Pharmacological and small interference RNA-mediated inhibition of breast cancer-associated fatty acid synthase (oncogenic antigen-519) synergistically enhances Taxol (paclitaxel)-induced cytotoxicity

Authors

  • Javier A. Menendez,

    Corresponding author
    1. Department of Medicine, Breast Cancer Translational Research Laboratory, Evanston Northwestern Healthcare Research Institute (ENHRI), Evanston, IL, USA
    2. Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, IL, USA
    • Evanston Northwestern Healthcare Research Institute, 1001 University Place, Evanston, IL 60201
    Search for more papers by this author
    • Fax: +1-847-570-8022

  • Luciano Vellon,

    1. Department of Medicine, Breast Cancer Translational Research Laboratory, Evanston Northwestern Healthcare Research Institute (ENHRI), Evanston, IL, USA
    2. Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, IL, USA
    Search for more papers by this author
  • Ramon Colomer,

    1. Institut Catala d'Oncologia, Hospital Universitari de Girona Dr. Josep Trueta, Girona, Spain
    Search for more papers by this author
  • Ruth Lupu

    1. Department of Medicine, Breast Cancer Translational Research Laboratory, Evanston Northwestern Healthcare Research Institute (ENHRI), Evanston, IL, USA
    2. Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, IL, USA
    Search for more papers by this author

Abstract

The relationship between breast cancer-associated fatty acid synthase (FAS; oncogenic antigen-519) and chemotherapy-induced cell damage has not been studied. We examined the ability of C75, a synthetic slow-binding inhibitor of FAS activity, to modulate the cytotoxic activity of the microtubule-interfering agent Taxol™ (paclitaxel) in SK-Br3, MDA-MB-231, MCF-7 and multidrug-resistant MDR-1 (P-Glycoprotein)-overexpressing MCF-7/AdrR breast cancer cells. When the combination of C75 with Taxol™ in either concurrent (C75 + Taxol™ 24 hr) or sequential (C75 24 hr → Taxol™ 24 hr) schedules were tested for synergism, addition or antagonism using the isobologram and the median-effect plot analyses, co-exposure of C75 and Taxol™ mostly demonstrated synergistic effects, whereas sequential exposure to C75 followed by Taxol™ mainly showed additive or antagonistic interactions. Because the nature of the cytotoxic interactions was definitely schedule-dependent in MCF-7 cells, we next evaluated the effects of C75 on Taxol™-induced apoptosis as well as Taxol™-activated cell death and cell survival-signaling pathways in this breast cancer cell model. An ELISA for histone-associated DNA fragments demonstrated that C75 and Taxol™ co-exposure caused a synergistic enhancement of apoptotic cell death, whereas C75 pre-treatment did not enhance the apoptosis-inducing activity of Taxol™. Co-exposure to C75 and Taxol™ induced a remarkable nuclear accumulation of activated p38 mitogen-activated protein kinase (p38 MAPK), which was accompanied by a synergistic nuclear accumulation of the p53 tumor-suppressor protein that was phosphorylated at Ser46, a p38 MAPK-regulated pro-apoptotic modification of p53. As single agents, FAS blocker C75 and Taxol™ induced a significant stimulation of the proliferation and cell survival mitogen-activated protein kinase extracellular signal-regulated kinase (ERK1/ERK2 MAPK) activity, whereas, in combination, they interfered with ERK1/ERK2 activation. Moreover, the combined treatment of C75 and Taxol™ inactivated the anti-apoptotic AKT (protein kinase B) kinase more than either agent alone, as evidenced by a synergistic down-regulation of AKT phosphorylation at its activating site Ser473 without affecting AKT protein levels. To rule out a role for non-FAS C75-mediated effects, we finally used the potent and highly sequence-specific mechanism of RNA interference (RNAi) to block FAS-dependent signaling. Importantly, SK-Br3 and multi-drug resistant MCF-7/AdrR cells transiently transfected with sequence-specific double-stranded RNA oligonucleotides targeting FAS gene demonstrated hypersensitivity to Taxol™-induced apoptotic cell death. Our findings establish for the first time that FAS blockade augments the cytotoxicity of anti-mitotic drug Taxol™ against breast cancer cells and that this chemosensitizing effect is schedule-dependent. We suggest that the alternate activation of both the pro-apoptotic p38 MAPK-p53 signaling and the cytoprotective MEK1/2 → ERK1/2 cascade, as well as the inactivation of the anti-apoptotic AKT activity may explain, at least in part, the sequence-dependent enhancement of Taxol™-induced cytotoxicity and apoptosis that follows inhibition of FAS activity in breast cancer cells. If chemically stable FAS inhibitors demonstrate systemic anticancer effects of FAS inhibition in vivo, these findings may render FAS as a valuable molecular target to enhance the efficacy of taxanes-based chemotherapy in human breast cancer. © 2004 Wiley-Liss, Inc.

A biologically aggressive subset of human breast carcinomas and other malignancies is characterized to exhibit derangement of the de novo fatty acid biosynthesis, manifested as overexpression and hyperactivity of the lipogenic enzyme fatty acid synthase (FAS).1, 2, 3, 4, 5, 6 The widespread expression of FAS in human cancer and its association with poorer prognoses in breast,1, 2, 3, 4, 5, 6 ovarian7, 8 and prostate carcinomas9, 10 suggest that high levels of FAS expression and activity provide an advantage for tumor growth and progression.11 This is in marked contrast to the role of FAS-dependent fatty acid biosynthesis as an anabolic energy storage pathway in liver and adipose tissue. In fact, most human tissues express very low levels of FAS because endogenous fatty acid biosynthesis is downregulated when a normal diet is consumed.12,13 Interestingly, the differential expression of FAS between cancer and normal tissues has lead to the hypothesis that tumor-associated FAS could be exploited as a useful molecular target for the development of new therapeutic anti-metabolites.4, 14 Specifically, the tumoricidal activity of pharmacological inhibitors of FAS activity has begun to emerge. Thus, it has been demonstrated that cerulenin, [(2R, 3S), 2-3-epoxy-4-oxo-7, 10-trans, trans-dodecadienamide], a natural product derived from the fungus Cephalosporium caerulens that binds irreversibly to the catalytic binding site of the β-ketoacyl carrier protein synthase in the multienzyme FAS complex,15, 16 leads to selective cytotoxicity of cancer cells in vitro.4, 14, 17, 18, 19, 20In vivo, treatment with cerulenin has resulted in significantly increased survival in human cancer xenografts.21 Unfortunately, the clinical relevance of these results is limited because cerulenin is chemically unstable and may affect processes other than FAS activity. Cerulenin structure harbors a very reactive epoxy group that may interact also with other proteins and may affect processes other than FAS activity, such as protein palmitoylation, cholesterol synthesis or proteolysis.22, 23, 24, 25 Interestingly, a novel inhibitor of FAS has recently become available.26 The α-methylene-γ-butyrolactone C75 lacks the reactive epoxide present on cerulenin, enhancing chemical stability and specificity. C75 inhibits purified mammalian FAS activity with characteristics of a slow-binding inhibitor and, similarly to cerulenin, it induces cytostatic and cytotoxic effects in cultured tumor cells, and exhibits significant growth inhibitory effects on human breast cancer xenografts.19, 20, 26, 27

Although it has become clearer that breast cancer cells are dependent upon active FAS-dependent de novo fatty acid synthesis for survival and proliferation, the relationship between breast cancer-associated FAS hyperactivity and the efficacy of chemotherapy has not been studied. We hypothesized that the pharmacological inhibition of FAS activity in human breast cancer cells might prove useful in combination with conventional anticancer therapy. Because chemotherapeutic regimens in advanced breast cancer frequently use microtubule inhibitors such as taxanes, we looked into the role of FAS activity on the cytotoxic activity of paclitaxel (Taxol™, Bristol-Myers Squibb Company, Princeton, NJ), a member of the taxanes class of anti-neoplastic agents that exhibits significant activity against metastatic breast cancer.28, 29, 30, 31, 32, 33, 34, 35, 36, 37 Taxol™ binds to β-tubulin, stabilizes the microtubule, prevents its depolymerization, leads to arrest of cells in G2-M and ultimately, it triggers apoptosis.28, 29, 30, 38, 39, 40 Taking advantage of the well-known ability of C75 to specifically block FAS-dependent de novo fatty acid biosynthesis, we employed this γ-lactone as an experimental tool to evaluate the role of FAS activity on breast cancer cell response to Taxol™-induced cell damage. Using a panel of human breast cancer cell lines differentially expressing FAS, we determined increases in overall cytotoxic effects, as compared to single-agent treatment alone. In an attempt to provide the preclinical rationale for the optimal clinical development of these combinations, isobologram and median-effect plot (Chou and Talalay) methods41, 42, 43, 44, 45, 46 were used to asses the synergism or antagonism between C75 and Taxol™. The efficacy of different schedules of administration (simultaneous exposure to C75 and Taxol™ or sequential exposure to C75 followed by Taxol™) was also compared. We show that the combined treatment of FAS inhibitor C75 with Taxol™ results in a synergistic cytotoxicity against human breast cancer cells and that this synergistic interaction is, in general, a schedule-dependent event; it is greater when cells are concurrently exposed to C75 and Taxol™ and less pronounced when C75-induced blockade of FAS activity is limited to pre-treatment. Moreover, we delineate how the alternate modulation of pro- and anti-apoptotic signaling pathways (e.g., p38 MAPK, p53 phosphorylation, ERK1/ERK2 MAPK, AKT) after pharmacological inhibition of FAS activity may influence the nature of breast cancer cell response to Taxol™. In addition, we illustrate that RNA interference-mediated silencing of the FAS gene restores Taxol™ sensitivity in MDR1 (P-Glycoprotein)-overexpressing multidrug-resistant breast cancer cells. These results, altogether, present the first evidence that specific blockade of breast cancer-associated FAS hyperactivity synergistically enhances Taxol™ efficacy toward human breast cancer cells. If chemically stable FAS inhibitors or cell-selective vector systems able to deliver RNAi targeting FAS gene demonstrate systemic anticancer effects in vivo, our current findings show FAS as a valuable molecular target to enhance the efficacy of taxanes-based chemotherapy in breast carcinomas.

