SEARCH

SEARCH BY CITATION

Keywords:

  • estrogen receptor;
  • hypermethylation;
  • lung cancer

Abstract

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Disscussion
  6. References

It has been documented that estrogen receptor (ER) transcription silencing due to hypermethylation is linked to the tumor progression of breast, uterine and prostate cancers. Additionally, ER hypermethylation in lung tumors has been associated with the exposure of specific carcinogens in animal study. The role of hypermethylation-induced ER transcription silencing in lung tumor progression and its prognostic value for non-small cell lung cancer (NSCLC) patients remained unclear. In our study, ER hypermethylation of 123 lung tumors and adjacent normal parts were examined by methylation-specific PCR (MSP). Estrogen receptor mRNA expression in lung tumors was determined by RT-PCR. Our data indicated that ER hypermethylation was only detected in lung tumors, but not in adjacent normal lung tissues. This suggests that ER hypermethylation may be associated with lung tumorigenesis. Among the clinical parameters studied, only gender factor was correlated with ER hypermethylation with a higher frequency of ER hypermethylation being in male patients than in female patients (58 vs. 34%, p = 0.01). After being stratified by gender and cigarette smoking status, a similarly high prevalence of ER hypermethylation was found in male smoking and nonsmoking patients (60 vs. 61%) as compared to that of female nonsmoking patients (34%). To investigate if 17-β estradiol (E2) was responsible for such gender difference in ER hypermethylation, a lung cancer A549 cell with ER hypermethylation and without ER mRNA expression was treated with E2 of various concentrations for defined time intervals to show that an E2 treatment could restore the expression of ER mRNA and eliminate ER hypermethylation. Western blot data also showed that acetylated histone 3 and histone 4 of chromatin were increased significantly by E2 treatment. Thus, E2 can make ER mRNA re-expression by eliminating ER hypermethylation. To elucidate the prognostic value of ER hypermethylation, Kaplan-Meier analysis was carried out to show that patients with ER hypermethylation had a poorer prognosis than those without ER hypermethylation. Such prognostic prediction, however, applied only to male (p = 0.0044) patients. Cox regression analysis further showed the feasibility of ER hypermethylation as an independent prognostic factor of NSCLC (p = 0.007). It is possible that antiestrogens may have different therapeutic values for male and female lung cancer patients. © 2005 Wiley-Liss, Inc.

Non-small cell lung cancer (NSCLC) accounts for 75–80% of lung cancer patients and its dismal survival rate has been improved only marginally in the past 2 decades. The 5-years survival rate of patients with NSCLC is only about 15%.1 This illustrates the need for more effective strategies for early diagnosis and chemoprevention. Identification of useful biomarkers for early detection and predication of patient survival are important to determine a better clinical treatment and our findings may be helpful for the clinical outcome of NSCLC patients.

Previous studies have indicated that ER β was detected in all tested lung cancer cell lines and lung tumor tissues compared to ER α that was partially detected in lung cell lines and lung tumor tissues.2, 3 We considered that ER α may play a more important role than ER β in lung cancer. Our study was focused on ER α (ER). The ER is located on chromosome 6q25.14, 5 and belongs to the super family of transcription activators.6, 7 Its protein product is a transcription factor that regulates the expression of estrogen responsive gene by binding to a specific DNA sequence found in their regulatory regions. As a mediator of estrogen hormone action, ER is involved in many physiological processes.8 Loss or downregulation of ER expression in breast,9, 10 ovary11, 12 and prostate cancers13 has been documented frequently. Low ER expression was also associated with a poor prognosis for effective endocrine therapy.14, 15, 16 Mechanisms regulating the expression of ER are poorly defined, unfortunately, and no mutation or other gross structure alteration of the ER gene in lung cancer has been reported that could clarify the mechanism. Our previous reports indicated that DNA adduct levels may act as a risk marker of lung cancer and the adduct levels in female nonsmoking lung cancer patients were significantly higher than those of male nonsmoking patients.17, 18 We suggested that ER might play a role in the gender difference of DNA adduct levels, and it may be helpful to understand why female lung cancer had a higher susceptibility to DNA damage derived from environmental carcinogens. We hypothesized that gender difference in loss of ER expression may affect lung cancer risk. Additionally, ER inactivation by promoter hypermethylation may alter antiestrogen therapeutic response that would result in different prognostic values between male and female lung cancer patients.

