated by SEREX was 3,112-bp long, which is compatible with the approximately 3.2-kb band detected by Northern blot analysis. By sequence comparison with other KU-BL-2 clones, a 1,758-bp ORF encoding a 586-amino acid protein was indicated (Fig. 5). A Kozak sequence and a stop codon were present at the 5′ region upstream of the putative first ATG. By nucleotide homology search, KU-BL-2 was found to match an uncharacterized cDNA clone DKFZp564C1616 (AL136597) derived from human fetal brain. It was localized to chromosome 7 and had similarity to Drosophilakelch.47 KU-BL-2 had 2 base differences from DKFZp564C1616, at positions 584 and 887, that did not change the amino acids. By homology search with protein databases, KU-BL-2 was found to be almost identical to a recently registered uncharacterized hypothetical protein (CAB66532). KU-BL-2 was also homologous to human kelch-like protein 348 (KLHL3: Q9UH77) (34% identical), Drosophilakelch47 (Q04652) (33% identical), kelch-like 249 (Mayven: NP_009177) (32% identical) and other kelch-like proteins. Motif analysis using the PROSITE and Pfam programs indicated that KU-BL-2 had a BTB/POZ domain and 6 possible kelch repeats, which are conserved in kelch-like proteins (Fig. 5). The possible BTB/POZ domain of KU-BL-2 was 94.6% (35/37) satisfied with previously described consensus sequences.50 Five repeats (repeats 2–6) had a high probability of being kelch repeats by the Pfam program and repeat 1 could also be a kelch repeat, based on its similarity to the other 5 repeats in the protein (data not shown), indicating that KU-BL-2 has at least 5 kelch repeats. These results suggest that KU-BL-2 is one of the human kelch-like proteins.

thumbnail image

Figure 5. Nucleotide and amino acid sequences of the KU-BL-2. Nucleotide sequence of a 3,112-bp KU-BL-2 cDNA containing a 1,758-bp ORF (underlined) encoding a 586-amino acid protein, with a Kozak sequence and a stop codon in the region 5′ upstream of the putative first ATG, is shown. The amino acid sequence of KU-BL-2, containing a BTB/POZ domain (a) and 6 kelch repeats (b), is shown.

Download figure to PowerPoint

Induction of KU-BL-2 specific T cells by stimulation with a synthetic peptide from PBMC of healthy donors

To evaluate whether T cells specific for KU-BL-1 and KU-BL-2 can be induced, we have attempted in vitro T cell induction from PBMC from 8 healthy donors by stimulation with possibly HLA-A24 binding synthetic peptides predicted by the BIMAS program. Among 2 each synthetic peptide with the highest binding affinity for KU-BL-1 (NYNKLKNTL and SYKAGEFFL) and KU-BL-2 (VYILGGSQL and VYDAAVRML), one of the KU-BL-2 peptides, VYILGGSQL, induced peptide specific CTL (Fig. 6a) that also recognized HLA-A24 positive, KU-BL-2 positive autologous bladder cancer cell line FY, but did not recognize HLA-A24 negative bladder cancer cell line KU1 (Fig. 6b). Among the 3 peptides, clear recognition of tumor cells was not observed, although weak peptide specific CTL was induced with one of the KU-BL-1 peptides, SYKAGEFFL.

thumbnail image

Figure 6. Induction of tumor reactive T cells by stimulation with an HLA-A24 binding KU-BL-2 peptide. T cells were induced from PBMC of 8 healthy donors by in vitro stimulation with possible HLA-A24 binding synthetic peptides that were predicted by the BIMAS program. First stimulation was performed with DC and an additional 3 stimulations were done with irradiated autologous PBMC. Antigen recognition of the recovered T cells was evaluated by IFN-γ release assay. T cells induced from one of the donors specifically recognized KU-BL-2338–346 (VYILGGSQL) and produced IFN-γ (a). IFN-γ release subtracted with background release from culture of T cells plus T2-A24 with no peptide, was shown. The same CTL also recognized HLA-A24 positive, KU-BL-2 positive autologous bladder cancer cell line FY, but not HLA-A24 negative bladder cancer cell line KU1 (b).