Material and Methods

Materials

Cerulenin and C75 were purchased from Sigma (St. Louis, MO) and Alexis Biochemicals (San Diego, CA), respectively. Cerulenin and C75 were dissolved in dimethyl sulfoxide (DMSO) and stored in the dark as stock solution (50 mg/ml) at −20°C. U0126 and SB203580 were purchased from Calbiochem (La Jolla, CA), dissolved in DMSO and stored in the dark as stock solution (10 mM) at −20°C until use. For experimental use, stock solutions were diluted with growth medium. In all cases, final concentrations of DMSO were <0.1% and did not modify either the proliferation of control cells or the responses of cells to FAS inhibitors or Taxol™.

Paclitaxel (Taxol™) was supplied by Bristol-Myers Squibb and kept as a stock solution of 6 mg/ml in Cremophor EL, stored at 4°C. Stock was freshly diluted in culture medium before any experiment. The primary antibody for FAS immunoblotting was a mouse IgG1 FAS monoclonal antibody (clone 23) from BD Biosciences Pharmingen (San Diego, CA). p53 (Ab-5) monoclonal antibody was from Oncogene Research Products (San Diego, CA). Anti-ERK1/2, anti-phosphor-ERK1/2 MAPK, anti-p38 MAPK, anti-phosphor-p38 MAPKThr180/Tyr182, anti-phosphor-p53Ser46, anti-AKT, and anti-phosphor AKTSer473 rabbit polyclonal antibodies were from Cell Signal Technology (Beverly, MD). Anti-β-actin goat polyclonal antibody was from Santa Cruz Biotechnology (Santa Cruz, CA).

Cell culture

MDA-MB-231, MCF-7 and MCF-7/AdrR breast cancer cells were obtained from the American Type Culture Collection (ATCC) and they were routinely grown in DMEM (Gibco, Invitrogen SA, Barcelona, Spain) containing 10% heat-inactivated FBS (Bio-Whittaker, Cambrex, NJ), 1% L-glutamine, 1% sodium pyruvate, 50 U/ml penicillin and 50 μg/ml streptomycin. SK-Br3 breast cancer cells were obtained from Dr. H. Riese (Centro Nacional de Biotecnología, Madrid, Spain) and they were passaged in McCoy's 5 A medium (Gibco) containing 10% heat-inactivated FBS, 1% L-glutamine, 1% sodium pyruvate, 50 U/ml penicillin and 50 μg/ml streptomycin. Cells were maintained at 37°C in a humidified atmosphere of 95% air and 5% CO2.

Immunoblotting

Cells were harvested by treatment with trypsin-EDTA solution, washed twice with PBS (−) and stored at −80°C. The cells were lysed in lysis buffer (20 mM Tris [pH 7.5], 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM β-glycerol-phosphate, 1 mM Na3VO4, 1 μg/ml leupeptin, 1 mM phenylmethylsulfonylfluoride) for 30 min on ice, and then a particle-free supernatant solution was obtained by centrifugation at 14,000g for 15 min. All operations were at 0–4°C. A sample was taken for measurement of protein content by a BioRad assay (Bio-Rad Laboratories, Hercules, CA). Equal amounts of protein were heated in SDS sample buffer (Laemmli) for 10 min at 70°C and subjected to electrophoresis on either 3–8% NuPAGE Tris-Acetate (FAS) or 10% SDS-PAGE (p53, p38 MAPK, ERK1/2 MAPK) gels (Novex™) and transferred to nitrocellulose membranes. For immunoblot analysis of FAS and p53, nonspecific binding on the nitrocellulose filter paper was minimized by blocking for 1 hr at room temperature (RT) with TBS-T (25 mM Tris-HCl, 150 mM NaCl [pH 7.5], and 0.05% Tween 20) containing 5% (w/v) nonfat dry milk. The treated filters were washed in TBS-T and then incubated with primary antibodies for 2 hr at RT in TBS-T containing 1% (w/v) nonfat dry milk. The membranes were washed in TBS-T, horseradish peroxidase-conjugated secondary antibodies (Jackson Immuno Research, West Grove, PA) in TBS-T were added for 1 hr, and immunoreactive bands were visualized with ECL detection reagent (Pierce, Rockford, IL). For immunoblot analysis of phosphor-p53Ser46, p38 MAPK, phosphor-p38 MAPK, ERK1/2 MAPK, phosphor-ERK1/2 MAPK, AKT, and phosphor-AKTSer473, membranes were blocked as described above and incubated overnight at 4°C with primary antibody in TBS-T/5% BSA. The membranes were washed in TBS-T, horseradish peroxidase-conjugated secondary antibodies in TBS-T containing 5% (w/v) nonfat dry milk were added for 1 hr, and primary antibody binding was detected with ECL detection reagent (Pierce). Blots were re-probed with an antibody for β-actin to control for protein loading and transfer. Densitometric values of protein bands were quantified using Scion imaging software (Scion Corp., Frederick, MD).

FAS activity

FAS activity was assayed in particle-free supernatants by recording spectrophotometrically at 25°C the decrease of A340 nm due to oxidation of NADPH essentially as described by Dils and Carey.47 Particle-free supernatant (96 μg), 200 mM potassium phosphate buffer pH 6.6, 1 mM dithiothreitol, 1 mM EDTA, 0.24 mM NADPH and 30 μM acetyl-CoA in 0.2 ml reaction volume were monitored at 340 nm for 3 min to measure background NADPH oxidation. After the addition of 50 μM of malonyl-CoA, the reaction was assayed for an additional 10 min to determine FAS-dependent oxidation of NADPH. Preliminary experiments determined the linear response range for the assay. The rate of NADPH oxidation was linear for at least 20 min of incubation after the addition of malonyl-CoA when increasing concentrations of cellular proteins (2–120 μg) were tested. Rates were corrected for the background rate of NADPH oxidation in the presence of acetyl-CoA. FAS activity was expressed in nmol NADPH oxidized min−1 mg protein−1.

To confirm C75-induced inhibition of FAS activity, exponentially growing MCF-7, MDA-MB-231 and SK-Br3 cells were plated at 1.5 × 106 cells/100-mm plates and incubated overnight before use. C75 (2.5, 5.0 and 10 μg/ml) was added for 18 hr. Particle-free supernatants from C75-treated cells were compared to control cells, which consisted of cells incubated with DMSO (v/v) alone, in their ability to oxidize NADPH.

Chemosensitivity testing

Drug sensitivity was determined using a standard colorimetric MTT (3-4, 5-dimethylthiazol-2-yl-2, 5-diphenyl-tetrazolium bromide) reduction assay. Cells in exponential growth were harvested by trypsinization and seeded at a concentration of 104 cells/100 μl/well into 96-well plates, and allowed an overnight period for attachment. Medium was removed and fresh medium along with various concentrations of C75, Taxol™ or combinations of compounds, were added to cultures in parallel. Agents were studied in combination concurrently or sequentially with the first agent (C75) washed out before the introduction of the second agent (Taxol™). Control cells without agents were cultured using the same conditions with comparable media changes. Compounds were not renewed during the entire period of cell exposure.

After treatment, the medium was removed and replaced by fresh drug-free medium (100 μl/well), and MTT (5 mg/ml in PBS) was added to each well at a 1/10 volume. After incubation for 2–3 hr at 37°C, the supernatants were carefully aspirated, 100 μl of DMSO were added to each well, and the plates agitated to dissolve the crystal product. Absorbances were measured at 570 nm using a multi-well plate reader (Model Anthos Labtec 2010 1.7 reader). The cell viability effects from exposure of cells to each compound alone and their combination for a particular schedule were analyzed generating concentration-effect curves as a plot of the fraction of unaffected (surviving) cells vs. drug concentration. Dose response curves were plotted as percentages of the control cell absorbances, which were obtained from control wells treated with appropriate concentrations of the compounds vehicles that were processed simultaneously. For each treatment, cell viability was evaluated as a percentage using the following equation: (A570 of treated sample/A570 of untreated sample) × 100. Drug sensitivity was expressed in terms of the concentration of drug required for either 50% (IC50, cytostatic condition) or 70% (IC70, cytotoxic condition) reduction of cell viability. Because the percentage of control absorbance was considered to be the surviving fraction of cells, the IC50 and IC70 values were defined as the concentration of drug that produced 50 and 70% reduction in control absorbance (by interpolation), respectively. The degree of sensitization to Taxol™ by C75 was evaluated by dividing both IC70 values of control cells by those obtained when cells were exposed to C75 either before or during exposure to Taxol™.

Determination of synergism and antagonism (I): isobologram analysis

The interaction between C75 and Taxol™ was evaluated by the isobologram technique,41 a dose-oriented geometric method of assessing drug interactions. Briefly, the concentration of one agent producing a 70% inhibitory effect was plotted on the horizontal axis, and the concentration of another agent producing the same degree of effect was plotted on the vertical axis; a straight line joining these 2 points represents zero interaction (addition) between 2 agents. The experimental isoeffect points were the concentrations (expressed relative to the IC70 concentrations) of the 2 agents that when combined kill 70% of the cells. When the experimental isoeffect points felt below that line, the combination effect of the 2 drugs was considered to be supra-additive or synergistic. Within the designed assay range, a set of isoeffect points was generated because there were multiple C75 and Taxol™ concentrations that achieved the same isoeffect. In our present study, the mean values of the survival fractions were used to generate the set of experimental isoeffect points and construct the isobole for a particular C75-Taxol™ combination. A quantitative index of these interactions was provided by the isobologram equation Ix = (a/A) + (b/B), where, for our study, (A) and (B) represent the respective concentrations of C75 and Taxol™ required to produce a fixed level of inhibition (IC50 or IC70) when administered alone, (a) and (b) represent the concentrations required for the same effect when the drugs were administered in combination, and (Ix) represents an index of drug interaction (interaction index). Ix values of <1 indicate synergy, a value of 1 represents addition, and values of >1 indicate antagonism. For all estimations of Ix, we used only isobols where intercept data for both axes were available.