Loss of ER expression has been associated with aberrant 5′CpG island hypermethylation in breast cancer cell lines and their tumor tissues.19, 20 The cause of aberrant hypermethylation in lung cancer and the clinical determinants associated with such hypermethylation have not been well defined. Observations in animal model of lung cancer have indicated that ER gene hypermethylation was contributed partially by carcinogenic insults that induced tumor formation. In this model, ER gene in spontaneous and radiation-induced tumors was much more likely to be methylated than that in tumors induced by the tobacco-derived carcinogen, NNK.21, 22 This data suggests the possibility that ER hypermethylation may be also associated with specific clinical characteristics in lung tumors. Stabile et al.2 indicated that estrogen signaling played a biological role in lung tissues and that estrogen could potentially promote lung cancer, either through direct actions on preneoplastic or neoplastic cells or through indirect action on lung fibroblasts. It was conceivable that loss of ER expression by promoter hypermethylation may modulate lung tumor progression and even have different prognostic values between male and female NSCLC patients.

Material and methods

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Disscussion
  6. References

Study subject

Lung tumor cancer tissues obtained by surgical resection and adjacent normal lung tissues were collected respectively from 123 NSCLC lung cancer patients (58 male smokers, 33 male nonsmokers, 32 female nonsmokers) admitted to Taichung Veterans General Hospital, Taichung, Taiwan between 1997–2001. Patients were followed up from January 1997 with a combination of active follow-up and record linkage to the death certificates. Their censoring data was assigned to be December 31 2001, 6 months before our search of the vital statistics registry, to follow for a possible delay of entry of the death certificates into the registry. No lung tumors for female smokers were available for our study because <10% of female lung cancer patients were smokers in Taiwan, and most cases could not be carried out with surgical therapy because they were diagnosed to be advanced lung cancer. The histology, types and stages of tumors were determined according to the WHO classification method (WHO, 1982). Information on smoking history of lung cancer patients was obtained from hospital records and used to categorize patients into smoking and non-smoking groups. Tissues were stored at −80°C after resections until used.

Methylation-specific PCR

Genomic DNA was isolated from lung tumor tissues and A549 cells by conventional phenol-chloroform extraction and ethanol precipitation. Hypermethylation status of the ER promoter region was determined by a bisulfite genomic sequencing protocol and methylation-specific PCR (MSP).23 The bisulfite-modified DNA was amplified by using primers specific for the methylated and unmethylated ER sequence, respectively.23, 24 The ER CpG islands were amplified from bisulfite-treated genomic DNAs by PCR using the same pairs of primers described earlier.23 Amplified products were sequenced using the ABI sequencing system (Applied Biosystem, Foster City, CA).

RT-PCR analysis

The expression of ER in lung cancer tumors and A549 cells was examined by RT-PCR. Total RNA from lung cancer tissues was extracted by Trizol regent (Life Technologies, Grand Island, NY) according to the manufacturer's recommendations. First-strand cDNA synthesis with oligo-dT primers was carried out using Superscript II (reverse transcriptase). The size of amplified ER fragment was identified to be 782 bp with the primers described as below: sense, GCAATGACTATGCTTCAGGCTACC; antisense, AGGCACACAAACTCCTCTCCC. GAPDH and 18s rRNA were used as an internal control for RT-PCR.

Cell culture

A549, a human lung cancer cell line, was grown in RPMI-1640 supplemented with 10% FBS, penicillin (100 U/ml), streptomycin (100 mg/ml) and 5% glucose. Under estrogen-depleted conditions, cells were grown in estrogen-depleted medium, consisting of phenol red-free RPMI-1640 (Sigma, St. Louis, MO), 10% charcoal-stripped FBS, penicillin (100 U/ml), streptomycin (100 mg/ml) and 5% glucose as described previously. Cells were grown in a 37°C humidified incubator with 5% CO2.

In vitro treatment of lung cells with 5-AZA-dCyd

Cells were plated with a density of 3 × 105/100 cm2 dish and incubated for 24 hr. Culture media were replaced with a media containing 10 nM 5-AZA-dCyd (5-aza-2-deoxycytidine; Sigma, St. Louis, MO), dissolved in 50% acetic acid and storage at −80°C). After an incubation of 5 days, treated cells were subjected to molecular analyses.