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

In our present study, we attempted to isolate tumor antigens that may be useful for the diagnosis and treatment of bladder cancer. Because chemotherapy and radiation therapy have only a limited efficacy for metastatic bladder cancer, new treatments such as immunotherapy need to be developed. BCG administration has been found to be effective for preventing the recurrence of superficial bladder cancer,4, 5 and recently, our clinical protocol, in which patients are immunized with autologous DC pulsed with the HLA-A24-binding MAGE-3 peptide, resulted in partial tumor regression in some patients with bladder cancer.15 These observations suggest that immunotherapy may be effective for metastatic bladder cancer.

Although the role of the antibodies raised in patients in immunologic tumor rejection has not been clear, an important role of T cells in tumor regression in vivo has been demonstrated in many murine tumor models51 and human melanoma.20, 22, 52 It is important to identify the tumor antigens recognized by these tumor-reactive T cells for the development of immunotherapy that involves highly effective immune intervention with monitoring T cell responses in patients. We previously isolated various human melanoma antigens recognized by tumor-reactive T cells using cDNA expression cloning techniques. These include tissue-specific antigens such as gp100,17 MART-1,53 tyrosinase,54 TRP155 and TRP2;56 cancer testis antigens such as NY-ESO-157 and tumor-specific mutated antigens such as MART-2.58 Although the expression of cancer testis antigens including the MAGE family and NY-ESO–1 has been reported in bladder cancer,12, 13, 14 only a limited number of tumor antigens recognized by T cells has been identified for bladder cancer.13, 23 Thus, more bladder cancer antigens need to be identified for the development of immunotherapy to treat bladder cancer.

cDNA expression cloning with tumor-reactive T cells is a powerful technique. However, it is difficult to apply it to cancers for which tumor-reactive T cells and autologous tumor cell lines are not available. Pfreundschuh and Old et al. have extensively sought human tumor antigens using cDNA expression cloning with patents' sera (SEREX) and revealed that tumor antigens recognized by both CD4+ and CD8+ T cells were identified by SEREX.24–26, 59, 60 We previously used SEREX to identify a melanoma antigen, KU-MEL-1, that is preferentially expressed in melanoma and melanocytes.61 Because this method can be performed without establishing tumor-reactive T cells and tumor cell lines, it is applicable for most cancers. Thus, in our study, we applied SEREX to identify bladder cancer antigens.

cDNA libraries made from fresh tumor tissues were used in the original SEREX protocol. In our study, we used a cDNA library constructed from the autologous tumor cell line. This eliminates false positives caused by contaminating normal cells, including human IgG produced by contaminating B cells in tumor tissues, although we might miss antigens that show differential expression among tumor cell clones. The FY cell line was established from the lymph node metastasis of invasive bladder cancer (TCC, grade 3) and expressed the cancer testis antigens MAGE-1, -2 and -3. This patient was treated with DC pulsed with the HLA-A24-restricted MAGE-3 epitope peptide, IMPKAGLLI, which resulted in the regression of lymph node metastasis.15

In our study, a total of 48 antigens, including 36 previously characterized proteins and 12 uncharacterized proteins, were revealed. Most of the antigens detected by SEREX were intracellular proteins. In spite of the expression of MAGE-1, -2 and -3 on the FY bladder cancer cells and of the previous identification of the MAGE family by SEREX, none of the MAGE family members were detected in our study. It may be explained by relatively low titer of antibody against the MAGE antigens in this patient or by no antibody production due to immunologic genetic background of this patient, including HLA type. Eight cDNAs, including the genes for high-density lipoprotein binding protein (HDLBP), and uncharacterized proteins B3 and B4 were the most frequently detected. IgG antibody against HDLBP was also frequently (4 of 28) detected in the sera of bladder cancer patients. HDLBP is a 110-kD membrane-associated protein that specifically binds HDL molecules to remove excess cellular cholesterol.62 The expression of HDLBP in cultured cells is increased when cells are loaded with cholesterol.62 However, the association between HDLBP and cancer is not known. Although an immune response to HDLBP occurred in some patients with bladder cancer, the reason this molecule was frequently recognized needs to be determined.