Determination of synergism and antagonism (II): Chou and Talalay analysis

Synergism, addition or antagonism of the drugs was also determined by the multiple drug analysis of Chou and Talalay (combination index), which is based on the median-effect principle. Details of this methodology have been published.42, 43, 44, 45, 46 This method involves plotting dose-effect curves for each agent and for multiply diluted, fixed ratio combinations of agents. A combination index (CI) is determined with the equation:

equation image

where (Dx)1 is the dose of Agent 1 required to produce × percent effect alone, and (D)1 is the dose of Agent 1 required to produce the same × percent effect in combination with (D)2. Similarly (Dx)2 is the dose of Agent 2 required to produce × percent effect alone, and (D)2 is the dose required to produce the same effect in combination with (D)1. If the agents are mutually exclusive (e.g., similar mode of action), then α is 0 (i.e., CI is the sum of 2 terms); if the agents are mutually non-exclusive (e.g., independent mode of action), α is 1 (i.e., CI is the sum of 3 terms). If it is uncertain whether the agents act in a similar or and independent manner, the formula may be solved both ways. For simplicity, however, the third term of the Chou and Talalay equation is usually omitted, and, thus, the mutually exclusive assumption or classic isobologram is indicated. Only the CI values obtained from the classic (mutually exclusive) calculation are therefore given in Results. Similar results were also obtained when the complete equation was used for combination studies with C75 and Taxol™ (data not shown). Different values of CI may be obtained by solving the equation for different values of fa (e.g., different degrees of inhibition of cell viability). CI values of <1 indicate synergy (the smaller the value, the greater the degree of synergy), values >1 indicate antagonism and values equal to 1 indicate additive effects. Each experiment was carried out with triplicate cultures for each data and was repeated independently at least 3 times. The conformity of the experimental data to the median-effect principle of the mass-action law is automatically provided by the computer printout in terms of the linear correlation coefficient (r-value) of the median-effect plots. In our study, the r-values for C75, Taxol™ and their combinations were all >0.95.

RNA interference-mediated silencing of the FAS gene

Synthetic sense and antisense oligonucleotides targeting FAS gene were purchased from Dharmacon RNA Technologies (Lafayette, CO). This double-stranded siRNA was as follows: sense sequence, CCCUGAGAUCCCAGCGCUGdTdT; antisense sequence, CAGCGCUGGGAUCUCAGGGdTdT. The design of these siRNA oligos targeting FAS gene was based on a DNA sequence of the type AA(N19) corresponding to the nucleotides 1210–1231 located 3′ to the first nucleotide of the start codon of the human FAS cDNA (AACCCTGAGATCCCAGCGCTG). Searches of the human genome database (BLAST) were carried out to ensure the sequences would not target other gene transcripts. Transfections were carried out in 60-mm dishes at a density of 0.4–0.5 × 106 cells/dish using FUGene (Roche) as per manufacturer's instructions. The final concentrations of siRNA FAS in the 60-mm dishes were 100 and 200 nM. As a nonspecific siRNA control, cells were transfected with equimolar concentrations (100 and 200 nM) of a non-specific control pool (siRNA negative control) containing 4 pooled non-specific siRNA duplexes (Upstate Cell Signaling Solutions-Dharmacon RNA Technologies, Lafayette, CO); Catalog no. D-001206-13). At the indicated time points after transfection cells were used for analyses of FAS expression and activity.

In situ immunofluorescent staining

Cells were seeded at a density of 1 × 104 cells/well in a 4-well chamber slide (Nalge Nunc International, Rochester, NY). After either a 48 hr transfection with siRNA FAS or after a 6 hr incubation with C75, Taxol™ or cerulenin + Taxol™, cells were washed with PBS, fixed with 4% paraformaldehyde in PBS for 10 min, permeabilized with 0.2% Triton X-100/PBS for 15 min, and stored overnight at 4°C with 10% horse serum in PBS. The cells were washed and then incubated for 2 hr with anti-FAS monoclonal, p53 mouse monoclonal (1:200), phosphor-ERK1/2 MAPK rabbit polyclonal (1:200), phosphor-p38 MAPKThr180/Tyr182 rabbit polyclonal (1:200) or phosphor-p53Ser46 rabbit polyclonal (1:200) antibodies diluted in 0.05% Triton X-100/PBS. After extensive washes, the cells were incubated for 45 min with fluorescein isothiocyanate (FITC)-conjugated anti-mouse IgG, FITC-conjugated anti-rabbit IgG, or tetramethylrhodamine isothiocyanate (TRIC)-conjugated anti-rabbit IgG secondary antibodies (Jackson ImmunoResearch Labs) diluted 1:200 in 0.05% Triton X-100/PBS. The cells were washed five times with PBS and mounted with VECTASHIELD + DAPI (Vector Laboratories, Burlingame, CA). As controls, cells were stained with primary or secondary antibody alone. Control experiments did not display significant fluorescence in any case (data not shown). Indirect immunofluorescence was recorded on a Zeiss microscope. Images were noise-filtered, corrected for background, and prepared using Adobe Photoshop.

Apoptosis analysis: determination of cytoplasmic mono- and oligo nucleosomes.

The induction of apoptosis was assessed using the Cell Death Detection ELISAPLUS kit obtained from Roche Molecular Biochemicals USA (Indianapolis, IN). This kit uses a photometric enzyme immunoassay that quantitatively determines the formation of cytoplasmic histone-associated DNA fragments (mono- and oligo nucleosomes) after apoptotic cell death. Briefly, MCF-7 cells (5 × 103 cells/well) were treated with Taxol™ (10 nM), C75 (2 μg/ml) or a combination of C75 + Taxol™ for 24 hr in a 96-well plate as specified. Alternatively, SK-Br3 and MCF-7/AdrR cells (1 × 104 cells/well) were treated with Taxol™ (25 and 250 nM, respectively) and, 30 min later they were transfected with siRNA oligos targeting FAS gene (200 nM) in a 96-well plate for 72 hr. The induction of apoptosis was evaluated using cytosolic fractions obtained from pooled adherent and floating cells (obtained by centrifugation at 200g for 10 min) by assessing the enrichment of nucleosomes in the cytoplasm (by using anti-histone biotin and anti-DNA peroxidase antibodies) and determined exactly as described in the manufacturer's protocol. The enrichment of histone-DNA fragments in treated cells was expressed as fold increase in absorbance, which was read at 405 nm at multiple time intervals after the addition of peroxidase substrate, as compared to control (vehicle-treated) cells.

Statistical analysis

All observations were confirmed by at least 3 independent experiments. The data are presented as means ± SD. The Student's t-test (paired and unpaired) was used to evaluate the statistical significance of mean values. Statistical significance levels were p < 0.05 (denoted as *) and p < 0.005 (denoted as **). All p are two-tailed.

Results

C75-induced inhibition of FAS activity and C75-induced cytotoxicity positively correlates with endogenous FAS levels in human breast cancer cells

We first examined the expression levels of FAS in SK-Br3, MCF-7 and MDA-MB-231 human breast cancer cell lines. Immunoblotting analyses of whole lysates from these breast cancer cells exhibited a single band at approximately 250 KDa recognized by a monoclonal anti-FAS antibody (Fig. 1, left panel). SK-Br3 cells contained very large amounts of FAS, whereas MCF-7 and MDA-MB-231 expressed moderate and very small amounts of FAS protein, respectively. FAS activity, measured by the linear increase in NADPH oxidation after the addition of malonyl-CoA,47 was confirmed in the particle-free supernatants of SK-Br3 and MDA-MB-231 human breast cancer cells. FAS activity in extracts of SK-Br3 cells (7.8 ± 0.7 nmol NADPH oxidized min−1 mg protein−1) was 3 times greater than in extracts from MCF-7 cells and 9 times greater than in extracts from MDA-MB-231 cells (2.5 ± 0.4 and 0.9 ± 0.4 nmol NADPH oxidized min−1 mg protein−1, respectively).

Figure 1.

(Left panel) Characterization of FAS expression levels in MCF-7, MDA-MB-231 and SK-Br3 breast cancer cells. Cells were grown in complete medium until reaching ∼75% confluence, then washed twice with PBS, and solubilized in lysis buffer containing phosphatase and protease inhibitors (see Material and Methods). Aliquots (10 μg total protein) of 14,000g supernatants were fractionated by 3–8% NuPAGE, transferred to nitrocellulose membranes, and probed with a mouse anti-FAS monoclonal antibody. Immunoreactive bands in the figure are from one representative experiment. Equivalent results were found in 3 independent experiments. Blots were re-probed with an antibody for β-actin to control for protein loading and transfer. (Right panel) C75-induced inhibition of FAS activity in MCF-7, MDA-MB-231 and SK-Br3 breast cancer cells. To confirm C75-induced inhibition of FAS activity, exponentially growing MCF-7, MDA-MB-231 and SK-Br3 cells were plated at 1.5 × 106 cells/100-mm plates and incubated overnight prior use. C75 (2.5, 5 and 10 μg/ml respectively) were added for 18 hr. Particle-free supernatants from cerulenin-treated cells were compared to control samples, which consisted of cells incubated with DMSO (v/v) alone, in their ability to oxidize NADPH in the presence of malonyl-CoA (see Material and Methods). Values are in nmol NADPH oxidized min−1 mg protein−1. Shown are means (columns) ± SD. Bars = 3 separate experiments in which triplicate measurements were made. *p < 0.05; **p < 0.005 (Student's t-test) vs. DMSO-treated cells.

To demonstrate C75-induced inhibition of FAS activity, SK-Br3, MCF-7 and MDA-MB-231 cells were treated with 2.5, 5 or 10 μg/ml C75. After 18 hr, FAS activity was measured and compared to untreated cells (Fig. 1, right panels). Although all 3 lines exhibited dose-dependent reductions in FAS activity low-FAS-expressing MDA-MB-231 cells demonstrated a less marked response to FAS inhibitor C75 (∼60% reduction of FAS activity at 10 μg/ml C75), whereas MCF-7 and SK-Br3 cells demonstrated ∼90% reduction of basal FAS activity in 10 μg/ml C75.

