SEARCH

SEARCH BY CITATION

Keywords:

  • methylation;
  • tumor suppressor gene;
  • CpG island;
  • colon cancer;
  • ovarian cancer;
  • renal cell carcinoma

Abstract

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

Homozygous deletion and loss of heterozygosity (LOH) at chromosome 3p21 have been observed in several types of human cancer including lung cancer and breast cancer. In previous work, we cloned and identified the human RAS association domain family 1A gene (RASSF1A) from the lung tumor suppressor locus 3p21.3. The CpG island and promoter region of RASSF1A is highly methylated in primary lung and breast tumors. In this study, we analyzed the methylation status of the promoter region of RASSF1A in 3 different tumor types: colon, ovarian and renal cell carcinoma. In colon cancers, 3 out of 26 tumor tissues (12%) were methylated at the CpG island of the RASSF1A gene. Renal and ovarian cancers showed a much higher frequency of methylation. For ovarian tumors, 8 out of 20 tumors (40%) were methylated. In renal cell carcinomas, 18 out of 32 cases (56%) were methylated. For all tumor types, none of the available normal tissues was methylated. This data suggests that methylation of the CpG island and promoter of the RASSF1A gene is common not only in lung and breast tumors but also in renal cell carcinoma and ovarian cancer. © 2001 Wiley-Liss, Inc.

It is generally thought that an accumulation of events causing activation of oncogenes or mutational inactivation of tumor suppressor genes leads to tumor progression. The functional inactivation of certain tumor suppressor genes caused by genetic alterations such as chromosome deletions or loss-of-function mutations in the coding region may play a fundamental role in tumorigenesis. Homozygous deletions and loss of heterozygosity have been detected at several chromosomal loci in solid tumors. Among these, the chromosome 3p region has been shown to have the highest incidence of genetic aberration in several types of cancer including lung cancer,1 breast cancer,2, 3 ovarian cancer4 and kidney cancer.5–10

In recent studies, loss of genetic material from chromosome 3p21.3 was identified as one of the most common and earliest events in the pathogenesis of lung cancer.11, 12 Frequent loss of heterozygosity (LOH) and the presence of homozygous deletions suggest a critical role of the region 3p21.3 in tumorigenesis and a region of common homozygous deletion was narrowed to 120 kb.12, 13

In our previous work, we cloned and characterized the RAS association domain family 1A gene (RASSF1A), a candidate tumor suppressor gene located within the minimal homozygous deletion region at 3p21.3.14 We found that inactivation of this gene in tumor cells was highly correlated with methylation of CpG sites in the promoter region. In lung cancer, 40% of the non-small cell lung tumors and more than 80% of the small cell lung tumors or cell lines were highly methylated. In addition, 62% (28 out of 45) of the analyzed breast cancers were methylated at the CpG sites of the RASSF1A promoter region.15 Methylation of the promoter region of genes has become recognized as an alternative mechanism for inactivation of tumor suppressor genes and may in fact be the most common mechanism of gene inactivation in tumors. This hypothesis was strongly supported by recent studies showing that the CpG islands in the p16, RB, VHL, APC and BRCA1 genes are frequently methylated in a variety of human cancers.16–18

Renal cell carcinoma (RCC) is the most common cancer of the kidney and occurs in sporadic and hereditary forms. Sporadic RCC usually is diagnosed during the sixth or seventh decade of life and affects only 1 kidney, whereas hereditary cases become evident at earlier age and are often bilateral. The 3p25–p26 region, which contains the von Hippel-Lindau (VHL) disease gene, has been implicated in clear cell renal carcinoma (CC-RCC).19 In CC-RCC with 3p LOH but without VHL inactivation, however, mutations in tumor suppressor genes at 3p14–p21 appear to have a primary role in tumorigenesis. Inactivation of other 3p tumor suppressor genes in addition to VHL may be required for malignant transformation in tumors with VHL gene inactivation.9, 20 In renal cell carcinoma, a major role of 3p21 has been suggested.9, 20–22 In a sizable proportion of sporadic clear cell RCCs, VHL mutations are absent and an involvement of a gene at 3p21 is suspected. The common region of homozygous deletions in the lung and breast cancer cell lines at 3p21.3 is always contained within the smallest overlapping region of heterozygous deletions in renal cell carcinomas.21, 22

Ovarian cancer is the most lethal tumor of the female genital tract and the fourth most common cause of cancer death in American women. Although ovarian cancer susceptibility genes such as BRCA genes have been identified, most cases are sporadic and somatic mutations in familial ovarian cancer genes are uncommon in sporadic cancers.4 Three candidate ovarian cancer suppressor regions have been identified for chromosome 3p by mono-chromosome transfer studies. One suppressor region overlaps with the locus at 3p21.3 previously implicated in lung and breast cancer.4

In this work, we hypothesized that the CpG island associated with the RASSF1A gene might be methylated in other types of human cancers, in addition to lung and breast cancer. Because it has been reported that loss of heterozygosity is commonly occurring at chromosome 3p in ovarian and renal cancers, we investigated the methylation status at the CpG island of RASSF1A in these cancer types. We also included colorectal carcinomas. Loss at 3p21 is uncommon for this type of malignancy.

