SEARCH

SEARCH BY CITATION

Keywords:

  • protein serine-threonine kinases;
  • pre-malignant lesions;
  • hepatocellular carcinoma;
  • RNA interference;
  • apoptosis

Abstract

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. References

Most cases of human hepatocellular carcinoma develop after persistent chronic infection with human hepatitis B virus or hepatitis C virus, and host responses are presumed to have major roles in this process. To recapitulate this process, we have developed the mouse model of hepatocellular carcinoma using hepatitis B virus surface antigen transgenic mice. To identify the genes associated with hepatocarcinogenesis in this model, we compared the gene expression patterns between pre-malignant lesions surrounded by hepatocellular carcinoma tissues and control liver tissues by using a fluorescent differential display analysis. Among the genes that were expressed differentially in the pre-malignant lesions, we focused on Pim-3, a member of a proto-oncogene Pim family, because its contribution to hepatocarcinogenesis remains unknown. Moreover, the unavailability of the nucleotide sequence of full-length human Pim-3 cDNA prompted us to clone it from the cDNA library constructed from a human hepatoma cell line, HepG2. The obtained 2,392 bp human Pim-3 cDNA encodes a predicted open reading frame consisting of 326 amino acids. Pim-3 mRNA was selectively expressed in human hepatoma cell lines, but not in normal liver tissues. Moreover, Pim-3 protein was detected in human hepatocellular carcinoma tissues and cell lines but not in normal hepatocytes. Furthermore, cell proliferation was attenuated and apoptosis was enhanced in human hepatoma cell lines by the ablation of Pim-3 gene with RNA interference. These observations suggest that aberrantly expressed Pim-3 can cause autonomous cell proliferation or prevent apoptosis in hepatoma cell lines. © 2004 Wiley-Liss, Inc.

Hepatocellular carcinoma (HCC) is the 8th highest cause of death among human cancers and is endemic in Asia, Africa and southern Europe. Most cases of HCC arise from persistent chronic infection with human hepatitis B virus (HBV) or hepatitis C virus (HCV).1 Host responses are presumed to be involved in the development of HCC among patients harboring HBV or HCV, because these viruses lack apparent oncogenes and the infected patients develop HCC after suffering from chronic hepatitis-related pathology.2, 3

Hepatitis virus infection induces the generation of virus antigen-specific cytotoxic T lymphocytes, which have been implicated in both the eradication of viruses and liver injury.4 Cycles of cytotoxic T lymphocyte-mediated liver cell destruction and regeneration are thought to prepare the mitogenic environment.4, 5 To elucidate the molecular and cellular mechanism of HCC initiation and development, Nakamoto et al.6 has established a mouse model of HCC by using HBV surface antigen (HBsAg) transgenic mice (HBsTg). In this model, bone marrow cells and splenocytes were obtained from syngeneic wild-type mice, which were immunized with HBsAg and were transplanted into HBsTg mice, which were irradiated beforehand. At 15 months after the transplantation, the transgenic mice developed multiple foci of HCC surrounded by non-malignant areas consisting of hepatocytes with atypical nuclear configuration.6, 7

To obtain the molecular insights on hepatocarcinogenesis, we compared the gene expression pattern between non-tumor portion of this model as a pre-malignant lesion and normal tissues by using a fluorescent differential display (FDD) analysis. We observed that several genes are expressed differentially in this pre-malignant lesion, compared to normal liver tissues. Of interest is that the gene expression of Pim-3, originally identified as depolarization-induced gene in a rat pheochromocytoma cell line,8 was enhanced in this pre-malignant lesion. We demonstrated that Pim-3 was expressed aberrantly in human HCC tissues and hepatoma cell lines but not normal liver tissues. We also provided evidence to suggest the involvement of Pim-3 in the proliferation of human hepatoma cell lines.

Material and methods

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. References

Experimental animals

HBsAg transgenic mouse lineage 107-5D (official designation Tg[Alb-1,HBV]Bri66; inbred B10D2, H-2d) was provided by Dr. F.V. Chisari (The Scripps Research Institute, La Jolla, CA).9 Lineage 107-5D contains the entire HBV envelope-coding region (subtype ayw) under the transcriptional control of the mouse albumin promoter, and expresses the HBV small, middle and large envelope proteins in their hepatocytes.9 They display no evidence of liver disease during their lifetime unless they receive the adoptive transfer of HBsAg-specific cytotoxic T lymphocytes,9 due to their immunological tolerance to the HBs transgene at the T cell level.10

Chronic hepatitis-related liver disease model was generated as described previously.6 Briefly, after male HBsAg transgenic mice were thymectomized and irradiated (900 cGy), their hematopoietic system was reconstituted with the bone marrow cells from syngeneic non-transgenic B10D2 (H-2d) mice. At 1 week after the bone marrow transplantation, the animals received 108 splenocytes from syngeneic non-transgenic B10D2 (H-2d) mice that were infected intraperitoneally with a recombinant vaccinia virus expressing HBsAg 3 wk before the splenocyte transfer. At 12–15 months after the lymphocyte transfer, multiple HCC foci developed in mice.6, 7 Non-tumor and tumor portions were demarcated macroscopically and were removed separately. A pathologist without a prior knowledge on the experimental procedures confirmed the presence of hepatocytes with atypical configurations but not malignant cells in this non-tumor potion. Non-tumor portions were designated as pre-malignant lesions in the following experiments. Liver tissues were also obtained from untreated or HBsTg mice transplanted with tolerant splenocytes as a control.

Fluorescent differential display

Total RNAs extracted from liver tissues were subjected to FDD according to the method described by Ito et al.11 Briefly, total RNAs were isolated with RNA-Bee (Tel-Test, Inc., Friendswoods, TX), followed by the treatment with RNase-free DNase (Takara Shuzo, Kyoto, Japan). The purified total RNAs (2.5 μg) were reverse-transcribed with SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA) and fluorescein-labeled anchor primer, GT15A, GT15C or GT15G. The resultant cDNA equivalent to 50 ng of RNA was subjected to polymerase chain reaction (PCR) with 0.5 μM anchor primer, 0.5 μM arbitrary primer (10 mer kit A; Operon Biotechnology, Huntsville, AL), 50 μM each dNTP, 1 unit of Gene Taq DNA polymerase (Nippon Gene, Toyama, Japan), and 1 U of Taq DNA polymerase (Takara Shuzo). PCR products were separated with 6% polyacrylamide-8 M urea gel and analyzed by employing Vistra Fluor Imager SI (Molecular Dynamics, Sunnyvale, CA). The bands of interest were excised from the gel and cloned into pSTBlue-1 Vector (Novagen, San Diego, CA). The inserted cDNA was sequenced with CEQ 2000 DNA Analysis System (Beckman Coulter, Fullerton, CA) and analyzed with the BLAST program to search the GenBank database.