To evaluate C75-induced cytotoxicity, breast cancer cells were incubated with various concentrations of C75 (1.25–20 μg/ml) for 24 hr. C75 treatment decreased cell viability of SK-Br3, MCF-7 and MDA-MB-231 cells in a dose-dependent fashion. When the C75 concentrations needed for 50% reduction of cell viability (IC50) were evaluated in SK-Br3, MCF-7 and MDA-MB-231 breast cancer cell lines it was concluded that the extent of C75-induced cytotoxicity was correlated significantly with constitutive FAS levels. Thus, FAS-overexpressing SK-Br3 cells were significantly more sensitive to the drug (IC50 = 4.5 ± 0.5 μg/ml) than moderately FAS-expressing MCF-7 and low-FAS-expressing MDA-MB-231 cells (IC50 = 8.0 ± 1.5 and 9.6 ± 1.5 μg/ml, respectively).

The small-molecule FAS inhibitor C75, but not the mycotoxin cerulenin, specifically induces breast cancer cell toxicity through its FAS target

To evaluate the consequences of the loss of FAS signaling on Taxol™-induced cytotoxicity, we initially evaluated whether the cytotoxic effects of chemical FAS blocker C75 toward breast cancer cells were exclusively dependent on their ability to inhibit FAS activity. Because previous studies and our current findings have shown that cancer cells with high constitutive FAS expression are more sensitive to pharmacological inhibitors of FAS activity, we envisioned that, if C75-induced cytotoxicity solely occurs through theirs effects on FAS activity, a loss of sensitivity to chemical FAS blockers (C75-resistance) should occur in parallel with loss of FAS expression or activity.

The specificity of the synthetic slow-binding inhibitor C75 compared to the natural FAS inhibitor cerulenin toward its FAS target was evaluated by characterizing the cytotoxic responses on SK-Br3 cells in which FAS gene expression was previously knocked-down. This approach was based on selective FAS gene silencing, using the potent and highly sequence-specific mechanism of RNA interference (RNAi). RNAi is a cellular process resulting in enzymatic cleavage and breakdown of mRNA, guided by sequence-specific double-stranded RNA oligonucleotides (siRNA).48, 49, 50 To specifically silence the expression of FAS gene, SK-Br3 cells were transfected with siRNA-targeting FAS mRNA as described in Material and Methods. As a control for specificity of RNAi, cells were transfected with a non-specific control pool of RNAi. Silencing of FAS expression was already visible 48 hr after transfection, reached an optimum after 72 hr, and lasted for at least another 72 hr (through 144 hr after transfection; data not shown). Figure 2a shows Western blot analyses for a representative experiment (n = 3) in which 2 different concentrations of the RNAi targeted to FAS mRNA were used, as well as a non-specific-targeted RNAi. A more severe knock-down of FAS was seen for the 200 nM concentration of siRNA targeted to FAS than for the 2-fold lower (100 nM) concentration. Indeed, FAS RNAi at 200 nM severely suppressed constitutive FAS overexpression (∼90% reduction) in SK-Br3 cells when compared to control cells transfected with non-specific RNAi. No effect of FAS-targeted siRNA transfection was observed on β-actin expression, which was used as an internal control for gene silencing specificity and protein loading. To analyze whether FAS RNAi resulted in decreased FAS enzymatic activity, we monitored the in vitro ability of cell protein extracts from FAS RNAi-transfected SK-Br3 cells to oxidize NADPH after the addition of malonyl-CoA.47 At 72 hr after transfection, FAS RNAi resulted in a significant 85% decrease of FAS activity in SK-Br3 cells (data not shown). It is noteworthy that siRNA-induced silencing of FAS expression was associated with marked morphological changes, including an astrocyte-like phenotype with the occurrence of numerous extrusions, a significant loss of cell-cell contacts, and a less packed cell growth of SK-Br3 cells (Fig. 2a). Interestingly, De Schrijver et al. recently reported similar morphological changes after RNAi-mediated silencing of the FAS gene in LNCaP prostate cancer cells.51

Figure 2.

RNAi-mediated silencing of the FAS gene induces insensitivity to C75-induced cytotoxicity in breast cancer cells. (a) Immunoblotting analyses of FAS expression: SK-Br3 breast cancer cells were transfected with increasing concentrations of siRNA-targeting FAS or with a non-specific control siRNA Pool (negative control) for 72 hr. Equal amounts of total protein (10 μg per lane) were subjected to immunoblotting analyses with specific antibodies against FAS or β-actin (see Material and Methods). Immunofluorescent staining of FAS cellular localization: non-specific RNAi- and FAS RNAi-transfected SK-Br3 cells were fixed and labeled with an anti-FAS monoclonal antibody. After labeling, cells were thoroughly washed, and localization of FAS was detected by indirect immunofluorescence by incubating with TRITC-conjugated anti-mouse IgG. After counterstaining with DAPI, cells were examined and photographed using a Zeiss fluorescent microscope equipped with a built-in camera. Figure shows a representative immunostaining analysis. Similar results were obtained in 3 independent experiments. (b) Seventy-two hours after transfection, one set of non-specific control pool- and RNAi FAS-transfected SK-Br3 cells were used for FAS activity assays (not shown) and immunoblotting analyses of FAS expression (top panels). A second set of non-specific control pool- and RNAi FAS-transfected SK-Br3 cells were harvested by trypsinization and seeded at a concentration of 5 × 103 cells/200 μl/well into 96-well plates, and allowed an overnight period for attachment. Such conditions did allow the control untreated cells to become confluent after ∼3 days. Then the medium was removed and fresh medium along with various concentrations of cerulenin or C75 (1–10 μg/ml) were added to cultures. Compounds were not renewed during the entire period of cell exposure, and control cells without agents were cultured using the same conditions. After treatment, the medium was removed and replaced by fresh drug-free medium (100 μl/well), and cell viability patterns were analyzed (see Material and Methods). Data is from 3 separate experiments made in triplicate presented as means of cell toxicity (100 − cell viability) (columns) ± SD (bars).

To assess potential effects of RNAi-mediated FAS silencing on the efficacy of chemical FAS blockers, FAS RNAi-transfected and matched control SK-Br3 cells, at 72 hr after transfection, were harvested, re-cultured in 96-well plates, and their metabolic status was judged by using a MTT-based cell viability assay after exposure to increasing concentrations of cerulenin or C75 (Fig. 2b, top panels). Cerulenin and C75 treatments significantly reduced cell viability in a dose-dependent fashion in SK-Br3 cells transfected with nonspecific control pool of RNAi (Fig. 2b, bottom panels). We observed a significant reduction of cerulenin-induced cell toxicity toward FAS RNAi-transfected SK-Br3 cells when low concentrations of cerulenin were used, whereas FAS RNA-transfected cells were slightly less sensitivity when exposed to higher concentrations of cerulenin. Interestingly, we found that the dose of C75 required to produce a 50% reduction in cell viability (IC50) markedly increased from <5 μg/ml in SK-Br3 cells transfected with a nonspecific-targeted RNAi to >15 μg/ml in SK-Br3 cells transiently transfected with 200 nM RNAi FAS. These data shows that specific depletion of FAS by RNAi causes the loss of sensitivity to C75-induced cytotoxicity, thus ruling out a role for non-FAS mediated effects on breast cancer cell toxicity after C75-induced blockade of endogenous fatty acid metabolism. At low cerulenin concentrations, and similarly to C75, breast cancer cell death seems to be due solely to FAS inhibition. The lack or reversion of cerulenin-induced toxicity seen at higher concentrations may reflect involvement of a secondary mechanism other than FAS inhibition. Altogether, these results conclusively confirm that C75-induced cytotoxic damage to breast cancer cells is closely dependent on its ability to inhibit FAS-catalyzed endogenous fatty acid biogenesis.

Pharmacological inhibition of FAS activity synergistically augments Taxol™-induced cytotoxicity in a schedule-dependent manner

The effects of 24 hr co-exposure or 24 hr pre-exposure to sub-optimal doses of C75 on the response of SK-Br3, MCF-7 and MDA-MB-231 breast cancer cell lines to Taxol™ are shown in Table I. IC70 values were chosen to analyze the combination effect of C75 and Taxol™ in terms of cytotoxic condition. To measure the increase in Taxol™ sensitivity, a “sensitization factor” was determined by dividing Taxol™ IC70 values in the absence of C75 by those in the presence of FAS inhibitor. C75 enhanced the cytotoxic activity of Taxol™ in a dose-dependent manner. As the concentration of C75 increased, the efficacy of Taxol™ was significantly increased. After co-exposure for 24 hr, SK-Br3 cells incubated in the presence of C75 showed an up to 3-fold increase at IC70 in Taxol™ sensitivity. For MCF-7 cells, addition of C75 to Taxol™ for 24 hr also markedly increased Taxol™-induced cytotoxicity in a dose-dependent manner (2.1–5.2-fold increase in sensitivity at IC70). Conversely, there was not significant enhancement of Taxol™-induced cytotoxicity when MDA-MB-231 cells were co-exposed to C75. Interestingly, the pre-treatment with the FAS inhibitor for 24 hr, followed by the addition of Taxol™, markedly reduced the ability of C75 to potentiate Taxol™ lethality in SK-Br3 and MCF-7 cells, whereas pre-treatment with C75 significantly increased the sensitivity for Taxol™ of MDA-MB-231 cells (up to 3.8-fold increase in sensitivity at IC70).