Among the 36 known proteins, 9 were previously reported to have some association with cancer phenotypes. Two of them are involved in the generation of oncogenes by recombination with other genes. Golgin-84 (B5) generates the oncogene RET-II by recombining with the RET protooncogene.34 The LBc protooncogene (B14) becomes an onco-LBc oncogene by fusion with a gene in chromosome 7. Onco-LBc activates the small GTP-binding protein Rho and mediates cytoskeletal reorganization in cancer cells.42 However, no genetic alteration was found in these antigens in the FY bladder cancer cells. The increased expression of α-enolase (B6), mitosin (B8), thrombospondin-1 (B27) and annexinVIII (B37) in tumor cells has been reported. Mitosin (B8), which is involved in mitotic phase progression, has been suggested to be a predictor for the recurrence of breast cancer.38, 39 The expression of thrombospondin-1 (B27) on stromal cells in tumor tissues correlates positively with advanced stages of esophageal cancer.43 AnnexinVIII (B37) is highly expressed in acute promyelocytic leukemia.44 The production of IgG against such proteins that showed increased expression in cancer cells was indicated in previous SEREX studies.61 Although the patient in our study did not develop any ophthalmic problems, autoantibodies to α-enolase (B6) are associated with cancer-associated retinopathy syndrome.35 HLA-DRB1*08032 restricted CD4+ T cells specific for α-enolase, which may help increase IgG production, have recently been established from a patient with squamous cell cancer.36 Laminin receptor 1 (B7), which is involved in cell-extracellular matrix interactions, is associated with the development and progression of hepatocellular carcinoma.37 A cytoplasmic localization of α-actinin4 (B12) is correlated with an infiltrative histologic phenotype and a poor prognosis in breast cancer.41 The down-regulation of the metalloproteinase-like collagenase PM5 (B9) is associated with tumor progression of prostate cancer.40 Because the induction of antibodies against these self proteins may be caused by the increased immunogenicity of their structural changes in cancer cells, we examined their possible genetic alteration by DNA sequencing in our study. However, no alteration other than polymorphisms was detected.

KU-BL-1 was expressed in 4 of 6 bladder cancer cell lines, all 23 bladder cancers, 3 gastric cancer and 10 RCC tissues tested; normal bladder mucosa and testis. IgG for KU-BL-1 was detected in sera from 2 of 28 patients with bladder cancer, but not from any other cancer patients or healthy individuals tested. Thus, KU-BL-1 is an interesting immunogenic antigen that is expressed in bladder cancer and normal bladder, but not in other normal tissues with the exception of testis. In our study, almost full-length KU-BL-1 cDNA was isolated and found to code for a putative human lipoic acid synthetase (LAS) because of its structural similarity to other previously identified LASs, including murine LAS.63 It contained the motif (CXXXCXXC) for a metal-binding site (iron-sulfur cluster) that is involved in the introduction of a sulfur into lipoic acids (6,8-thioctic acid).46 Lipoic acid is a sulfur-containing coenzyme essential for the activity of enzymes such as pyruvate dehydrogenase, 2-oxoglutarate dehydrogenase, branched-chain 2-oxo acid dehydrogenase and the glycine cleavage system.63 The role of LAS in bladder cancer remains to be investigated.

KU-BL-2 was expressed in some bladder cancer cell lines and bladder cancer tissues as well as normal heart and testis. Although IgG for KU-BL-2 was detected in sera from 8 of 28 patients with bladder cancer, it was also detected only in one patient with RCC, and not in any other cancer patients or healthy individuals tested. KU-BL-2 is homologous to Drosophilakelch and other kelch-like proteins. Kelch is expressed during Drosophila oogenesis and plays a role in the generation of the intercellular bridge called ring canal.47 KU-BL-2 has a BTB/POZ domain, which is found in several zinc-type transcription factors, and kelch repeats, which mediate the interactions of proteins including modulators of chromatin structure, cytoskeletal proteins and nuclear matrix proteins.49, 50 The kelch repeats typically consist of 6 repeats of ≅ 50 amino acids each, which are predicted to fold into a β-superbarrel structure.64 They are reported to associate with other proteins such as actin.65, 66 These findings suggest that KU-BL-2 is one of the human kelch-like proteins. Its role in bladder cancer remains to be determined.