Cell culture

Human hepatoma cell lines (HepG2, Hep3B, HLE, HLF, HuH7 and SK-Hep1) were maintained in DMEM (Sigma-Aldrich, St. Louis, MO) supplemented with 10% heat-inactivated FBS (Atlanta Biologicals, Norcross, GA) at 37°C in a humidified atmosphere with 5% CO2 in the air.12

Semi-quantitative RT-PCR

Total RNAs were isolated with RNA-Bee, followed by the treatment with RNase-free DNase (Takara Shuzo), and a semi-quantitative RT-PCR analysis was carried out as described previously.13 The cDNA was amplified using the sets of the primers that specifically amplify Pim family kinases and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The sequences are as follows; Pim-1, sense 5′-CCCGAGCTATTGAAGTCTGA-3′, antisense 5′-CTGTGCAGATGGATCTCAGA-3′; Pim-2, sense 5′-CATCCCCAGCAGCTCTTTAG-3′, antisense 5′-CAGTAGGGTCCCTCACCAAA-3′; Pim-3, sense 5′-AAGCAGTGACCTCTGACCCCTGGTGACC-3′, antisense 5′-CAGCGGAACCGCTCATTGCCAATGG-3′; GAPDH, sense 5′-ACCACAGTCCATGCCATCAC-3′, antisense 5′-TCCACCACCCTGTTGCTGTA-3′. The resultant PCR products were separated on 1.5% agarose gel and visualized by ethidium bromide staining. The band intensities were measured using NIH Image Analysis Software Ver 1.61 (National Institutes of Health, Bethesda, MD) and the ratios to GADPH were calculated.

cDNA library construction and screening

Total RNA was isolated from HepG2 cell line and polyA mRNA was further separated from total RNA by Oligotex-dT30 mRNA Purification kit (Takara Shuzo). cDNA was synthesized with SuperScript II reverse transcriptase (Invitrogen) and oligo-dT primer, and cDNA library was constructed in pCMVSPORT6 (Invitrogen) with Escherichia coli DH10B (Invitrogen), according to the manufacturer's instructions. The initial screening was carried out using GENE TRAPPER® cDNA Positive Selection System (Invitrogen) and the oligomer, CTGTGAAGCACGTGGTGAAG, as a probe. The obtained colonies were subjected to colony PCR screening with the sets of primers described above. The inserted cDNA was sequenced with CEQ 2000 DNA Analysis System (Beckman Coulter).

Northern blot analysis

Human Pim-3 mRNA expression was analyzed by using Human 12-Lane MTN Blot (Clontech, Palo Alto, CA). In vitro transcribed digoxigenin-labeled probes were hybridized overnight at appropriate temperatures (70°C for Pim-3 and 68°C for GAPDH). After being washed sequentially each for 15 min in 2× and 0.5× SSC buffer containing 0.1% sodium dodecyl sulfate at room temperature and at 68°C, respectively, the hybridized probes were detected by the DIG detection kit (Boehringer Mannheim Biochemicals, Mannheim, Germany), according to the manufacturer's instructions.

Preparation of anti-Pim-3 polyclonal antibodies

Anti-Pim-3 antibodies were prepared by Asahi Techno Glass Co. (Tokyo, Japan). Briefly, chickens were immunized with keyhole limpet hemocyanin-conjugated Pim-3 peptide, CGPGGVDHLPVKILQPAKAD, which corresponds to the amino acid residues between 13–32 in human Pim-3 and is conserved in murine Pim-3, and their egg yolks were harvested before and after the immunization. IgY proteins were purified with EGGstract IgY Purification System (Promega, Madison, WI) according to the manufacturer's instructions. They were affinity-purified with Pim-3 peptide conjugated NHS-activated HP (Amersham Biosciences, Tokyo, Japan). Purified antibodies were quantified by measuring the absorbance at 280 nm.

Immunohistochemical analysis

Human liver specimens were surgically obtained from the patients with their informed consent. Mouse liver tissues were obtained from HBsTg mouse at the indicated time intervals after splenocyte transfer. Paraffin-embedded tissue sections were deparaffinized in xylene and rehydrated through graded concentrations of ethanol (70–100%). After incubation with 0.3% hydrogen peroxide in 10 mM phosphate buffer, pH 7.4, containing 150 mM NaCl (PBS [−]), sections were incubated sequentially with 3% normal rabbit serum (DAKO, Kyoto, Japan) and 2% BSA in PBS (−) and with Avidin-Biotin blocking kit (Vector Laboratories, Burlingame, CA). Slides were treated subsequently with 10 μg/ml anti-Pim-3 IgY or pre-immunized IgY at 4°C overnight, followed by the incubation with 2.5 μg/ml biotin-conjugated rabbit anti-chicken IgY antibodies (Promega) at room temperature for 30 min. The immune complexes were visualized by using the Vectastain Elite ABC kit (Vector Laboratories) and Vectastain DAB substrate kit (Vector Laboratories) according to the manufacturer's instructions. The slides were counterstained with hematoxylin (DAKO), mounted, and observed under a microscope (BX-50; Olympus, Tokyo, Japan).

Immunocytochemical analysis of HuH7 cells

Cells were cultured on Lab-Tec chamber slides (Nalge Nunc, Roskilde, Denmark). They were fixed with 4% paraformaldehyde in PBS (−) and permeated in methanol. Then, they were blocked by incubation with 3% normal rabbit serum and 2% BSA in PBS (−) at room temperature for 30 min, and with Avidin-Biotin blocking kit. They were treated subsequently with 20 μg/ml affinity-purified anti-Pim-3 IgY or pre-immunized IgY at 4°C overnight, with 2.5 μg/ml biotin-labeled rabbit anti-chicken IgY at room temperature for 30 min. The signals were amplified and visualized by the Vectastain Elite ABC kit and Vectastain DAB substrate kit according to the manufacturer's instructions. The slides were counterstained with methyl green (DAKO), mounted, and observed under a microscope (BX-50; Olympus).