Table I. Effects of Chemical FAS Inhibitor C75 on Taxol™-Induced Cytotoxicity in Human Breast Cancer Cells
Cell line[C75] (μg/ml)C75 + Taxol™ (24 h) IC701C75 (24 h) → Taxol™ (24 h) IC70
  • SK-Br3, MCF-7 and MDA-MB-231 cells (104 cells per well) were incubated in serial dilutions of Taxol™ in the absence or presence of a given concentration of C75 for 24 h or incubated with a given concentration of C75 for 24 h and then C75 was washed out prior the introduction of serial dilutions of Taxol™ for 24 h.

  • 1

    IC70 designated for the nM concentrations of Taxol™ required to decrease cell viability by 70%. Data represent the mean ± S.D. of 3 or more experiments.

  • 2

    Numbers in parentheses are the sensitization factors obtained by dividing IC70 values of Taxol™ alone by those when C75 was supplemented.

SK-Br3026 ± 328 ± 6
 0.516 ± 5 (1.7)223 ± 1 (1.2)
 114 ± 4 (1.9)22 ± 2 (1.3)
 211 ± 1 (2.4)20 ± 4 (1.4)
 39 ± 1 (2.9)17 ± 2 (1.6)
MCF-7031 ± 345 ± 5
 0.515 ± 3 (2.1)38 ± 3 (1.2)
 111 ± 1 (2.8)30 ± 8 (1.5)
 28 ± 1 (3.9)27 ± 6 (1.7)
 36 ± 2 (5.2)22 ± 5 (2.0)
MDA-MB-231036 ± 338 ± 1
 0.531 ± 1 (1.2)35 ± 31 (1.1)
 130 ± 2 (1.2)31 ± 2 (1.2)
 228 ± 1 (1.3)16 ± 2 (2.4)
 327 ± 1 (1.3)10 ± 1 (3.8)

C75 alone significantly decreased cell viability of human breast cancer cells at many of the concentrations examined. This indicated the presence of a potentially significant additive/antagonist component. Thus, possible synergistic interactions between C75 and Taxol™ could not be accurately discriminated from additive or antagonistic effects in the basis of the above data alone. Although there remains controversy over which method is best for detecting true in vitro synergy between drug combinations, we first carried out a series of isobologram transformations of multiple dose-response analyses.41 Representative transformations are presented graphically (isobolograms) in Figure 3a,b. The dashed line drawn between the IC70 for C75 alone and the IC70 for Taxol™ alone indicates the alignment of theoretical isoeffect data points for additive interactions between C75 and Taxol™. The true IC70 points (the experimental concentrations of C75 and Taxol™ combined produced 70% reduction in cell survival) were plotted and compared to the additive line. Data points above the dashed diagonal line of the additive effects in the isobole suggest antagonism and those below the diagonal suggest synergism. Although these figures provide a graphical representation of C75-Taxol™ interactions, the values of the mean interaction index (Ix) for a particular cell line, drug combination and effect levels are also labeled. In addition, Student t-tests were computed to evaluate whether significant differences in the Ix means values occurred as compared to a null hypothesized Ix of 1 (addition) and to formally evaluate whether antagonism or synergism was evident. At the 70% effect level, concurrent administration of C75 and Taxol™ resulted in cell killing synergism in SK-Br3 and MCF-7 cells (I70 = 0.790 ± 0.079 and 0.628 ± 0.090, respectively; p < 0.05 vs. I70 = 1.0), whereas this schedule demonstrated additive effects in MDA-MB-231 cells (Fig. 3a, left panel). In the sequential schedule, the Ix values demonstrated additive or marginally antagonistic effects of C75 + Taxol™ in SK-Br3 and MCF-7 cells (Fig. 3b, left panel). Under this schedule, cerulenin and Taxol™ demonstrated a nearly additive interaction at the 70% effect level in MDA-MB-231 cells (I70 = 0.930 ± 0.095).

Figure 3.

Synergy analysis of the cytotoxic interactions between C75 and Taxol™ in breast cancer cells according to the isobologram method (left panels) and the median-effect plot method of Chou and Talalay (right panels). (a) Simultaneous exposure to C75 and Taxol™ for 24 hr. (b) Sequential exposure to C75 for 24 hr followed by Taxol™ for 24 hr. (Left panels) The dashed diagonal line indicates the alignment of theoretical values of an additive interaction between the two compounds. The values of the mean Ix values for a particular combination and effect level are also labeled. mI70 were designated for the mean Ix values ± SD at the 70% cytotoxic effect level (see Material and Methods). Number in parentheses = number of data points. Data points at the 70% cytotoxic effect level were generated from the mean survival fractions from at least 4 triplicate experiments and were fitted to construct the isobols (by order of polynomial, with all R values > 0.95). Data points above the dashed diagonal line of the additive effect in the isobole suggest antagonism and those below the diagonal suggests synergism. Student's t-tests were applied on each set of data points to formally evaluate whether synergism or antagonism was evident for a particular schedule and effect level (as compared to a null hypothesis Ix of 1). *p < 0.05; **p < 0.005. (Right panels) Shown in the figure are plots of the combination index (CI) at various effect levels (fraction affected) for the combination of C75 and Taxol™ in MCF-7, MDA-MB-231 and SK-Br3 cells using different schedules of administration. The CIs were calculated using assumptions for the drug mutually exclusive. The shaded area indicate the additivity area based on null interval of 0.95–1.05; CIs above and below indicate antagonism and synergism, respectively. Results are means of at least three independent experiments made in triplicate. The largest coefficient of variation for each set of experiments was <10%.

To examine in more detail how the degree of synergistic or antagonistic interactions varied as a function of the extent of cell kill, the combined cytotoxic effect of C75 and Taxol™ was assessed using the median-effect analysis of Chou and Talalay.42, 43, 44, 45, 46 This procedure allows the characterization of drug interactions with a single number, the combination index (CI). The CI parameter, similarly to Ix, indicates whether the doses of the 2 agents required to produce a given degree of cytotoxicity are greater than (CI > 1 or antagonism) equal to (CI = 1 or addition) or less than (CI < 1 or synergism) the doses that would be required if the effects of the 2 agents were strictly additive. For this type of analysis and for each drug separately (i.e., C75 alone or Taxol™ alone), we measured how the fraction affected (i.e., fractional cell toxicity) varied with differing doses. For 2 drugs in combination (i.e., C75 + Taxol™ or C75 → Taxol™), we varied the doses of the 2 agents while monitoring the fraction affected; however, the doses were varied such that a constant ratio of Drug 1 (C75) to Drug 2 (Taxol™) was maintained. Specifically, 1.5-, 2.0-, 3.0- and 4.0-fold serial dilutions of C75 and Taxol™ were prepared and combined with each other from the lowest to the highest concentration while monitoring the cell fraction affected. Importantly, the doses were varied such that a constant molar ratio of C75 to Taxol™ was maintained. The combination ratio was designed to approximate the IC50 ratio of the drugs determined in preliminary experiments, so that the contribution of the effect for C75 and Taxol™ in the mixture would be the same (i.e., equi potency ratio). The data were calculated using mutually exclusive assumption that conforms to the classical isobologram equation. Figure 3a (right panel) shows the CI plots for SK-Br3, MCF-7 and MDA-MB-231 cells that were simultaneously exposed to C75 and Taxol™ for 24 hr. Overall, the curves demonstrated synergy between both agents in SK-Br3 and MCF-7 cells (CI50 = 0.671 and 0.768, respectively), whereas addition was observed for MDA-MB-231 cells (CI50 = 1.006). Figure 3b (right panel) illustrates the CI plots obtained for the panel of breast cancer cell lines when they were treated with C75 for 24 hr followed by Taxol™ for 24 hr. C75 pre-treatment produced an additive to antagonistic interaction in SK-Br3 and MCF-7 cells (CI50 = 1.101 and 1.503, respectively). In MDA-MB-231 cells, C75 pre-exposure slightly synergized the cytotoxic effects of Taxol™ (CI50 = 0.757). Thus, the results were closely confined to the interactions concluded in the isobologram analysis. Table II summarizes the nature of the interaction between C75 and Taxol™ resulting from the median-effect analysis of Chou and Talalay at 4 different levels of cell death (30, 50, 70 and 90%).

Table II. Summary of Combination Index (CI) Values of C75-Taxol™ Combinations in Human Breast Cancer Cells
Cell lineSchedule2CI at fraction affected1Interpretation3
30%50%70%90%
  • 1

    Data reflect the CIs (mutually exclusive case) calculated at the fraction affected of 0.3, 0.5, 0.7 and 0.9 of the combination of C75 and Taxol™ and are means of three to six experiments. Standard deviations were less than 20%.

  • 2

    Cells were exposed to the combination of C75 and Taxol™ either simultaneously (24 h) or pre-incubated with C75 for 24 h followed by Taxol™ for 24 h.

  • 3

    CI profiles were compared to a preset “null” interval of 0.95–1.05, so that mean CI values > 1.05 or < 0.95 were interpreted a being suggestive of antagonism and synergism, respectively.

  • 4

    t-Student tests were computed to evaluate whether significant differences in the group means occurred as compared to a null hypothesized CI of 1 (*P < 0.05; **P < 0.001). CI values < 1 indicate synergy, CI = 1 indicates addition, and CI > 1 denotes antagonism.