The specific immunogenicity in cancer patients indicated by the presence of the specific IgG antibody in sera, as well as the preferential expression on bladder cancer cells and in limited normal tissues, suggests that KU-BL-1 and KU-BL-2 are attractive antigens to use as tumor markers and possibly useful immune-targets for developing diagnostic and therapeutic methods for bladder cancer. Because these antigens appear to be intracellular proteins, the antibodies against them are not be able to recognize living tumor cells, indicating that these would not be useful targets for antibody therapy. However, they could be good targets for T-cell-based immunotherapy, even though some expression is observed in restricted normal tissues. In our study, we tested 4 possible HLA-A24 binding peptides for induction of tumor reactive T cells using PBMC of 8 healthy donors. Only one of the peptides from KU-BL-2 was shown to induce peptide specific T cells that are also able to recognize tumor cells. Further analysis of additional peptides and PBMC from patients with bladder cancer, particularly patients whose sera containing IgG Ab specific for KU-BL-1 or KU-BL2, needs to be performed. When T cells are induced in patients, expression of these antigens in testis may not be a problem if these antigens are expressed in MHC class I negative cells, including spermatogonia and spermatocytes, because these testis cells cannot be recognized by T cells. The relatively strong expression of KU-BL-2 in the heart and KU-BL-1 in normal bladder mucosa may not necessarily exclude their use in immunotherapy, because autoimmune adverse effects may not occur if the epitope density on heart smooth muscle is low. Expression of these antigens in normal bladder epithelium may not be a problem after a radical operation. The role of SEREX-identified antigens in immunotherapy has recently been reported in a murine tumor model.67 In that study, antigens identified by SEREX were shown to be effective helper CD4+ T-cell antigens that could induce strong antitumor immunity in combination with tumor antigenic peptides for CD8+ CTLs. Therefore, KU-BL-1 and KU-BL-2 appear to be good candidates as helper antigens for immunotherapy.

In summary, we identified 2 tumor antigens, KU-BL-1 (putative human lipoic acid synthetase) and KU-BL-2 (human kelch-like protein), that show preferential expression in bladder cancer with expression in limited normal tissues, as well as immunogenicity in some patients with bladder cancer. One of the KU-BL-2 peptides appears to induce tumor reactive T cells. Therefore, these antigens may be useful as tumor markers for diagnosis and in treatment as targets in immunotherapy for patients with bladder cancer.

Acknowledgements

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

We are grateful to Tomoko Shofuda and Noriko Murakami for excellent technical assistance. We thank Rie Yamazaki for helpful comment and discussion for CTL induction. We also thank Akira Miyajima, Department Urology, National Defense Medical College, for kindly providing cDNAs made from mRNAs extracted from RCC tissues.

  • 1

    Dr. Ito's current address is: Department of Urology, National Defense Medical College, Tokorozawa, Japan.

  • 2

    Dr. Tachibana's current address is: Department of Urology, Tokyo Medical University, Tokyo, Japan.

  • 3

    Dr. Ikeda's current address is: Department of Pathology, Sapporo Medical University School of Medicine, Sapporo, Japan.