RNA interference

Short interfering RNA (siRNA) was synthesized with Silencer siRNA Construction Kit (Ambion, Austin, TX) according to the manufacturer's instructions. By employing siRNA Target Finder and Design Tool (Ambion), siRNA duplexes were designed to target AA(N19)UU sequences in the open reading frame of mRNA encoding Pim-3. The selected siRNA target sequence (5′-GCACGUGGUGAAGGAGCGG-3′ corresponding to 642–661) was further subjected to BLAST searches against other human genome sequences to ensure its target specificity. We identified 2 distinct cDNAs, which exhibit identity with the target sequence at 16 of 19 nucleotides. We could not, however, detect any specific bands corresponding to these cDNAs in HuH7 and Hep3B cell lines by RT-PCR analysis (our unpublished data), further indicating the specificity of the used target sequence. Scramble siRNA (5′-GCGCGCUUUGUAGGAUUCG-3′ designed by B-Bridge International, Inc.) was used as a negative control. Each siRNA duplex (final concentration 50 nM) was mixed with 12.5 μl and 12 μl of Lipofectamine 2000 (Invitrogen) for HuH7 and Hep3B, respectively. The mixtures were added into 2.5 ml of Opti-MEM (Invitrogen) and allowed to stand at room temperature for 20 min. The final mixture was then added directly into the semi-confluent cells in 6-cm culture dishes, which were washed with serum-free DMEM beforehand. The following day, 2.5 ml of DMEM plus 20% FBS medium was added to adjust the FBS concentration to 10%. At the indicated time intervals, cells were harvested for further analyses.

Semi-quantitative RT-PCR analysis of siRNA transfectant

Hep3B and HuH7 cells were harvested at 2 and 4 days after the transfection, respectively. Total RNAs were extracted and a semi-quantitative RT-PCR analysis was carried out as described above. The cDNA was amplified using the sets of the primers that specifically amplify Pim-3 (sense 5′-ATGCTGCTCTCCAAGTTCGGCTCCCTGGCG-3′, antisense 5′- TCCTGTGCCGGCTCGGGTCGCTCCAGCACC-3′) and GAPDH.

Cell proliferation assay

Cells were trypsinized at 2 days after the transfection, and 5 × 103 cells were plated to each well of 96-well plate. This time point was designated as Day 0. The cell viability was determined every day using WST-1 reagent (an MTT analog from Boehringer-Mannheim Biochemicals) according to the manufacturer's instructions. The ratios to Day 0 were calculated.

Cell-cycle analysis by a flow cytometry

HuH7 cells were harvested at 4 days after the transfection and fixed with graded concentrations of ethanol on ice. They were incubated with 50 μg/ml propidium iodide and 1 μg/ml of RNase A for 30 min at room temperature and quenched by adding EDTA to a final concentration of 10 μM. The filtered cells were analyzed using a FACSCalibur (Becton Dickinson, Bedford, MA). The distribution in each cell-cycle phase was determined by using Cell Quest analysis software (Becton Dickinson).

Chromatin condensation analysis by Hoechst 33258

HuH7 and Hep3B cells were harvested at 4 days after the transfection and stained with Hoechst 33258 to detect the cells with condensed nuclei under a fluorescence microscope (BX-50; Olympus).

Results

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. References

Identification of the genes differentially expressed in pre-malignant liver tissue

We compared the gene expression patterns between pre-malignant lesions and normal liver tissues by employing a FDD method. The determination of the nucleotide sequence of the resultant bands identified 24 and 19 distinct genes among the upregulated and downregulated bands in pre-malignant lesions, respectively (Table I). Among these genes, Pim-3 expression has not been reported in normal hepatocytes. We focused on Pim-3, a member of proto-oncogene Pim family including Pim-1 and Pim-2. A semi-quantitative RT-PCR analysis confirmed that Pim-3 mRNA expression was significantly enhanced in the pre-malignant tissues and to a lesser degree, in HCC tissues, compared to control (Fig. 1). In contrast, specific Pim-1 and Pim-2 transcripts were barely detected under these conditions (Fig. 1). These results indicate that Pim-3 mRNA expression is enhanced during HCC development in this model.

Table I. Identification of Genes Differentially Expressed in Pre-Malignant Lesion of HBsTg Mice
ClassificationDescriptionAccession number
Upregulated  
 Transcription factorsY box protein 3AK029441
 Immune system proteinsComplement component 3BC043338
 Xenobiotic metabolismCeruloplasminNM_00775
 Metallothionein IIAK002567
 Oncogenes24p3 (lipocalin 2)X81627
 Metabolism enzymesAldehyde dehydrogenase family 1, subfamily A1BC044729
 Hemoglobin α, adult chain 1NM_008218
 Phosphoenolpyruvate carboxy-kinase 1NM_011044
 Succinate dehydrogenase complex, subunit A flavoproteinBC031849
 Growth factors, cytokines, and chemokinesGrowth differentiation factor 15 (macrophage inhibiting compound-1)NM_011819
 Insulin-like growth factor binding protein 1NM_008341
 Non-receptor protein kinasesSerine/threonine kinase pim-3NM_145478
 Not classifiedBetaKlothoAF178429
 Pol proteinXM_196572
 Serine (or cysteine) proteinase inhibitor, clade A, member 6NM_007618
 Putative proteinsHypothetical Esterase/acetylhydrolase structure containing proteinNM_026347
 Putative el proteinAK090127
 Similar to bile acid Coenzyme A: amino acid N-acyltransferaseNM_145368
 Est AW047153
  BE132832
  BB168703
  BM224373
 UnknownFibronectin non-coding region 
 Hypothetical protein non-coding region chromosome 5 
Downregulated  
 Immune system proteinsβ2-microglobulinM84367
 Complement component CISAAF459017
 Extracellular transport/carrier proteinsSerum amyloid A-1M13521
 Metabolism enzymesCytochrome P450 4A10BC031141
 Hemoglobin β, adult major chainAK027904
 Stearoyl-Coenzyme A desaturase 1BC007474
 Isocitrate dehydrogenase 1 (NADP+), solubleAK087063
 Not classifiedEndogenous retrovirus 3′ LTRK02892
 Glutatione S-transferaseBC009805
 Group 1 major urinary proteinX03208
 Major urinary protein 1BC012221
 Major urinary protein 2BC012259
 Major urinary protein 3XM_135398
 Major urinary protein 11 and 8AK011413
 Preimplantation protein 2AK028563
 Ubiquitin-associated protein 1NM_023305
 Mitchondrial geneCytochrome oxidase A1V00711
 Putative proteinsArcheraseAY071852
 Dis3 protein homologAK032091
thumbnail image