SK-Br3C75 + Taxol™ (24 h)0.663*40.671*0.701*0.790*Synergism
 C75 (24 h) → Taxol™ (24 h)1.2081.1011.0441.021Addition
MCF-7C75 + Taxol™ (24 h)0.813*0.768*0.768*0.879*Synergism
 C75 (24 h) → Taxol™ (24 h)1.750**1.503**1.315*1.092Antagonism
MDA-MB-231C75 + Taxol™ (24 h)0.9601.0061.0441.021Addition
 C75 (24 h) → Taxol™ (24 h)0.715*0.757*0.8030.892Moderate synergism

Pharmacological inhibition of FAS activity synergistically enhances Taxol™-induced apoptosis in a schedule-dependent manner

We next evaluated the possibility that the synergistic decrease in cell viability of breast cancer cells co-treated with the FAS inhibitor C75 and Taxol™ would represent a cerulenin-promoted enhancement of Taxol™-induced programmed cell death (apoptosis). First, MCF-7 cells were co-exposed to C75 and Taxol™ for 24 hr, and apoptotic cell death was measured by the Cell Death Detection ELISA, which is based on quantitative enzyme-immunoassay-principle using mouse monoclonal antibodies directed against DNA and histones that allows the specific determination of mono- and oligo nucleosomes that are released into the cytoplasm of cells dying from apoptosis. In this treatment, we used the lowest clinically relevant concentration of Taxol™ that blocks normal cell cycle progression at the G2-M phase of the cell cycle (10 nM). With this protocol, Taxol™ by itself induced a 7-fold increase in basal apoptosis (e.g., vs. untreated cells), whereas administration of a sub-optimal concentration of C75 (2.5 μg/ml) alone exerted almost negligible effects on apoptotic cell death of MCF-7 cells (Fig. 4, left panel). More importantly, the inhibition of FAS activity with C75 together with Taxol™ resulted in an enhancement of apoptosis that was significantly higher than the additive value of the 2 drugs alone. Thus, C75 and Taxol™ combined caused 2 times more apoptotic cell death than Taxol™ alone, and 14 times more apoptotic cell death than C75 alone. A completely different picture emerged when MCF-7 cells were pre-treated with C75 for 24 hr prior Taxol™ exposure. Thus, sequential administration of C75 followed by Taxol™ exerted little effects on Taxol™-mediated apoptosis (Fig. 4, right panel). Consistent with previously observed sequence-dependent synergism using the isobologram and Chou and Talalay cytotoxic analyses, these findings suggest that co-exposure of MCF-7 breast cancer cells to FAS inhibitor C75 and Taxol™ is necessary for maximal augmentation of Taxol™-induced apoptotic cell death, whereas sequential administration of C75 followed by Taxol™ did not increase apoptosis relative to cells exposed to Taxol™ alone.

Figure 4.

C75-induced inhibition of FAS activity synergistically enhances Taxol™-induced apoptotic cell death in a schedule-dependent manner. MCF-7 cells were left untreated or treated with 2.5 μg/ml C75, 10 nM Taxol™, or a combination of C75 + Taxol™ using different schedules of administration. Histone-associated DNA fragments in cytoplasmic fractions of cell lysates were determined using a photometric enzyme immunoassay as per manufacturer's instructions. Data were expressed as mean fold increases in absorbance values using the formula [A405nm − A490nm]TREATED/[A405nm − A490nm]UNTREATED. Shown are means (columns) ± SD (bars) from 3 separate experiments in which duplicate measurements were made (**p < 0.005; Student's t-test; n.s., not statistically significant).

The concurrent combination of FAS inhibitor C75 and Taxol™ synergistically activates p38 MAPK

Although the biochemical basis of Taxol™-induced apoptotic cell death is unclear, there is increasing evidence that both cell death and cell survival-pathways are concomitantly activated during mitotic arrest by Taxol™. Indeed, Taxol™-induced modulation of stress-activated MAPKs, such as the pro-apoptotic p38 MAPK pathway, has been shown to be necessary for Taxol™-induced cell death.39, 52, 53 We hypothesized that inhibition of FAS activity may contribute to the endogenous p38 MAPK pro-apoptotic signaling in Taxol™-treated breast cancer cells. To test this hypothesis, we monitored nuclear translocation of p38 MAPK by immunofluorescence with a phospho-p38 MAPK antibody detecting p38 MAPK only when activated by dual phosphorylation at Thr180 and Tyr182. A slight phosphorylation of p38 MAPK was observed when MCF-7 cells were exposed to 10 nM Taxol™ for 6 hr (Fig. 5a, top panels). Similarly, C75-treated MCF-7 cells displayed a weak activation of p38 MAPK (Fig. 5a, top panels). Interestingly, the combination of C75 and Taxol™ strongly activated the enzyme as dual-phosphorylated p38 MAPK was clearly seen in the nuclei of MCF-7 cells (Fig. 5a, top panels). The increases in p38 MAPK activation were verified by Western blot analyses (Fig. 5a, bottom panels). Because activation of the p38 MAPK pathway temporally preceded a synergistic decrease in cell survival due to apoptosis, these results indicate that increased p38 MAPK activity may be crucial for the enhanced apoptosis observed when MCF-7 cells were simultaneously treated with Taxol™ and C75.

Figure 5.

C75-induced inhibition of FAS activity modulates Taxol™-activated cell death and cell survival-signaling pathways in breast cancer cells. (a,b) C75-induced inhibition of FAS activity synergistically enhances Taxol™-induced Serine-46 phosphorylation of p53 in a p38 MAPK-dependent manner. (Top panels) MCF-7 cells were seeded at a density of 5 × 103 cells/well in a 4-well chamber slide, and then treated for 6 hr with Taxol™, C75 or a combination of C75 + Taxol™. Cells were fixed and permeabilized (see Material and Methods) and then incubated for 2 hr with specific antibodies directed against phosphor-p38 MAPK, p53 and p53Ser46. After labeling, cells were extensively washed and localization of phosphor-p38 MAPK, p53 and p53Ser46 was detected by indirect immunofluorescence by incubating with FITC- or TRITC-conjugated anti-rabbit IgGs Figure shows a representative immunostaining analysis after counterstaining with DAPI. Similar results were obtained in 3 independent experiments. (Bottom panels) Total protein was isolated from MCF-7 cells after treatment with Taxol™ ± C75 in the absence or presence of SB203580 for 6 hr, and either the activation status of p38 MAPK or the phosphorylation status of p53 at Ser46 was determined by immunoblotting using specific antibodies. The blots were stripped and re-probed with antibodies for total p38 MAPK and p53 proteins and β-actin to assess equal loading of lysate proteins and transfer. (c) C75-induced FAS blockade leads to ERK1/ERK2 MAPK activation. (Top left panel) MCF-7 cells were seeded at a density of 5 × 103 cells/well in a 4-well chamber slide, and then treated for 6 hr with 2.5 μg/ml C75 in the absence or presence of 20 μM U0126. Cells were fixed and permeabilized (see Material and Methods) and then incubated for 2 hr with a polyclonal antibody directed against phosphor-ERK1/2 MAPK. After labeling, cells were extensively washed, and localization of phosphor-ERK1/2 MAPK was detected by indirect immunofluorescence by incubating with a FITC-conjugated anti-rabbit IgG. Figure shows a representative immunostaining analysis after counterstaining with DAPI. Similar results were obtained in 3 independent experiments. (Bottom left panel) Total protein was isolated from MCF-7 cells after treatment with C75 ± U0126 for 6 hr, and the activation status of ERK1/2 MAPK was determined by immunoblotting using a specific antibody. The blots were stripped and re-probed with antibodies for total ERK1/2 MAPK and β-actin to assess equal loading of lysate proteins and transfer. (Right) Total protein was isolated from MCF-7 cells after simultaneous exposure to C75 and Taxol™ for 24 hr (top) or sequential exposure to C75 for 24 hr followed by Taxol™ for 24 hr (bottom). The activation status of ERK1/2 MAPK was determined by immunoblotting using a specific antibody. The blots were stripped and re-probed with antibodies for total ERK1/2 MAPK and β-actin to assess equal loading of lysate proteins and transfer. (d) Inactivation of the anti-apoptotic AKT activity by the combined treatment of C75 and Taxol™. (Left panel) Protein was isolated from MCF-7 cells after treatment with C75 in the absence or presence of Taxol™ for 24 hr, and AKT activation was determined by immunoblotting using a phosphor-AKTSer473 polyclonal antibody. The blot was stripped and reprobed with antibodies for total AKT protein and β-actin to assess equal loading of lysate proteins and transfer. (Right panel) Immunoreactive bands for phosphor-AKTSer473 were scanned and normalized to total AKT. After a second normalization to β-actin, the control value was set to 100% and the different treatment groups were expressed as a percentage of control levels. Data are presented as the mean ± SD of 2 independent experiments and the asterisks indicate values that are significantly different (*p < 0.05, **p < 0.005; Student's t-test vs. DMSO-treated cells).

Serine-46 phosphorylation of p53 is synergistically augmented in breast cancer cells treated with the combination of FAS inhibitor C75 and Taxol™

Numerous cellular insults, including Taxol™-induced microtubule disruption, elevate the levels of p53 tumor suppressor protein, which plays a key role in the regulation of stress-mediated cell growth arrest or apoptosis.54, 55 Although it remains largely unknown how p53 selects the pathways of growth arrest or apoptosis, it has been shown that phosphorylation plays an important role in regulating biological activities of p53.54 Specifically, phosphorylation of Ser46 is important in determining the ability of p53 to induce apoptosis.56, 57, 58 Most relevant to our study, the p38 MAPK phosphorylates p53 on Ser46 and inhibition of p38 MAPK activity reduces p53-mediated apoptosis,56, 57, 58 suggesting that the pro-apoptotic activity of p38 MAPK signaling may function through the p53 pathway.58

Because C75 exposure synergistically enhanced paclitaxel-induced activation of p38 MAPK and p53 phosphorylation has recently been proposed to be important for p53 stabilization and activation after Taxol™ treatment,59, 60, 61 our goal was to determine if p53 phosphorylation did increase after FAS inhibition, and if so, to identify how FAS blocker C75 did modulate Taxol™-induced phosphorylation of p53 at Ser46. Cellular localization of total p53 and phospho-p53Ser46 was carried out by indirect immunofluorescence microscopy before and after Taxol™ exposure in the absence or presence of FAS blocker C75. Fig. 5b (top panels) shows the immunodetection profile obtained for total p53 and phospho-p53Ser46 in unstressed MCF-7 breast cancer cells. Both p53 and phospho-p53 could be seen as fine granules of fluorescence more or less evenly distributed throughout both the cytoplasm and the nucleus of MCF-7 cells. The faint nuclear staining of total p53 and phospho-p53Ser46 under basal conditions slightly changed to a more intense nuclear labeling after single exposure to Taxol™ or C75, and a more pronounced nuclear accumulation of total p53 was found in MCF-7 cells co-exposed to Taxol™ and C75. Importantly, a dramatic accumulation of phospho-p53Ser46 appeared in the nuclei of Taxol™-treated MCF-7 cells in the presence of C75, which was reversed in the presence of the specific p38 MAPK inhibitor SB203580 (Fig. 5b, bottom panels). These data confirm that FAS inhibition induces accumulation of p53 tumor suppressor protein in breast cancer cells.20, 62 In addition, our findings show for the first time that pharmacological inhibition of FAS activity is also capable of activate phosphorylation of p53 at Ser46 in a p38 MAPK-dependent manner, a non-genotoxic phosphorylation of p53 involved in induction of p53-dependent apoptosis.57 More importantly, FAS inhibition markedly enhances Taxol™-induced phosphorylation of p53 at Ser46, a change that may increase the affinity of p53 to promoters of apoptosis-related genes compared to promoters of cell growth arrest.57