MATERIAL AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

Tissues

Non-microdissected primary frozen tumors were classified and obtained from the pathology department of the City of Hope National Medical Center (Duarte, CA). The renal tumors were graded according to the scheme of Fuhrman et al.23

Methylation analysis

DNA was isolated from tumors and the methylation status of the RASSF1A promoter region was determined by a bisulfite sequencing protocol.14, 24 One microgram of genomic DNA was denatured in 0.3 M sodium hydroxide for 15 min at 37°C. Cytosines were sulfonated in 3.12 M sodium bisulfite (Sigma, St. Louis, MO) and 5 mM hydroquinone (Sigma) in a thermal cycler for 16 hr at 55°C. The DNA samples were desalted through columns (Wizard DNA Clean-Up System, Promega, Madison, WI), then desulfonated in 0.3 M sodium hydroxide and precipitated with ethanol. DNA sequences were amplified by mixing 100 ng of bisulfite-treated DNA with primers MU379 (5′GTTTTGGTAGTTTAATGAGTTTAGGTTTTTT) and ML730 (5′ACCCTCTTC-CTCTAACACAATAAAACTAACC) in 100 μl reaction buffer containing 200 μM of each dNTP and Taq polymerase (Roche Diagnostics Corp., Indianapolis, IN) and incubating at 95°C for 15 sec, 55°C for 15 sec and 74°C for 30 sec, for 20 cycles. A mismatch was created at a CpG site in primer MU379 to prevent biased amplification of methylated and unmethylated DNA. We think this produces less bias than a 50:50 mix of C:T. A semi-nested PCR was performed using 1/50 of the initially amplified products and an internal primer ML561 (5′CCCCACAATCCCTACACCCAAAT) and primer MU379 with similar conditions as described for the preceding PCR amplification, but for 30 cycles. The PCR products were purified using QIAquick PCR purification kits (Qiagen, Valencia, CA).

For the restriction enzyme analysis of PCR products from bisulfite-treated DNA,25 20–50 ng of the PCR products were digested with 10 U of TaqI (New England Biolabs; Beverly, MA) according to conditions specified by the manufacturer of the enzyme. The digestion products were analyzed on 2% agarose gels.

RT-PCR analysis

Total RNA from tissues was isolated by a guanidinium isothiocyanate method (RNAgents; Promega). RT-PCR was essentially performed as described.14 Briefly, 100 ng of RNA was pre-associated with of a lower primer from exon 4 of the RASSF1A gene. After the reverse transcriptase reaction, an upper primer from exon 2αβ was used in the PCR. PCR conditions were 95°C for 30 sec, 60°C for 30 sec and 74°C for 1 min, for 20 cycles for the RASSF1A gene and 15 cycles for the GAPD gene. These cycle numbers were chosen because they were in the exponential range of product amplification. PCR products were separated on 2% TBE agarose gels, blotted, hybridized with a labeled probe from exon 3 and visualized by autoradiography.

RESULTS

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

In our previous study, we found that the transcript of the RASSF1A gene was missing in lung cancer cells and loss of expression correlated with hypermethylation of the CpG island and promoter region of this gene.14 In addition, breast cancer tissues showed a high frequency of methylation of the RASSF1A CpG island, that is, all of 5 different breast cancer cell lines were methylated and 62% (28/45) of primary breast tumors were methylated.15 In the present work, we analyzed the methylation status of the RASSF1A promoter region in 3 different cancers: colon, ovarian and renal cell carcinoma.

To elucidate the methylation status of RASSF1A, we used bisulfite treatment of genomic DNA from cancer tissues. In this method, sodium bisulfite is used to convert all unmethylated cytosines to uracil, then to thymines during the subsequent PCR step. Because 5-methylcytosine remains non-reactive with bisulfite, all cytosines after the subsequent PCR represent only methylated cytosines. We analyzed a 205 bp fragment of the RASSF1A promoter region, in which 16 CpG sites, the putative transcription and translation initiation sites of RASSF1A and 3 Sp1 consensus binding sites are contained. We analyzed the methylation status by digestion with a restriction enzyme that has a CpG in its recognition sequence. We used TaqI, having a 5′TCGA3′ consensus sequence, for analysis. After bisulfite conversion and subsequent PCR, the RASSF1A PCR product has 2 TaqI sites (5′TCGA3′), at CpG sites 6 and 16, but only when the genomic DNA was methylated at these sites. Restriction digestion of these initially methylated fragments results in 3 bands of 90, 81 and 34 bp (the 90 and 81 bp fragments migrate together; the 34 bp band is not visible on the gels). If neither of the 2 sites was methylated, only 1 band of 205 bp would be expected (Fig. 1).