Figure 1. Semi-quantitative RT-PCR analysis for proto-oncogene Pim family mRNA expression in HBsTg mice. (a) Total RNAs were extracted from HBsTg ice before (N), 9 (whole liver, 9), 15 months (pre-malignant lesions, 15) after splenocyte transfer, or transgenic splenocytes transfer (C). (b) Total RNAs were extracted from pre-malignant (P) or malignant (M) tissues of HBV transgenic mice 15 months after splenocyte transfer. Representative results from 3 independent experiments are shown in the upper panels. The ratios of the PCR product for Pim-3 to GAPDH were determined, and relative intensities were calculated to assume the ratio of untreated mice as 1.0. Means and SD were calculated and are shown in the lower panels. Statistical significance was evaluated using ANOVA test, and p < 0.05 was accepted as statistically significant. *p < 0.05 compared to N.

Download figure to PowerPoint

We further localized Pim-3 protein immunohistochemically in liver tissues obtained from HBsTg mouse after splenocyte transfer. We failed to detect Pim-3 protein in unmanipulated mice (Fig. 2a) or 9 months after splenocyte transfer, when hepatocytes with atypical nuclear configuration were not detected (data not shown). On the contrary, Pim-3 protein was weakly detected in the cytoplasm of hepatocytes with atypical nuclear configurations in pre-malignant lesion (Fig. 2b,e) and highly differentiated neoplastic hepatocytes in the tumor portion7 (Fig. 2c,f). Moreover, Pim-3 protein was detected in regenerated proliferating bile ductules (Fig. 2d, arrow), which are assumed to be the proliferation of hepatic stem cells after chronic liver injuries (i.e., infection, tumors).14 These results may indicate that Pim-3 protein expression was aberrantly enhanced in liver during the course of hepatocarcinogenesis in this model.

thumbnail image

Figure 2. Immunohistochemical analysis of Pim-3 in HBsTg mice. HBsTg mice liver tissues before (a) and 15 months after splenocyte transfer (b,d,e: non-tumor portions; c,f: tumor potions) were immunostained by anti-Pim-3 IgY as described in Material and Methods. Representative results are shown here. (b) Pre-malignant lesion is indicated with arrowheads. (c) Tumor portion is indicated with arrowheads. (d) Positively-stained regenerated proliferating bile ductule. The arrow indicates regenerated proliferating bile ductule. (e,f) Positively-stained hepatocytes at a higher magnification of the square in (b) and (c). Original magnification = (ac) ×100; (df) ×400. Scale bars = 50 μm.

Download figure to PowerPoint

Cloning and determination of nucleotide sequence of human Pim-3

Because the full length human Pim-3 cDNA nucleotide sequence has not been determined yet, we initially cloned and determined the nucleotide sequence of human Pim-3 cDNA by screening cDNA library constructed from a human hepatoma cell line, HepG2. Three positive clones were obtained after 2 rounds of screening, and these 3 distinct cDNA clones contained the same insertion consisting of 2,392 bp. The 5′-untranslated region is 82.3% G and C, whereas the 3′-untranslated region contains 5 copies of the ATTTA motif and 8 copies of TATT motif (Fig. 3a). This sequence exhibits an identity with a partial human Pim-3 cDNA sequence predicted from EST database (data not shown).15 Its open reading frame encodes the protein consisting of 326 amino acids with a calculated molecular weight of 35,861 (Fig. 3a). Moreover, the amino acid sequence of the predicted open reading frame, shares a high degree of identity with the mouse16 and rat Pim-3 (KID-1)8 proteins (95.0%; Fig. 3b). Based on these results, we judged this clone as human Pim-3 cDNA. Human Pim-3 protein showed a high sequence identity with the quail qPim17 (73.9%) and Xenopus Pim (Pim-1)18 (68.7%) at the amino acid level (data not shown). Moreover, human Pim-3 protein shows a high sequence identity with human Pim-119 (57.1%) and Pim-220 (44.0%) at the amino acid level (Fig. 3c). Northern blotting analysis detected 2.4-kb mRNA in various organs including heart, skeletal muscle, brain, spleen, kidney, placenta, lung and peripheral blood leukocytes (Fig. 4). In contrast, no specific band was detected in colon, thymus, liver and small intestine under the present experimental conditions (Fig. 4).

thumbnail image

Figure 3. (a) Structure of human Pim-3 cDNA. The nucleotide and predicted amino acid sequences of human Pim-3 are shown. The nucleotide sequence is numbered. The predicted amino acid sequence is shown in a single-letter code below the nucleotide sequence. The AT-rich motifs are indicated in boxes and highlights. The region used as the probe for Northern blot analysis is underlined. (b,c) Amino acid alignment of Pim family proteins. The amino acid sequences of human, rat, and mouse Pim-3s (b) or other members of human Pim family kinases (c) were aligned using DNASIS-Mac version 3.0 software (Hitachi Software Engineering Co., Ltd., Yokohama, Japan). The residues identical to human Pim-3 are highlighted.

Download figure to PowerPoint

thumbnail image

Figure 4. Human Pim-3 mRNA expression in human normal tissues. Northern blot analysis was carried out as described in Material and Methods. Representative results are shown. sk, muscle, skeletal muscle; PBL, peripheral blood leukocytes. GAPDH mRNA expression was analyzed in parallel to evaluate the amount of mRNA loaded in each lane.

Download figure to PowerPoint

Pim-3 is expressed aberrantly in human HCC

Immunohistochemical analysis failed to detect Pim-3 protein in normal liver tissues (Fig. 5a), consistent with the Northern blotting analysis. On the contrary, Pim-3 protein was weakly but diffusely detected in most of large regenerative nodules and adenomatous hyperplasia, lesions with precancerous potential, which were located adjacent to HCC areas (19 of 27 cases; Fig. 5b,c). Moreover, a substantial proportion of HCC cells were immunostained with anti-Pim-3 IgY (6 of 27 cases; Fig. 5d,e) but not the pre-immunized IgY (data not shown). Furthermore, Pim-3 protein was observed markedly in regenerated proliferating bile ductules (27 of 27 cases; Fig. 5c,f, arrows). Because the staining patterns were similar to that observed in HBsTg mouse model (Fig. 2), these results would indicate that Pim-3 protein expression was aberrantly enhanced in precancerous lesion, also in humans, and a portion of HCC cells.

thumbnail image

Figure 5. Immunohistochemical analysis of Pim-3 in HCC tissues. Human normal liver tissue (a) or HCC tissues (bf) were immunostained by anti-Pim-3 IgY as described in Material and Methods. Representative results are shown. (b) Precancerous lesions. The lesions surrounded with arrowheads and arrows are precancerous lesions and HCC lesions, respectively. (c) Precancerous lesion in the square of (b) is shown at a higher magnification. Arrows indicate regenerated proliferating bile ductules. (d,e) Positively-stained HCC cells. (e) Indicates the square in (d) at a higher magnification. (f) Positively-stained regenerated proliferating bile ductules at a higher magnification of the square in (d). Arrows indicate regenerated proliferating bile ductules. Original magnification: (a,b,d) 100; (c,e,f) ×400. Scale bars = 50 μm.