REFERENCES

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES
  • 1
    Coppin CM, Gospodarowicz MK, James K, Tannock IF, Zee B, Carson J, Pater J, Sullivan LD. Improved local control of invasive bladder cancer by concurrent cisplatin and preoperative or definitive radiation. The National Cancer Institute of Canada Clinical Trials Group. J Clin Oncol 1996; 14: 29017.
  • 2
    Kaufman DS, Shipley WU, Griffin PP, Heney NM, Althausen AF, Efird JT. Selective bladder preservation by combination treatment of invasive bladder cancer. N Engl J Med 1993; 329: 137782.
  • 3
    Millikan R, Dinney C, Swanson D, Sweeney P, Ro JY, Smith TL, Williams D, Logothetis C. 2001. Integrated therapy for locally advanced bladder cancer: final report of a randomized trial of cystectomy plus adjuvant M-VAC versus cystectomy with both preoperative and postoperative M-VAC. J Clin Oncol 2001; 19: 400513.
  • 4
    Catalona WJ, Ratliff TL. Bacillus Calmette-Guerin and superficial bladder cancer. Clinical experience and mechanism of action. Surg Annu 1990; 22: 36378.
  • 5
    Kavoussi LR, Torrence RJ, Gillen DP, Hudson MA, Haaff EO, Dresner SM, Ratliff TL, Catalona, WJ. Results of 6 weekly intravesical bacillus Calmette-Guerin instillations on the treatment of superficial bladder tumors. J Urol 1988; 139: 93540.
  • 6
    Bohle A, Gerdes J, Ulmer AJ, Hofstetter AG, Flad HD. Effects of local bacillus Calmette-Guerin therapy in patients with bladder carcinoma on immunocompetent cells of the bladder wall. J Urol 1990; 144: 538.
  • 7
    Peuchmaur M, Benoit G, Vieillefond A, Chevalier A, Lemaigre G, Martin ED, Jardin A. Analysis of mucosal bladder leucocyte subpopulations in patients treated with intravesical Bacillus Calmette-Guerin. Urol Res 1989; 17: 299303.
  • 8
    Stefanini GF, Bercovich E, Mazzeo V, Grigioni WF, Emili E, D'Errico A, Lo Cigno M, Tamagnini N, Mazzetti M. Class I and class II HLA antigen expression by transitional cell carcinoma of the bladder: correlation with T-cell infiltration and BCG treatment. J Urol 1989; 141: 144953.
  • 9
    De Boer EC, De Jong WH, Steerenberg PA, Aarden LA, Tetteroo E, De Groot ER, Van der Meijden AP, Vegt PD, Debruyne FM, Ruitenberg EJ. Induction of urinary interleukin-1 (IL-1), IL-2, IL-6, and tumour necrosis factor during intravesical immunotherapy with bacillus Calmette-Guerin in superficial bladder cancer. Cancer Immunol Immunother 1992; 34: 30612.
  • 10
    Prescott S, James K, Hargreave TB, Chisholm GD, Smyth JF. Radio-immunoassay detection of interferon-gamma in urine after intravesical Evans BCG therapy. J Urol 1990; 144: 124851.
  • 11
    Taniguchi K, Koga S, Nishikido M, Yamashita S, Sakuragi T, Kanetake H, Saito Y. Systemic immune response after intravesical instillation of bacille Calmette-Guerin (BCG) for superficial bladder cancer. Clin Exp Immunol 1999; 115: 1315.
  • 12
    Patard JJ, Brasseur F, Gil-Diez S, Radvanyi F, Marchand M, Francois P, Abi-Aad A, Van Cangh, P, Abbou CC, Chopin D. Expression of MAGE genes in transitional-cell carcinomas of the urinary bladder. Int J Cancer 1995; 64: 604.
  • 13
    Heidecker L, Brasseur F, Probst-Kepper M, Gueguen M, Boon, T, Van den Eynde BJ. Cytolytic T lymphocytes raised against a human bladder carcinoma recognize an antigen encoded by gene MAGE-A12. J Immunol 2000; 164: 60415.
  • 14
    Kurashige T, Noguchi Y, Saika T, Ono T, Nagata Y, Jungbluth A, Ritter G, Chen YT, Stockert E, Tsushima T, Kumon H, Old LJ, et al. Ny-ESO-1 expression and immunogenicity associated with transitional cell carcinoma: correlation with tumor grade. Cancer Res 2001; 61: 46714.
  • 15
    Nishiyama T, Tachibana M, Horiguchi Y, Nakamura K, Ikeda Y, Takesako K, Murai M. Immunotherapy of bladder cancer using autologous dendritic cells pulsed with human lymphocyte antigen-A24-specific MAGE-3 peptide. Clin Cancer Res 2001; 7: 2331.