thumbnail image

Figure 1. Overview of the experimental procedure to analyze methylation of the RASSF1A CpG island. A 205 bp DNA sequence of the RASSF1A promoter region and its bisulfite-converted PCR sequence is shown. This DNA fragment has 3 Sp1 binding sites and 16 CpG sequences. CpG sites 6 and 16 are contained within a TaqI consensus sequence after PCR amplification of bisulfite-treated methylated DNA templates (5′TCGA3′). Single strand, “A” indicates an original adenine, whereas “a” indicates an original guanine.

Download figure to PowerPoint

First, we analyzed methylation of the RASSF1A CpG island in colon cancer tissues. From 8 tumors shown in Figure 2, 3 were partially methylated: CC1, CC3 and CC8. TaqI cut CC8 DNA at both CpG sites, whereas the CC3 sample was predominantly cut at CpG site 16 giving rise to a fragment of 171 bp (Fig. 2a). None of the normal tissues was methylated (Fig. 2b). Eighteen additional colon cancer tissues and 5 additional normal tissues were analyzed (Table I). Together, only 3 out of 26 tumors (12%) were methylated and none of the normal tissues (0/10 = 0%) was methylated.

thumbnail image

Figure 2. Methylation analysis of the RASSF1A gene in colon cancer by restriction digestion with TaqI. PCR products from bisulfite-treated DNA obtained from primary tumors (a) and normal tissues (b) were digested (+) or mock-digested (−) with TaqI. The numbers of CN (normal colon tissues) are matching numbers of CC (colon carcinomas). The sizes of molecular weight markers (M) are shown on the right and left.

Download figure to PowerPoint

Table I. Summary of the Methylation Analysis
CaseMethylation
Colon cancer
 26 primary colon tumors3/26 (12%)
 25 adenocarcinomas3/25 (12%)
  10 poorly differentiated1 (10%)
  13 moderately differentiated2 (15%)
  2 well differentiated0
 1 cecal polyp0
 10 normal colon tissues0/10 (0%)
Ovarian cancer
 20 primary ovarian tumors8/20 (40%)
 16 carcinomas8/16 (50%)
  7 poorly differentiated4/7 (57%)
  3 moderately differentiated1/3 (33%)
  3 well differentiated3/3 (100%)
  3 unknown0/3 (0%)
 1 ovarian fibroma0
 1 lipoma0
 2 unclassified0
 10 normal tissues0/10 (0%)
Renal cancer
 32 primary renal tumors18/32 (56%)
 26 adenocarcinomas16/26 (62%)
 6 unclassified2/6 (33%)
Grade (I–IV)
 1 Grade I0
 5 Grade II0
 8 Grade III6 (75%)
 18 grading not available12 (67%)
 10 normal tissues0/10 (0%)

Next, we analyzed 20 ovarian tumor samples. Eight tumors (40%) were methylated including 8/16 (50%) of the carcinomas (Fig. 3; Table I). Some samples showed only very low levels of methylation (e.g., OC2, OC8). These were not counted as methylated. For 3 tumors, matching normal tissue was available (Fig. 3b). Normal tissue DNA was not methylated, whereas 1 corresponding tumor (OC11) was methylated.

thumbnail image

Figure 3. Methylation analysis of the RASSF1A gene in ovarian cancer by restriction digestion with TaqI. (a) ovarian cancers, (b) matching normal tissues and tumors. OC indicates DNA samples from ovarian primary tumors and ON are samples from matching normal tissue.

Download figure to PowerPoint

We also analyzed 32 tumors and 10 matching normal tissues of renal cell carcinomas. Figure 4 shows the methylation status of several renal cancers and normal tissues. Eighteen of 32 tumors (56%) were methylated and all 10 normal tissues tested were unmethylated (Fig. 4a,b). Sixteen of these tumors were classified as clear cell RCCs and 10/16 (62%) of these were methylated. According to the grading system available, it seems that grade III tumors were more commonly methylated (6/8) than grade I and II tumors (0/6; Table I). This difference is statistically significant (p = 0.0097; Fisher's exact test, 2-sided). Some of the RCCs (samples RC1, RC2, RC6, RC9) show particularly high levels of methylation indicated by almost complete cutting with TaqI (Fig. 4a).

thumbnail image

Figure 4. Methylation analysis of the RASSF1A gene in renal cell carcinomas. (a) renal cancers, (b) matching normal tissues. RC, renal cell carcinoma; RN, normal kidney tissue from a matching tumor.