Download figure to PowerPoint

Constitutive Pim-3 expression in human hepatoma cell lines

Immunohistochemical analysis indicated that Pim-3 protein expression was aberrantly enhanced not only in precancerous lesion but also in a portion of HCC cells in human HCC tissues (Fig. 5). This finding prompted us to examine Pim-3 expression in human hepatoma cell lines, by RT-PCR. To exclude the possibility that contaminated genomic DNA gave rise to the generation of the amplified bands, we used total RNA samples that were treated with DNase. Under the present condition, Pim-3 transcript was detected in all hepatoma cell lines, whereas no specific band was detected in the normal liver tissue (Fig. 6a), consistent with the Northern blotting analysis. The exclusion of reverse transcriptase failed to give rise to any bands, further indicating the specificities of RT-PCR (Fig. 6a; non-RT). Moreover, an immunocytochemical analysis detected immunoreactive Pim-3 proteins in HuH7 cell line, when incubated with anti-Pim-3 antibodies (Fig. 6b[a]) but neither pre-immunized IgY (Fig. 6b[b]) nor anti-Pim-3 adsorbed with the relevant peptide (Fig. 6b[c]). Immunoreactive Pim-3 proteins were similarly detected in all 6 human hepatoma cell lines, consistent with RT-PCR analysis (data not shown). Collectively, these results would indicate that Pim-3 was constitutively expressed in human hepatoma cell lines.

thumbnail image

Figure 6. (a) Pim-3 mRNA expression in various human hepatoma cell lines. Total RNAs were extracted from human hepatoma cell lines and normal liver tissue. RT-PCR was carried out. Representative results from 3 independent experiments are shown here. Analysis for Pim-3 expression was carried out without reverse transcriptase treatment and the results are shown as non-RT. (b) Pim-3 protein expression in HuH7 cells. HuH7 cells were immunostained by anti-Pim-3 IgY (b[a]), by pre-immunized IgY (b[b]), or by anti-Pim-3 antibodies absorbed with the relevant peptide (b[c]) as described in Material and Methods. Representative results from 3 independent experiments are shown. Original magnification = ×400. Scale bars = 50 μm.

Download figure to PowerPoint

RNAi ablation of Pim-3 induces cell death to hepatoma cell lines

Because Pim-1 and Pim-2 were required to induce cell-cycle progression21, 22 and anti-apoptotic effects,21, 22, 23, 24, 25 we examined the role of Pim-3 in cell proliferation by ablating endogenous Pim-3 mRNA expression in HuH7 and Hep3B cell lines with RNAi. Endogenous Pim-3 mRNA level was decreased after the transfection with specific Pim-3 siRNA but not Scramble siRNA (Fig. 7a). Under these conditions, transfection with Pim-3 siRNA significantly retarded cell proliferation, compared to Scramble siRNA-transfected and the control cells (Fig. 7b,c). These results suggested that Pim-3 ablation has adverse effects on the proliferation of hepatoma cell lines. We further observed that HuH7 cells detached from the plates later than 4 days after the transfection with Pim-3 but not Scramble siRNA (Fig. 8a). Moreover, Pim-3 siRNA transfectants exhibited a higher ratio of sub-G1 populations with reduced G1 and G2/M populations, compared to Scramble siRNA transfectants and control cells (Fig. 8b). Furthermore, the proportion of cells with condensed nuclei was significantly higher in both HuH7 and Hep3B cells transfected with Pim-3 siRNA, than those transfected with Scramble siRNA (Fig. 8c). These observations would indicate that the ablation of Pim-3 might induce apoptosis in these hepatoma cell lines.

thumbnail image

Figure 7. The effects of endogenous Pim-3 ablation on cell proliferation. (a) Semi-quantitative RT-PCR analysis for Pim-3 mRNA levels in siRNA transfected cells. Total RNAs were extracted from the transfectant with Pim-3 siRNA (P), Scramble siRNA (S), or no siRNA (N) 2 (Hep3B) or 4 days (HuH7) after the transfection as described in Material and Methods. (b,c) Cell proliferation rates were determined on HuH7 (b) and Hep3B (c) cells transfected with Pim-3 siRNA (ˆ), Scramble siRNA (□), or no siRNA (▵) by WST-1 assay. Cells were trypsinized and 5 × 103 cells were plated to each well of 96-well plate at 2 days after the transfection. This time point was designated as Day 0. The ratios to Day 0 were calculated. Results are expressed as means (n = 3), and error bars indicate SD. Representative results from 3 independent experiments are shown. Statistical significance was evaluated using ANOVA test, and p < 0.05 was accepted as statistically significant. *p < 0.05 compared to no siRNA samples at the same time point.