  • 16
    Kawakami Y, Eliyahu S, Delgado CH, Robbins PF, Sakaguchi K, Appella E, Yannelli JR, Adema GJ, Miki T, Rosenberg SA. Identification of a human melanoma antigen recognized by tumor-infiltrating lymphocytes associated with in vivo tumor rejection. Proc Natl Acad Sci USA 1994; 91: 645862.
  • 17
    Kawakami Y, Eliyahu S, Jennings C, Sakaguchi K, Kang X, Southwood S, Robbins PF, Sette A, Appella E, Rosenberg SA. Recognition of multiple epitopes in the human melanoma antigen gp100 by tumor-infiltrating T lymphocytes associated with in vivo tumor regression. J Immunol 1995; 154: 396168.
  • 18
    van der Bruggen P, Traversari C, Chomez P, Lurquin C, De Plaen E, Van den Eynde B, Knuth A, Boon TA. Gene encoding an antigen recognized by cytolytic T lymphocytes on a human melanoma. Science 1991; 254: 164347.
  • 19
    Robbins PF, El-Gamil M, Li YF, Kawakami Y, Loftus D, Appella E, Rosenberg SA. A mutated beta-catenin gene encodes a melanoma-specific antigen recognized by tumor infiltrating lymphocytes. J Exp Med 1996; 183: 118592.
  • 20
    Kawakami Y, Rosenberg SA. Human tumor antigens recognized by T-cells. Immunol Res 1997; 16: 31339.
  • 21
    Rosenberg SA. Progress in human tumour immunology and immunotherapy. Nature 2001; 411: 3804.
  • 22
    Rosenberg SA, Yang JC, Schwartzentruber DJ, Hwu P, Marincola FM, Topalian SL, Restifo NP, Dudley ME, Schwarz SL, Spiess PJ, Wunderlich JR, Parkhurst MR, et al. Immunologic and therapeutic evaluation of a synthetic peptide vaccine for the treatment of patients with metastatic melanoma. Nat Med 1998; 4: 3217.
  • 23
    Gueguen M, Patard JJ, Gaugler B, Brasseur F, Renauld JC, Van Cangh PJ, Boon T, Van den Eynde BJ. An antigen recognized by autologous CTLs on a human bladder carcinoma. J Immunol 1998; 160: 618894.
  • 24
    Sahin U, Tureci O, Schmitt H, Cochlovius B, Johannes T, Schmits R, Stenner F, Luo G, Schobert I, Pfreundschuh M. Human neoplasms elicit multiple specific immune responses in the autologous host. Proc Natl Acad Sci USA 1995; 92: 118103.
  • 25
    Jager E, Chen YT, Drijfhout JW, Karbach J, Ringhoffer M, Jager D, Arand M, Wada H, Noguchi Y, Stockert E, Old LJ, Knuth A. Simultaneous humoral and cellular immune response against cancer-testis antigen NY-ESO-1: definition of human histocompatibility leukocyte antigen (HLA)-A2-binding peptide epitopes. J Exp Med 1998; 187: 26570.
  • 26
    Jager E, Gnjatic S, Nagata Y, Stockert E, Jager D, Karbach J, Neumann A, Rieckenberg J, Chen YT, Ritter G, Hoffman E, Arand M, Old LJ, Knuth A. Induction of primary NY-ESO-1 immunity: CD8+ T lymphocyte and antibody responses in peptide-vaccinated patients with NY-ESO-1+ cancers. Proc Natl Acad Sci USA 2000; 97: 12198203.
  • 27
    Tazaki H, Tachibana M. Studies on KU-1 and KU-7 cells as an in vitro model of human transitional cell carcinoma of urinary bladder. Hum Cell 1988; 1: 7883.
  • 28
    Tachibana M, Miyakawa A, Nakashima J, Murai M, Nakamura K, Kubo A, Hata JI. Constitutive production of multiple cytokines and a human chorionic gonadotrophin beta-subunit by a human bladder cancer cell line (KU-19-19): possible demonstration of totipotential differentiation. Br J Cancer 1997; 76: 16374.
  • 29
    Tachibana M, Miyakawa A, Uchida A, Murai M, Eguchi K, Nakamura K, Kubo A, Hata JI. Granulocyte colony-stimulating factor receptor expression on human transitional cell carcinoma of the bladder. Br J Cancer 1997; 75: 148996.
  • 30
    Bubenik J, Baresova M, Viklicky V, Jakoubkova J, Sainerova H, Donner J. Established cell line of urinary bladder carcinoma (T24) containing tumour-specific antigen. Int J Cancer 1973; 11: 76573.
  • 31
    Matsushita M, Ikeda H, Kizaki M, Okamoto S, Ogasawara M, Ikeda Y, Kawakami Y. Quantitative monitoring of the PRAME gene for the detection of minimal residual disease in leukaemia. Br J Haematol 2001; 112: 91626.