Download figure to PowerPoint

To confirm that methylation of the RASSF1A CpG island was not limited to the TaqI sites, we determined the methylation status of other CpG sites by direct sequencing analysis (Fig. 5). All CpGs in samples RC1 and RC6 were methylated. In sample RC7, however, some CpG sites including site 6 were unmethylated, consistent with the restriction analysis (Fig. 4a), but it was methylated at several other CpG sites including site 16 (data not shown).

thumbnail image

Figure 5. Sequence analysis of PCR products from bisulfite-treated DNA obtained from 3 renal cell carcinomas. Methylated cytosines appear as a G signal in the complementary strand at CpGs. The positions of several CpGs and a TaqI restriction site are indicated. The sequencing data is for the 3 renal cell carcinomas RC1, RC6and RC7. Data were obtained by direct sequencing of PCR products from bisulfite-treated DNA.

Download figure to PowerPoint

We performed RT-PCR analysis on primary tumors to determine the expression levels of RASSF1A (Fig. 6). We were able to obtain good quality RNA from 4 matched samples of normal tissue and ovarian or renal cell carcinomas in which the tumor DNA was methylated. In Figure 6, we show by semi-quantitative RT-PCR, that expression of RASSF1A is almost undetectable in the tumor tissues but is present in the normal matching tissues. Lack of expression was seen even in samples that have partially unmethylated DNA. This could be due to mosaic methylation patterns, not detectable by the restriction assay, or to mechanisms other than methylation of the promoter sequence of RASSF1A, e.g., lack of transactivating factors.

thumbnail image

Figure 6. Expression of RASSF1A in primary ovarian and renal cancer samples and matching normal tissue controls. RASSF1A and GAPD were analyzed by RT-PCR using PCR cycle numbers chosen to give product amplification in the exponential range. N, normal tissue; T tumor. Matching samples are indicated by straight lines. For some tumors, no matching normal RNA was available.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

One of the major mechanisms of tumor progression is thought to be the inactivation of tumor suppressor genes. This inactivation can be induced by mechanisms such as chromosomal deletion and loss of function mutation in the coding region of genes or by epigenetic alteration in the form of methylation of promoter regions.17, 18 In recent reports, several genes including tumor suppressor genes and DNA repair genes (such as p16, MGMT, VHL, MLH1 and BRCA1) were shown to be subject to this mechanism of epigenetic inactivation by methylation in tumors. The VHL tumor suppressor gene has been associated with the development of renal cancers.9, 26 Besides mutations in the VHL coding sequence, a number of kidney tumors were reported to be methylated at the CpG island containing the VHL promoter region.9, 27–29 Our data indicate that methylation of the RASSF1A gene on 3p21.3 is a common aberration in renal cell carcinomas and occurs in 56% of the analyzed tumors. Both renal cell carcinomas and ovarian cancers show a coincidence of substantial frequencies of LOH at 3p21.34, 9, 11, 21, 22 and methylation of the RASSF1A promoter region. On the other hand, LOH at 3p21.3 has not commonly been reported in colon tumors and, according to our data, the methylation frequency is also low (12%). Unfortunately, we did not have a sufficient number of matching normal tissue samples and tumors available to derive statistically meaningful correlations between methylation of RASSF1A and LOH at 3p21.3. A low CpG island methylation frequency, however, is not typical for colon cancer. Genes found to be commonly hypermethylated in colon tumors are the MLH1 gene,30–32 the MGMT gene,33 the APC gene34, 35 and the p16 gene.36, 37 Genes that have been reported to be methylated in kidney tumors are the tissue inhibitor of metalloproteinase-3 (TIMP3) gene38 and the VHL gene.9, 26, 27 For ovarian cancer, methylation levels have been analyzed for various genes, such as p16, BRCA1 and MLH1, but, with the possible exception of p16,39 the methylation frequencies reported were generally quite low.40–42

In our previous study, we found that the RASSF1A gene was epigenetically silenced in 40% of the analyzed primary non-small cell lung tumors and in several different cancer cell lines.14 Furthermore, the methylation of RASSF1A promoter region showed an even higher frequency of methylation in breast tumors (62%)15 and primary small cell lung cancers (79%).43 The precise function of the RASSF1A gene is unknown. The protein has about 50% homology to the mammalian Ras-binding protein Nore1.44 Another splice variant of the RASSF1 locus (termed RASSF1C) was shown to induce apoptosis in a Ras-dependent manner.45

The results presented here suggest that methylation of the RASSF1A promoter has a critical role in tumor development, is not limited to lung and breast cancer, but is extending to several other cancers. This data supports the idea that the RASSF1A gene may have a fundamental role as a tumor suppressor gene for several types of human solid tumors.

Acknowledgements

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES

We thank Sharon Wilczynski and Jeff Longmate for discussions.

REFERENCES

  1. Top of page
  2. Abstract
  3. MATERIAL AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. Acknowledgements
  7. REFERENCES