Download figure to PowerPoint

thumbnail image

Figure 8. The effects of endogenous Pim-3 ablation on apoptosis in HuH7 cells. (a) HuH7 cells were observed under an inverted microscope at 4 days after the transfection with Pim-3 or Scramble siRNA under the same conditions as Figure 7. Representative results from 3 independent experiments are shown. Original magnification = ×200. Scale bars = 50 μm. (b) Cell-cycles were analyzed at 4 days after the transfection, by using a flow cytometry as described in Material and Methods. Representative results from 3 independent experiments are shown. (c) Chromatin condensation was analyzed at 4 days after the transfection as described in Material and Methods. Representative results from 3 independent experiments are shown. Results are expressed as means (n = 6), and bars indicate SE. Statistical significance was evaluated using ANOVA test and p < 0.05 was accepted as statistically significant. *p < 0.05 compared to Scramble siRNA samples.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. References

Transcriptome analysis has been applied widely to elucidate molecular mechanisms of various types of diseases and can provide many important clues, particularly for understanding the molecular pathogenesis of oncogenesis, where the expression of many genes changes simultaneously.26, 27 Several independent groups carried out transcriptomal studies on human HCC.28, 29, 30, 31, 32, 33 In most studies, however, the gene expression pattern was compared between tumor and non-tumor portions obtained from the same patients.28, 29, 30, 31, 32, 33 Because these non-tumor portions exhibit usually hepatocyte dysplasia, this type of analysis may fail to detect the changes in gene expression that have already existed at the stage of hepatocyte dysplasia. To circumvent these pitfalls, we compared gene expression patterns between pre-malignant lesions and normal tissues by using FDD. We observed that various genes were selectively changed in pre-malignant lesions. Moreover, a semi-quantitative RT-PCR analysis did not detect any significant differences in the expression of several of these genes between malignant and pre-malignant lesions (our unpublished data), supporting our assumption that the changes in gene expression which have already existed at the stage of hepatocyte dysplasia, might be undetected in the preceding studies.

Among the genes identified in our study, we focused on Pim-3. Pim-3 was originally identified as depolarization-induced gene KID-1 in PC12 cell line, a rat pheochromocytoma cell line.8 Subsequently, several independent groups observed a selective expression of its mRNA in neuronal system,16, 34, 35 but not the liver. By using human Pim-3 cDNA as a probe, we detected Pim-3 mRNA in several organs such as the brain and spleen but not the liver. On the contrary, Pim-3 mRNA expression was detected in all human hepatoma cell lines that we examined. Moreover, immunohistochemical analysis detected immunoreactive Pim-3 protein in precancerous lesions and a portion of HCC cells. Furthermore, Pim-3 protein was also detected in regenerating bile ductules, which are assumed to be the proliferation of hepatic stem cells after chronic liver injury (i.e., infection, tumors).14

Deneen et al.36 provided evidence on the crucial involvement of Pim-3 in EWS/ETS-mediated malignant transformation of mouse NIH 3T3 cells. They demonstrated that Pim-3 was a common transcriptional target of EWS/ETS. EWS/ETS fusion proteins retain an intact ETS DNA-binding domain and can bind to a binding sequence in the target genes through this domain.37Pim-3 gene transcription may be regulated not only by EWS/ETS fusion proteins but also other Ets family proteins. Several independent groups reported that Ets-1, one of the Ets family proteins, was expressed in human HCC tissues.38, 39 Ito et al.38 demonstrated that Ets-1 expression was markedly enhanced in non-cancerous lesions adjacent to HCC lesions and suggested that Ets-1 had a crucial role in hepatocarcinogenesis and HCC progression during their early phases. In line with these observations, we also observed that another transcription factor with an ETS-domain, polyomavirus enhancer A binding protein-3, was expressed selectively in HCC and induced constitutive gene expression of a pro-angiogenic factor, interleukin (IL)-8, in HCC.40 It is tempting to speculate that a transcription factor(s) with an ETS-domain, may induce ectopic Pim-3 gene expression in liver, during the course of hepatocarcinogenesis.

Several lines of evidence demonstrated that the gene expression of Pim-1 and Pim-2 could be regulated by IL-6-gp130-mediated signal transducers and activators of transcription (STAT) family protein, STAT3.41, 42 STAT3 signals can advance cell-cycles and prevent apoptosis by inducing Pim-1 and c-Myc in lymphomagenesis.42 In the liver, IL-6-deficient mice exhibited an impaired liver regeneration after a partial hepatectomy.43 Several lines of evidence have shown that Bcl-xL expression is upregulated by IL-6-gp130-mediated STAT3 and prevents hepatocyte apoptosis,45, 46 and the constitutive activation of STATs observed during oncogenesis can cause a permanent alteration in the genetic program.45, 46 These observations suggest that STAT3 signals could regulate hepatocyte regeneration during the course of HBV-induced hepatocarcinogenesis. We observed that Pim-3 gene ablation by RNAi attenuated proliferation rates and caused cell death in hepatoma cell lines. Thus, if Pim-3 was also regulated by STAT3, these observations suggest that Pim-3 would be involved in STAT3-mediated prevention of apoptosis or cell-cycle progression.

Pim-1 and Pim-2 are also known as proto-oncogene to be involved in lymphomagenesis.47, 48 Because Pim-1 and Pim-2 can induce anti-apoptotic effects,21, 22, 23, 24, 25 Pim-3 may be involved in cell-cycle regulation or anti-apoptosis. We also observed that gene ablation of Pim-3 caused cell death to human hepatoma cell lines, later than 3 days after the transfection. These results suggest that Pim-3 can regulate cell-cycle or apoptosis process indirectly by phosphorylating a molecule(s) upstream in these processes. Although Pim-1 can phosphorylate several molecules such as Cdc25A,49 a G1/S cell-cycle regulator, Pim-3 could not interact with Cdc25A.36 Pim-1 can also phosphorylate valosine containing protein (VCP)/p97,41, 42 a mammalian homolog of Saccaromyces cerevisiae Cdc48p. Pim-1 can upregulate further the expression of an anti-apoptotic molecule, Bcl-2 and Bcl-xL, by augmenting the expression of VCP.42, 43 In HCC tissues and human hepatoma cell lines, evidence is accumulating to indicate that Bcl-xL is constitutively expressed and is a major executer to prevent apoptosis.50, 51, 52 Moreover, VCP was also detected in human HCC tissues.53 If VCP could be phosphorylated by Pim-3 as well as Pim-1, Pim-3 may exert an anti-apoptosis effect by augmenting indirectly the expression of an anti-apoptotic molecule, similarly as Pim-1. Moreover, if the contents of target molecules may differ between HuH7 and Hep3B cell lines, these may account for different patterns of the effects of Pim-3 gene ablation on the proliferation of these cell lines.

The kinase activity of Pim-3 was crucially involved in EWS/ETS-mediated malignant transformation of mouse NIH 3T3 cells.36 Our present observations suggest that Pim-3 can regulate anti-apoptosis process or cell-cycle progression by modulating molecules involved in these processes. Accumulating evidence indicated that Pim-3 can auto-phosphorylate itself,8, 17 but it still remains elusive on physiological substrates of Pim-3. The identification of a substrate(s) may shed novel light on Pim-3-mediated regulatory mechanisms of apoptosis or cell-cycle progression.