C75-induced inhibition of breast cancer-associated FAS activity stimulates the MEK1/2 → ERK1/2 pro-survival signaling

Taxol™ activates a number of signal transduction pathways leading to apoptosis, but it also enhances the activation of the Raf-mitogen-activated protein kinase kinase-extracellular signal-regulated kinase (Raf-MEK-ERK) pathway, which is expected to increase cell proliferation and survival, and may compromise the efficacy of Taxol™ in cancer treatment. Accordingly, it has been shown that inactivation of MEK markedly enhances Taxol™-induced apoptosis in various tumor cell lines.63, 64, 65, 66

Because sequential administration of FAS inhibitor C75 followed by Taxol™ significantly reduced the susceptibility of MCF-7 cells to Taxol™-induced apoptotic cell death, we hypothesized that C75-induced inhibition of FAS activity may perhaps target the MEK1/2 → ERK1/2 pro-survival pathway. First, activation of ERK1/ERK2 by C75 was monitored by indirect immunofluorescence and Western blot analysis using polyclonal antibodies recognizing the activated form of the enzymes (Fig. 5c, left panels). Almost no activated ERK1/ERK2 was detected in untreated cells. Interestingly, treatment with low doses of C75 was associated with a dramatic nuclear translocalization of activated ERK1/ERK2 enzymes. When MCF-7 cells were co-treated with a combination of C75 and MEK1/MEK2 inhibitor U0126, almost no activated ERK1/ERK2 was detected. These results demonstrate that perturbation of FAS activity is a novel upstream event regulating the MEK1/2 → ERK1/2 signaling cascade in MCF-7 breast cancer cells.

In other systems, ERK1/ERK2 generally plays a critical role in cell proliferation and survival; thus, it was reasoned that ERK1/ERK2 activation by FAS inhibitor cerulenin might enhance cell proliferation and compromise the efficacy of the drug. To test whether C75-induced ERK1/ERK2 activation could protect the cells from C75-mediated toxicity, we evaluated the metabolic status of MCF-7 cells treated with C75 in the absence or presence of the MEK1/MEK2 inhibitor U0126. The combination of C75 and U0126 significantly increased the ability of C75 to decrease MCF-7 cell viability, whereas cytotoxic effects of U0126 alone were not apparent at the concentrations used in the combination (data not shown). These findings strongly suggest that the MEK1/2 → ERK1/2 pathway does not mediate C75-induced cytotoxicity but may actually protect cells from death. Importantly, the activation status of ERK1/2 after exposure to Taxol™, C75 or a combination of these 2 drugs varied in a schedule-dependent manner. Figure 5c (right panels) demonstrates that singly, Taxol™ or C75, significantly increase ERK1/ERK2 activity, whereas the concurrent combination of Taxol™ and C75 downregulates the activation status of ERK1/ERK2. Conversely, in the sequential schedule, Taxol™- and C75-induced activation of ERK1/ERK2 was not reduced in Taxol™-treated cells after C75 exposure. This indicates that a simultaneous combination of Taxol™ and C75 can reproduce the previously described pro-apoptotic effects of Taxol™ and MEK inhibitors,63, 64, 65, 66 whereas a sequential combination of C75 followed by Taxol™ promotes a significant stimulation of the MEK1/2 → ERK1/2 pathway, which may promote cell proliferation and survival, thus determining an antagonistic interaction between FAS blocker C75 and Taxol™.

C75-induced inhibition of breast cancer-associated FAS activity decreases AKT Kinase activity

Another pathway thought to play an important role in breast cancer cell responses to Taxol™ is the PI-3′K signaling pathway, which together with its downstream target AKT, promotes cellular proliferation, cellular survival, and anti-apoptotic responses. Indeed, it has been shown that pharmacological inhibition of PI-3′K activity significantly enhances Taxol™-induced cytotoxicity and apoptosis against human breast cancer cells.66 Therefore, we finally speculated that C75-induced synergistic augmentation of Taxol™ cytotoxicity against MCF-7 cells could be related to a blockage of AKT pro-survival activity in these cells. For this purpose, MCF-7 cells were treated with increasing concentrations of C75 in the absence or presence of Taxol™ for 24 hr. As phosphorylation of AKT on Ser-473 is required for its activation, we monitored this site using an antibody that specifically reacts with phosphorylated Ser-473. Interestingly, the constitutive levels of phosphorylated AKT in MCF-7 cells were significantly downregulated in a dose-dependent fashion in the presence of low-concentrations of C75, whereas the levels of total AKT remained unchanged (Fig. 5d). Importantly, treatment of MCF-7 cells with a combination of Taxol™ and C75 reduced the level of AKT activity by 75–80% as compared to control cells. These data indicate that the serine-threonine protein kinase AKT, which is a key cellular signal that promotes breast cancer cell proliferation and survival, is exquisitely sensitive to C75-induced blockade of FAS activity. Moreover, the enhanced apoptosis observed with a concurrent combination of C75 and Taxol™ may associate with a reduction of the pro-survival kinase AKT.

Small interference RNA (siRNA)-mediated inhibition of FAS expression synergistically enhances Taxol™-induced apoptotic cell death in multidrug-resistant breast cancer cells

Although our current approach strongly suggests that C75-induced sensitization to Taxol™-induced cytotoxicity should occur through the specific inhibition of FAS activity, we finally hypothesized that, if C75-dependent blockade of FAS activity is the most important molecular mechanism responsible for C75-induced Taxol™ sensitization, a down-regulation of FAS gene expression would lead to breast cancer cell hypersensitivity to Taxol™. To evaluate this hypothesis, FAS-overexpressing SK-Br3 cells were exposed to 25 nM Taxol™ and 30 min later they were transfected with 200 nM of siRNA oligos targeting FAS gene. At 72 hr after transfection, apoptotic cell death was measured by the Cell Death Detection ELISA. With this protocol, Taxol™ by itself induced a 6-fold increase in basal apoptosis (e.g., vs. untreated cells), whereas specific silencing of FAS expression induced four-fold augment in apoptotic cell death of SK-Br3 cells. These findings clearly demonstrate that RNAi-mediated silencing of FAS expression significantly induces cell death in SK-Br3 cells, thereby lending additional support to the contention that FAS-dependent signaling is necessary for breast cancer cell survival. More importantly, FAS RNAi-induced silencing of FAS expression together with Taxol™ resulted in an enhancement of apoptosis that was significantly higher than the additive value of the 2 treatments alone (Fig. 6a). Thus, siRNA FAS and Taxol™ combined caused 2 times more apoptotic cell death than Taxol™ alone, and up to 6 times more apoptotic cell death than siRNA FAS alone.

Figure 6.

Effects of siRNA-induced silencing of FAS gene expression on Taxol™-induced apoptotic cell death in SK-Br3 and multi-drug resistant MCF-7/AdrR breast cancer cells. SK-Br3 (a) and MCF-7/AdrR (b) cells were treated with Taxol™ (25 and 250 nM, respectively), siRNA FAS (200 nM), or a combination of Taxol™ + siRNA FAS for 72 hr (see Material and Methods). Histone-associated DNA fragments in cytoplasmic fractions of cell lysates were determined using a photometric enzyme immunoassay as per manufacturer's instructions. Data were expressed as mean fold increases in absorbance values using the formula [A405nm − A490nm]TREATED/[A405nm − A490nm]UNTREATED. Shown are means (columns) ± SD (bars) from 3 separate experiments in which duplicate measurements were made (*p < 0.05, **p < 0.005; Student's t-test). MCF-7/AdrR breast cancer cells were transfected with increasing concentrations of siRNA-targeting FAS or with a non-specific control siRNA Pool (negative control) for 72 hr. Equal amounts of total protein (10 μg per lane) from wild-type MCF-7, MCF-7/AdrR and siRNA FAS-transfected MCF-7/AdrR cells were subjected to immunoblotting analyses with specific antibodies against FAS or β-actin (see Material and Methods).

Because MDR1-encoded P-glycoprotein (p170MDR1) has been implicated in Taxol™ resistance,67, 68, 69 we finally evaluated whether FAS blockade may modulate Taxol™ sensitivity in p170MDR1-overexpressing MCF-7/AdrR breast cancer cells, which demonstrated a slight increase in FAS expression when compared to wild-type MCF-7 cells (Fig. 6b). Likewise, very high concentrations of Taxol™ (250 nM) were required to obtain an equivalent increase in basal apoptosis to that found in wild-type MCF-7 cells (7-fold increase in apoptotic cell death after exposure to 10 nM Taxol™), whereas RNAi-mediated silencing of FAS expression induced a 2-fold augment in apoptotic cell death of MCF-7/AdrR cells. Interestingly, the specific silencing of FAS expression together with Taxol™ resulted in a synergistic enhancement of apoptotic cell death. Thus, siRNA FAS and Taxol™ combined caused 3 times more apoptotic cell death than Taxol™ alone, and up to 8 times more apoptotic cell death than siRNA FAS alone (Fig. 6b). These data show that C75-induced synergistic enhancement of Taxol™-induced apoptotic cell death through its FAS target, and show further that siRNA-induced suppression of FAS gene expression restores Taxol™ sensitivity to multidrug-resistant breast cancer cells.