  • 32
    Sallusto F, Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med 1994; 179: 110918.
  • 33
    Fidge NH. High density lipoprotein receptors, binding proteins, and ligands. J Lipid Res 1999; 40: 187201.
  • 34
    Bascom RA, Srinivasan S, Nussbaum RL. Identification and characterization of golgin-84, a novel Golgi integral membrane protein with a cytoplasmic coiled-coil domain. J Biol Chem 1999; 274: 295362.
  • 35
    Adamus G, Amundson D, Seigel GM, Machnicki M. Anti-enolase-alpha autoantibodies in cancer-associated retinopathy: epitope mapping and cytotoxicity on retinal cells. J Autoimmun 1998; 11: 6717.
  • 36
    Kondo H, Sahara H, Miyazak A, Nabeta Y, Hirohashi Y, Kanaseki T, Yamaguchi A, Yamada N, Hirayama K, Suzuki M, Hamuro J, Torigoe T, et al. Natural antigenic peptides from squamous cell carcinoma recognized by autologous HLA-DR8-restricted CD4+ T Cells. Jpn J Cancer Res 2002; 93: 91724.
  • 37
    Ozaki I, Yamamoto K, Mizuta T, Kajihara S, Fukushima N, Setoguchi Y, Morito F, Sakai T. Differential expression of laminin receptors in human hepatocellular carcinoma. Gut 1998; 43: 83742.
  • 38
    Zhu X, Mancini MA, Chang KH, Liu CY, Chen CF, Shan B, Jones D, Yang-Feng TL, Lee WH. Characterization of a novel 350-kilodalton nuclear phosphoprotein that is specifically involved in mitotic-phase progression. Mol Cell Biol 1995; 15: 501729.
  • 39
    Clark GM, Allred DC, Hilsenbeck SG, Chamness GC, Osborne CK, Jones D, Lee WH. Mitosin correlates with clinical outcome in node-negative breast cancer. Cancer Res 1997; 57: 55058.
  • 40
    Stubbs AP, Abel PD, Golding M, Bhangal G, Wang Q, Waxman J, Stamp GW, Lalani EN. Differentially expressed genes in hormone refractory prostate cancer: association with chromosomal regions involved with genetic aberrations. Am J Pathol 1999; 154: 133543.
  • 41
    Honda K, Yamada T, Endo R, Ino Y, Gotoh M, Tsuda H, Yamada Y, Chiba H, Hirohashi S. Actinin-4, a novel actin-bundling protein associated with cell motility and cancer invasion. J Cell Biol 1998; 140: 138393.
  • 42
    Sterpetti P, Hack AA, Bashar MP, Park B, Cheng SD, Knoll JH, Urano T, Feig LA, Toksoz D. Activation of the Lbc Rho exchange factor proto-oncogene by truncation of an extended C terminus that regulates transformation and targeting. Mol Cell Biol 1999; 19: 133445.
  • 43
    Oshiba G, Kijima H, Himeno S, Kenmochi T, Kise Y, Tanaka H, Nishi T, Chino O, Shimada H, Machimura T, Tsuchida T, Nakamura M, et al. Stromal thrombospondin-1 expression is correlated with progression of esophageal squamous cell carcinomas. Anticancer Res 1999; 19: 43758.
  • 44
    Chang KS, Wang G, Freireich EJ, Daly M, Naylor SL, Trujillo JM, Stass SA. Specific expression of the annexin VIII gene in acute promyelocytic leukemia. Blood 1992; 79: 180210.
  • 45
    Sulo P, Martin NC. Isolation and characterization of LIP5. A lipoate biosynthetic locus of Saccharomyces cerevisiae. J Biol Chem 1993; 268: 176349.
  • 46
    Tate R, Riccio A, Iaccarino M, Patriarca EJ. Cloning and transcriptional analysis of the lipA (lipoic acid synthetase) gene from Rhizobium etli. FEMS Microbiol Lett 1997; 149: 16572.
  • 47
    Xue F, Cooley L. Kelch encodes a component of intercellular bridges in Drosophila egg chambers. Cell 1993; 72: 68193.
  • 48
    Lai F, Orelli BJ, Till BG, Godley LA, Fernald AA, Pamintuan L, Le Beau MM. Molecular characterization of KLHL3, a human homologue of the Drosophila kelch gene. Genomics 2000; 66: 6575.
  • 49
    Soltysik-Espanola M, Rogers RA, Jiang S, Kim TA, Gaedigk R, White RA, Avraham H, Avraham S. Characterization of Mayven, a novel actin-binding protein predominantly expressed in brain. Mol Biol Cell 1999; 10: 236175.
  • 50