References

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. References
  • 1
    Schafer DF, Sorrell MF. Hepatocellular carcinoma. Lancet 1999; 353: 12537.
  • 2
    Geller SA. Hepatitis B and hepatitis C. Clin Liver Dis 2002; 6: 31734.
  • 3
    Iino S. Natural history of hepatitis B and C virus infections. Oncology 2002; 62: 1823.
  • 4
    Bertoletti A, Maini MK. Protection or damage: a dual role for the virus-specific cytotoxic T lymphocyte response in hepatitis B and C infection? Curr Opin Immunol 2000; 12: 4038.
  • 5
    Hino O, Kajino K, Umeda T, Arakawa Y. Understanding the hypercarcinogenic state in chronic hepatitis: a clue to the prevention of human hepatocellular carcinoma. J Gastroenterol 2002; 37: 8837.
  • 6
    Nakamoto Y, Guidotti LG, Kuhlen CV, Fowler P, Chisari FV. Immune pathogenesis of hepatocellular carcinoma. J Exp Med 1998; 188: 34150.
  • 7
    Nakamoto Y, Suda T, Momoi T, Kaneko S. Different procarcinogenic potentials of lymphocyte subsets in a transgenic mouse model of chronic hepatitis B. Cancer Res 2004; 64: 332633.
  • 8
    Feldman JD, Vician L, Crispino M, Tocco G, Marcheselli VL, Bazan NG, Baudry M, Herschman HR. KID-1, a protein kinase induced by depolarization in brain. J Biol Chem 1998; 273: 1653543.
  • 9
    Chisari FV, Filippi P, McLachlan A, Milich DR, Riggs M, Lee S, Palmiter RD, Pinkert CA, Brinster RL. Expression of hepatitis B virus large envelope polypeptide inhibits hepatitis B surface antigen secretion in transgenic mice. J Virol 1986; 60: 8807.
  • 10
    Wirth S, Guidotti LG, Ando K, Schlicht HJ, Chisari FV. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. J Immunol 1995; 154: 250415.
  • 11
    Ito T, Sakaki Y. Fluorescent differential display: a fast and reliable method for message display polymerase chain reaction. Methods Enzymol 1999; 303: 298309.
  • 12
    Lu P, Nakamoto Y, Nemoto-Sasaki Y, Fujii C, Wang H, Hashii M, Ohmoto Y, Kaneko S, Kobayashi K, Mukaida N. Potential interaction between CCR1 and its ligand, CCL3, induced by endogenously produced interleukin-1 in human hepatomas. Am J Pathol 2003; 162: 124958.
  • 13
    Kitamura K, Nakamoto Y, Akiyama M, Fujii C, Kondo T, Kobayashi K, Kaneko S, Mukaida N. Pathogenic roles of tumor necrosis factor receptor p55-mediated signals in dimethylnitrosamine-induced murine liver fibrosis. Lab Invest 2002; 82: 57183.
  • 14
    Wang X, Foster M, Al-Dhalimy M, Lagasse E, Finegold M, Grompe M. The origin and repopulating capacity of murine oval cells. Proc Natl Acad Sci USA 2003; 100: 118818.
  • 15
    Mikkers H, Allen J, Knipscheer P, Romeyn L, Hart A, Vink E, Berns A. High-throughput retroviral tagging to identify components of specific signaling pathways in cancer. Nat Genet 2002; 32: 1539.
  • 16
    Konietzko U, Kauselmann G, Scafidi U, Staubli U, Mikkers H, Berns A, Schweizer M, Waltereit R, Kuhl D. Pim kinase expression is induced by LTP stimulation and required for the consolidation of enduring LTP. EMBO J 1999; 18: 335969.
  • 17
    Eichmann A, Yuan L, Bréant C, Alitalo K, Koskinen PJ. Developmental expression of Pim kinases suggests functions also outside of the hematopoietic system. Oncogene 2000; 19: 121524.
  • 18
    Palaty CK, Kalmar G, Tai G, Oh S, Amankawa L, Affolter M, Aebersold R, Pelech SL. Identification of the autophosphorylation sites of the Xenopus laevis Pim-1 proto-oncogene-encoded protein kinase. J Biol Chem 1997; 272: 1051421.
  • 19
    Houri RZ, Hazum S, Givol D, Telerman A. The cDNA sequence and gene analysis of the human pim oncogene. Gene 1987; 54: 10511.
  • 20
    Baytel D, Shalom S, Madger I, Weissenberg R, Don J. The human Pim-2 proto-oncogene and its testicular expression. Biochim Biophys Acta 1998; 1442: 27485.
  • 21
    Möröy T, Grzeschiczek A, Petzold S, Hartmann KU. Expression of a Pim-1 transgene accelerates lymphoproliferation and inhibits apoptosis in lpr/lpr mice. Proc Natl Acad Sci USA 1993; 90: 107348.
  • 22
    Wang Z, Bhattacharya N, Weaver M, Petersen K, Meyer M, Gapter L, Magnuson NS. Pim-1: a serine/threonine kinase with a role in cell survival, proliferation, differentiation and tumorigenesis. J Vet Sci 2001; 2: 16779.
  • 23
    Skorska MN, Hoser G, Kossev P, Wasik MA, Skorski T. Complementary functions of the antiapoptotic protein A1 and serine/threonine kinase pim-1 in the BCR/ABL-mediated leukemogenesis. Blood 2002; 99: 45319.
  • 24
    Fox CJ, Hammerman PS, Cinalli RM, Master SR, Chodosh LA, Thompson CB. The serine/threonine kinase Pim-2 is a transcriptionally regulated apoptotic inhibitor. Genes Dev 2003; 17: 184154.
  • 25
    Yan B, Zemskova M, Holder S, Chin V, Kraft A, Koskinen PJ, Lilly M. The PIM-2 kinase phosphorylates BAD on serine 112 and reverses BAD-induced cell death. J Biol Chem 2003; 278: 4535867.
  • 26
    Liotta L, Petricoin E. Molecular profiling of human cancer. Nat Rev Genet 2000; 1: 4856.
  • 27
    Thorgeirsson SS, Grisham JW. Molecular pathogenesis of human hepatocellular carcinoma. Nat Genet 2002; 31: 33946.
  • 28
    Honda M, Kaneko S, Kawai H, Shirota Y, Kobayashi K. Differential gene expression between chronic hepatitis B and C hepatic lesion. Gastroenterology 2001; 120: 95566.