Discussion

The differential expression of FAS between cancer and normal cells may provide a useful molecular target for development of novel therapeutic anti-metabolites. Given the widespread expression of FAS in many types of human cancers,11 combinations of conventional agents with novel drugs directed against FAS-dependent endogenous fatty acid biosynthesis may provide increased efficacy over existing therapy for common human malignancies. Our present study provides the first evidence of cytotoxic interactions between Taxol™ and C75, a chemically stable slow-binding FAS inhibitor, in human breast cancer cells.

Our study confirmed that C75-induced cytotoxicity was proportional to FAS expression and activity in the human breast cancer cell lines tested. This correlated with several previous studies showing that the greatest cytotoxicity of chemical FAS blockers is seen when cells overexpress FAS.4 More importantly, pharmacological inhibition of FAS activity significantly enhanced the cytotoxic effects of Taxol™ toward human breast cancer cells. To evaluate the nature of each combination, which might be synergistic, additive, or antagonistic, we used the isobologram and Chou and Talalay analyses, 2 mathematical methods employed for assessing the combined effect of anti-tumor drugs in vitro as a pre-clinical screening test.41, 42, 43, 44, 45, 46 Our studies demonstrated that the greatest number of synergistic combinations as well as the greatest magnitude of synergy was observed in FAS-overexpressing SK-Br3 cells, whereas low-FAS-expressing MDA-MB-231 demonstrated the lowest number of synergistic combinations as well as the lowest magnitude of synergy between C75 and Taxol™. Moreover, we observed that the nature of the cytotoxic interaction between C75 and Taxol™ in individual breast cancer cell lines was sequence-dependent. Thus, synergism was observed mainly when breast cancer cells were exposed to the 2 agents simultaneously, whereas additive or even antagonistic interactions were observed when chemical FAS blocker C75 preceded Taxol™. From a clinical perspective these findings suggest that the simultaneous administration of FAS inhibitors and Taxol™ may be the optimal schedule for the combination in terms of cytotoxic effects. Although the ultimate molecular mechanisms of interaction operating with these schedules were not conclusively addressed by our experiments, these events were associated with several signaling interactions. In agreement with earlier studies, exposure to Taxol™ leaded to slight increases in the activation status of p38 MAPK and ERK1/ERK2 MAPK. Interestingly, p38 MAPK and ERK1/2 were also molecular targets in cells exposed to FAS inhibitor C75. Thus, it is reasonable to suggest a working model of signaling interactions in breast cancer cells exposed to C75 and Taxol™, in which the relative outputs of these pathways may influence the schedule-dependent synergistic cell death response to FAS inhibition (Fig. 7). Co-exposure of Taxol™-treated cells to C75 synergistically activated p38 MAPK, induced further a dramatic accumulation of p53 phosphorylated at Ser46, a p38 MAPK-regulated pro-apoptotic modification of p53, and concomitantly decreased the level of active AKT and ERK1/ERK2 (data not shown). Thus, the shift toward stress (e.g., p38 MAPK) and away from anti-apoptotic and cytoprotective (e.g., AKT, ERK1/ERK2) signaling pathways, may contribute to the observed C75-induced synergistic potentiation of Taxol™ lethality under a concomitant schedule. On the contrary, pre-exposure to C75 strongly activates ERK1/ERK2 MAPK signaling, which, in turn, may raise the sensitivity threshold for Taxol™-induced cell death, then contributing to the observed lost of synergism between C75 and Taxol™ under a sequential schedule.

Figure 7.

Working model of signaling interactions in MCF-7 breast cancer cells exposed to FAS inhibitor C75 and Taxol™. In MCF-7 cells, exposure to C75 or Taxol™ leads to activation/inactivation of several signaling cascades involved in cell proliferation, survival and apoptosis. The relative outputs of these pathways may influence the apoptotic cell death response to these agents in a schedule-dependent manner. Exposure of C75-pretreated cells to Taxol™ does not oppose the sustained activation of the proliferation and cell survival MEK1/2 → ERK1/ERK2 MAPK pathway induced by C75 and Taxol™ as single agents, and modestly increases and decreases p38 MAPK and AKT activation, respectively (data not shown). In contrast, the combined treatment of C75 and Taxol™ opposes the sustained ERK1/2 MAPK response to single treatments, markedly increases expression of phosphor-p38 MAPK which, in turn, phosphorylates p53 at Ser46, a pro-apoptotic post-transductional modification of p53, and significantly inactivates the anti-apoptotic AKT activity. Thus, the shift toward stress (e.g., p38 MAPK, phosphor-p53Ser46) and away from cytoprotective (e.g., ERK1/2, AKT) signaling pathways, particularly when combined with as yet to be defined perturbations in cell cycle progression or mitotic events, may contribute to the observed C75-induced schedule-dependent potentiation of Taxol™ lethality in MCF-7 breast cancer cells.

Although C75 is not a DNA-damaging agent, it has been shown recently that FAS inhibitors can induce the accumulation of p53 and of its main down-stream effector, the inhibitor of cyclin-dependent kinases p21WAF1/CIP1.20, 62 Specifically, we have observed that pharmacological inhibition of FAS activity induces dose- and time-dependent accumulation of the CDKi p21WAF1/CIP1 in both wild-type p53 cells (MCF-7) and mutant p53 cells (SK-Br3 and MDA-MB-231), although the degree of induction was greater in MCF-7 cells. These data suggest that the treatment with C75 in combination with Taxol™ may synergistically increase p21WAF1/CIP1 protein levels, enhancing pro-apoptotic signals. It must be taken into account, however, that anti-mitotic drugs such as Taxol™ can induce mitotic arrest only in cells that enter mitosis; and in turn, prolonged mitotic arrest causes cell death.38, 39, 40 As cells are most sensitive against anti-mitotic drugs in M phase, it is likely that C75, which produces inhibition of DNA replication and S phase progression preventing the tumor cells from entering the G2-M phase of the cell cycle,18, 20, 27 would be antagonistic if C75 precedes anti-microtubule drugs exposure. In agreement with this speculation, sequential exposure to C75 followed by Taxol™ had strong antagonistic effects in MCF-7 cells. In this context, cytoprotective effects of p53-dependent p21WAF1/CIP1 induction against paclitaxel-induced cytotoxicity have been demonstrated previously.70–72 This protection requires an intact p53/p21WAF1/CIP1 pathway.73 In wild-type p53 MCF-7 cells, C75-induced p53-dependent p21WAF1/CIP1 overexpression may cause complete cytoprotection by preventing entry into mitosis when cells are exposed to C75 first. Conversely, it has been demonstrated that lack of wild-type p53 or its transcriptional target, p21WAF1/CIP1, allows cells to enter mitosis after DNA damage.73 Moreover, pretreatment with cytostatic doses of DNA-damaging drugs before treatment with anti-mitotic drugs results in selective cytotoxicity to cancer cells with defective p53/ p21WAF1/CIP1-dependent checkpoint.74 In mutant p53 and low-FAS-expressing MDA-MB-231 cells, sequential exposure to C75 followed by Taxol™ resulted in higher cytotoxicity than the simultaneous schedule. Therefore, although viewed as an unfavorable event, inactivation of p53 could be elegantly exploited for therapeutic advantage in designing clinical regimens including anti-metabolites directed against FAS. Accordingly, a previous report showed that loss of p53 function substantially increased the sensitivity of tumor cells to FAS inhibitors in the absence of FAS overexpression.20

C75 treatment of human breast cancer xenografts has shown significant anti-tumor activity with concomitant inhibition of fatty acid synthesis in tumor tissue and normal liver.19 Importantly, histopathological analysis of normal tissues after C75 treatment showed no adverse effects on proliferating cellular compartments, such as bone marrow, gastrointestinal tract, skin or lymphoid tissues.

Increasing bodies of in vitro and in vivo evidence suggest strongly that pharmacological inhibition of FAS represents a novel therapeutic approach in human breast cancer. We establish for the first time that pharmacological inhibition of breast cancer-associated FAS hyperactivity potentiates the efficacy of microtubule inhibitor Taxol™. Of note, our current findings strongly suggest that the primary mechanism responsible for C75-induced breast cancer sensitization to Taxol™ was mediated through its interaction, and inhibition of FAS. Thus, RNA interference-mediated silencing of the FAS gene significantly enhanced Taxol™-induced apoptotic cell death of breast cancer cells, thus ruling out a role for non-FAS C75-mediated effects on breast cancer cell sensitivity to Taxol™. Moreover, siRNA-induced suppression of FAS gene expression was able to restore Taxol™ sensitivity to multidrug-resistant breast cancer cells. Considering that we demonstrated recently that inhibition of FAS specifically suppresses Her-2/neu (erbB-2) oncogene overexpression in breast cancer cells,75 we are investigating currently whether blockade of FAS activity similarly regulates Taxol™-induced cytotoxicity in in vitro breast cancer models engineered to overexpress Her-2/neu, one of the key molecular mechanisms determining Taxol™ resistance in cancer cells.76 Nevertheless, our current study suggests strongly that FAS activity is a novel regulator of Taxol™ efficacy in breast cancer cells. Taken into account that we showed recently that cerulenin, a less specific FAS blocker, induced a synergistic chemosensitization of human breast cancer cells to docetaxel (Taxotere™) and vinorelbine (Navelbine™),77, 78 it is reasonable to suggest that novel therapeutic strategies suppressing breast cancer-associated FAS hyperactivity can be exploited to improve the efficacy of existing breast cancer chemotherapies based on microtubule-interfering agents.

Acknowledgements

J.A. Menendez is the recipient of a Translational Research Pilot Project (PP2) from the Specialized Program of Research Excellence (SPORE) in Breast Cancer (Robert H. Lurie Comprehensive Cancer Center, Chicago, IL), of a Basic, Clinical and Translational Award (BRCTR0403141) from the Susan G. Komen Breast Cancer Foundation (USA), and of a Breast Cancer Concept Award (BC033538) from the Department of Defense (USA).

Ancillary