    Bardwell VJ, Treisman R. The POZ domain: a conserved protein-protein interaction motif. Genes Dev 1994; 8: 166477.
  • 51
    Chen L, Ashe S, Brady WA, Hellstrom I, Hellstrom KE, Ledbetter JA, McGowan P, Linsley PS. Costimulation of antitumor immunity by the B7 counterreceptor for the T lymphocyte molecules CD28 and CTLA-4. Cell 1992; 71: 1093102.
  • 52
    Kawakami Y, Robbins PF, Wang RF, Rosenberg SA. Identification of tumor-regression antigens in melanoma. In: DeVitaVT, HellmanS, RosenbergSA. Important Adv Oncol 1996. Philadelphia: Lippincott-Raven, 1996: 321.
  • 53
    Kawakami Y, Eliyahu S, Delgado CH, Robbins PF, Rivoltini L, Topalian SL, Miki T, Rosenberg SA. Cloning of the gene coding for a shared human melanoma antigen recognized by autologous T cells infiltrating into tumor. Proc Natl Acad Sci USA 1994; 91: 35159.
  • 54
    Robbins PF, el-Gamil M, Kawakami Y, Stevens E, Yannelli JR, Rosenberg SA. Recognition of tyrosinase by tumor-infiltrating lymphocytes from a patient responding to immunotherapy. Cancer Res 1994; 54: 31246.
  • 55
    Wang RF, Robbins PF, Kawakami Y, Kang XQ, Rosenberg SA. Identification of a gene encoding a melanoma tumor antigen recognized by HLA-A31-restricted tumor-infiltrating lymphocytes. J Exp Med 1995; 181: 799804.
  • 56
    Parkhurst MR, Fitzgerald EB, Southwood S, Sette A, Rosenberg SA, Kawakami Y. Identification of a shared HLA-A*0201-restricted T-cell epitope from the melanoma antigen tyrosinase-related protein 2 (TRP2). Cancer Res 1998; 58: 4895901.
  • 57
    Wang RF, Johnston SL, Zeng G, Topalian SL, Schwartzentruber DJ, Rosenberg SA. A breast and melanoma-shared tumor antigen: T cell responses to antigenic peptides translated from different open reading frames. J Immunol 1998; 161: 3598606.
  • 58
    Kawakami Y, Wang X, Shofuda T, Sumimoto H, Tupesis J, Fitzgerald E, Rosenberg S. Isolation of a new melanoma antigen, MART-2, containing a mutated epitope recognized by autologous tumor-infiltrating T lymphocytes. J Immunol 2001; 166: 28717.
  • 59
    Zarour HM, Storkus WJ, Brusic V, Williams E, Kirkwood JM. NY-ESO-1 encodes DRB1*0401-restricted epitopes recognized by melanoma-reactive CD4+ T cells. Cancer Res 2000; 60: 494652.
  • 60
    Zeng G, Touloukian CE, Wang X, Restifo NP, Rosenberg SA, Wang RF. Identification of CD4+ T cell epitopes from NY-ESO-1 presented by HLA-DR molecules. J Immunol 2000; 165: 11539.
  • 61
    Kiniwa Y, Fujita T, Akada M, Ito K, Shofuda T, Suzuki Y, Yamamoto A, Saida T, Kawakami Y. Tumor antigens isolated from a patient with vitiligo and T-cell-infiltrated melanoma. Cancer Res 2001; 61: 79007.
  • 62
    McKnight GL, Reasoner J, Gilbert T, Sundquist KO, Hokland B, McKernan PA, Champagne J, Johnson CJ, Bailey MC, Holly R. Cloning and expression of a cellular high density lipoprotein-binding protein that is up-regulated by cholesterol loading of cells. J Biol Chem 1992; 267: 1213141.
  • 63
    Morikawa T, Yasuno R, Wada H. Do mammalian cells synthesize lipoic acid? Identification of a mouse cDNA encoding a lipoic acid synthase located in mitochondria. FEBS Lett 2001; 498: 1621.
  • 64
    Bork P, Doolittle RF. Drosophila kelch motif is derived from a common enzyme fold. J Mol Biol 1994; 236: 127782.
  • 65
    Way M, Sanders M, Garcia C, Sakai J, Matsudaira P. Sequence and domain organization of scruin, an actin-cross-linking protein in the acrosomal process of Limulus sperm. J Cell Biol 1995; 128: 5160.
  • 66
    Tilney LG, Tilney MS, Guild GM. Formation of actin filament bundles in the ring canals of developing Drosophila follicles. J Cell Biol 1996; 133: 6174.
  • 67
    Nishikawa H, Tanida K, Ikeda H, Sakakura M, Miyahara Y, Aota T, Mukai K, Watanabe M, Kuribayashi K, Old LJ, Shiku H. Role of SEREX-defined immunogenic wild-type cellular molecules in the development of tumor-specific immunity. Proc Natl Acad Sci USA 2001; 98: 145716.