  • 29
    Kim MY, Park E, Park JH, Park DH, Moon WS, Cho BH, Shin HS, Kim DG. Expression profile of nine novel genes differentially expressed in hepatitis B virus-associated hepatocellular carcinomas. Oncogene 2001; 20: 456875.
  • 30
    Shirota Y, Kaneko S, Honda M, Kawai HF, Kobayashi K. Identification of differentially expressed genes in hepatocellular carcinoma with cDNA microarrays. Hepatology 2001; 33: 83240.
  • 31
    Smith MW, Yue ZN, Geiss GK, Sadovnikova NY, Carter VS, Boix L, Lazaro CA, Rosenberg GB, Bumgarner RE, Fausto N, Bruix J, Katze MG. Identification of novel tumor markers in hepatitis C virus-associated hepatocellular carcinoma. Cancer Res 2003; 63: 85964.
  • 32
    Xu XR, Huang J, Xu ZG, Qian BZ, Zhu ZD, Yan Q, Cai T, Zhang X, Xiao HS, Qu J, Liu F, Huang QH, et al. Insight into hepatocellular carcinogenesis at transcriptome level by comparing gene expression profiles of hepatocellular carcinoma with those of corresponding noncancerous liver. Proc Natl Acad Sci USA 2001; 98: 1508994.
  • 33
    Yamashita T, Kaneko S, Hashimoto S, Sato T, Nagai S, Toyoda N, Suzuki T, Kobayashi K, Matsushima K. Serial analysis of gene expression in chronic hepatitis C and hepatocellular carcinoma. Biochem Biophys Res Commun 2001; 282: 64754.
  • 34
    Giza CC, Prins ML, Hovda DA, Herschman HR, Feldman JD. Genes preferentially induced by depolarization after concussive brain injury: effects of age and injury severity. J Neurotrauma 2002; 19: 387402.
  • 35
    Lu A, Tang Y, Ran R, Clark JF, Aronow BJ, Sharp FR. Genomics of the periinfarction cortex after focal cerebral ischemia. J Cereb Blood Flow Metab 2003; 23: 786810.
  • 36
    Deneen B, Welford SM, Ho T, Hernandez F, Kurland I, Denny CT. PIM3 proto-oncogene kinase is a common transcriptional target of divergent EWS/ETS oncoproteins. Mol Cell Biol 2003; 23: 3897908.
  • 37
    Arvand A, Denny CT. Biology of EWS/ETS fusions in Ewing's family tumors. Oncogene 2001; 20: 574754.
  • 38
    Ito Y, Miyoshi E, Takeda T, Sakon M, Noda K, Tsujimoto M, Monden M, Taniguchi N, Matsuura N. Expression and possible role of ets-1 in hepatocellular carcinoma. Am J Clin Pathol 2000; 114: 71925.
  • 39
    Kanda K, Nakayama T, Onizuka S, Tomioka T, Kanematsu T. Expression of the Ets-1 proto-oncogene is linked to cell differentiation of human hepatocellular carcinoma. Hepatogastroenterology 2002; 49: 74651.
  • 40
    Iguchi A, Kitajima I, Yamakuchi M, Ueno S, Aikou T, Kubo T, Matsushima K, Mukaida N, Maruyama I. PEA3 and AP-1 are required for constitutive IL-8 gene expression in hepatoma cells. Biochem Biophys Res Commun 2000; 279: 16671.
  • 41
    Hirano T, Ishihara K, Hibi M. Roles of STAT3 in mediating the cell growth, differentiation and survival signals relayed through the IL-6 family of cytokine receptors. Oncogene 2000; 19: 254856.
  • 42
    Shirogane T, Fukada T, Muller JMM, Shima DT, Hibi M, Hirano T. Synergistic roles for Pim-1 and c-Myc in STAT3-mediated cell-cycle progression and anti-apoptosis. Immunity 1999; 11: 70919.
  • 43
    Cressman DE, Greenbaum LE, DeAngelis RA, Ciliberto G, Furth EE, Poli V, Taub R. Liver failure and defective hepatocyte regeneration in interleukin-6-deficient mice. Science 1996; 274: 137983.
  • 44
    Wuestefeld T, Klein C, Streetz KL, Betz U, Lauber J, Buer J, Manns MP, Müller W, Trautwein C. Interleukin-6/glycoprotein 130-dependent pathways are protective during liver regeneration. J Biol Chem 2003; 278: 112818.
  • 45
    Bowman T, Garcia R, Turkson J, Jove R. STATs in oncogenesis. Oncogene 2000; 19: 247488.
  • 46
    Bromberg J. Stat proteins and oncogenesis. J Clin Invest 2002; 109: 113942.
  • 47
    van Lohuizen M, Verbeek S, Krimpenfort P, Domen J, Saris C, Radaszkiewicz T, Berns A. Predisposition to lymphomagenesis in pim-1 transgenic mice: cooperation with c-myc and N-myc in murine leukemia virus-induced tumors. Cell 1989; 56: 67382.
  • 48
    Allen JD, Verhoeven E, Domen J, van der Valk M, Berns A. Pim-2 transgene induces lymphoid tumors, exhibiting potent synergy with c-myc. Oncogene 1997; 15: 113341.
  • 49
    Takehara T, Liu X, Fujimoto J, Friedman SL, Takahashi H. Expression and role of Bcl-xL in human hepatocellular carcinomas. Hepatology 2001; 34: 5561.
  • 50
    Mochizuki T, Kitanaka C, Noguchi K, Muramatsu T, Asai A, Kuchino Y. Physical and functional interactions between Pim-1 kinase and Cdc25A phosphatase. J Biol Chem 1999; 274: 1865966.
  • 51
    Pierce RH, Vail ME, Ralph L, Campbell JS, Fausto N. Bcl-2 expression inhibits liver carcinogenesis and delays the development of proliferating foci. Am J Pathol 2002; 160: 155560.
  • 52
    Watanabe J, Kushihata F, Honda K, Mominoki K, Matsuda S, Kobayashi N. Bcl-xL overexpression in human hepatocellular carcinoma. Int J Oncol 2002; 21: 51519.
  • 53
    Yamamoto S, Tomita Y, Nakamori S, Hoshida Y, Nagano H, Dono K, Umeshita K, Sakon M, Monden M, Aozasa K. Elevated expression of valosin-containing protein (p97) in hepatocellular carcinoma is correlated with increased incidence of tumor recurrence. J Clin Oncol 2003; 21: 44752.