Effects of 17-β estradiol on ER promoter hypermethylation of lung cancer cells

The A549 cells were pre-cultured for about 2 days in estrogen-depleted medium followed by a 2-hr treatment in the presence or absence of 5 nM 17-β estradiol. Histones of A549 cells were extracted according to the procedure of Yoshida et al.25 Cells (2 × 106) were collected and washed with ice-cold PBS, suspend with 1 ml ice-cold lysis buffer (10 mM Tris-HCl, 50 mM NaHSO3, 1% Triton X-100, 10 mM MgCl2, 8.6% sucrose, pH 6.5) and then lysed by being passed through a syringe with 22-gauge needle. The nuclei were collected by a centrifugation at 12,000g for 5 min, washed 3 times with cold lysis buffer, and 1 time with 10 mM Tris-HCl, 13 mM EDTA, pH 7.4, successively. The pellet was suspended in 100 μl ice-cold H2O by vortexing and concentrated H2SO4 was added to the suspension to give a concentration of 0.4 N. After incubation at 4°C for at least 1 hr, the suspension was centrifuged for 5 min at 15,000g and the supernatant was mixed with 1 ml of acetone. After an overnight incubation at −20°C, the coagulated material was collected by micro-centrifugation and air-dried. This acid-soluble histone fraction was dissolved in 30 μl of H2O and quantitated using a protein assay kit (Bio-Rad Laboratories, Hercules, CA). Acid-extracted histones from A549 cells treated with or without 17-β estradiol were resolved by 15% SDS-PAGE, transferred to PVDF (Millipore, Bedford, MA), blocked with 3% non-fat milk, and probed with acetylated H3 and H4 type-specific antibodies as indicated (Upstate Biotechnology Inc., Charlottesville, VA) for Western blotting. Proteins were visualized using a goat anti-rabbit secondary antibody conjugated to horseradish peroxidase and an enhanced chemiluminescence detection system. Gels were stained with Coomassie Brilliant Blue R-250 (Bio-Rad), dried and photographed.

Statistical analysis

Fisher's exact or χ2 test was applied for statistical analysis. For survival data, statistical differences were analyzed using the log-rank test. Survival curves were plotted using the Kaplan-Meier method and variables related to survival were analyzed using Cox's proportional hazards regression model with SPSS software (SPSS Inc., Chicago, IL). A p < 0.05 was considered to be statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Disscussion
  6. References

Comparison of ER hypermethylation between paired lung tumor and adjacent normal lung tissues

Our study recruited 123 lung cancer patients (58 male smokers, 33 male nonsmokers, 32 female nonsmokers). ER mRNA expression and ER hypermethylation were detected by RT-PCR and MSP, respectively. Representative results of RT-PCR of lung tumors were shown in Figure 1a and MSP results of lung tumor and adjacent normal lung tissues from lung cancer patients were shown in Figure 1b. The MSP data were confirmed by bisulfite-treated DNA sequencing (Fig. 1c). Our data indicated that ER hypermethylation was detected in lung tumor tissues (54%, 66/123) but not in any adjacent normal lung tissues (0%, 0/75) (Fig. 1b, Table I). We suggest, therefore, that ER hypermethylation may be associated with lung tumorigenesis.

thumbnail image

Figure 1. Expression of estrogen receptor alpha mRNA, MSP and bisulfite sequencing analysis of ER CpG islands in human non-small cell lung cancer patients. (a) Representative RT-PCR results for ER and GAPDH mRNA from seven lung tumors. Lane M was 100 bps ladder marker. Lanes 3 and 4 showed a positive ER mRNA expression whereas Lanes 1, 2, 5, 6 and 7 showed a negative ER mRNA expression. In Lane 8 and Lane 9, cDNAs form MCF-7 and MDAMB-231 cells were served as positive and negative controls for ER mRNA expression, respectively. Lane N was a negative control with cDNA template being replaced with ddH2O. (b) DNAs obtain from tumor (T) and corresponding normal (N) tissues was amplified with primer specific for the unmethylated (U) or the methylated (M) of ER gene after a treatment with sodium bisulfite (Lane 1-7). DNAs from MCF-7 (Lane 8) and MDA-MB-231 cells (Lane 9) served as positive controls for unmethylated and methylated reactions, respectively. (c) ER CpG islands were analyzed by bisulfite sequencing. ER CpG-methylated cytosines remained as cytosines (★, upper lane). Unmethylated cytosines changed to thymidines in the PCR products whereas 5-methylcytosines remained unaltered (lower lane).

Download figure to PowerPoint

Table I. Relationships between Clinical Parameters and Estrogen Receptor Hypermethylation in 123 NSCLC Patients
CharacteristicsNo. of casesNegative (%) (n = 57)Positive (%) (n = 66)p2
  • 1

    Mean ± SD.

  • 2

    Chi-square test for categorical variables.

Age (year)165 ± 9.465 ± 9.2263 ± 9.56 
 <655727 (47)30 (53)0.83
 ≧656630 (45)36 (55) 
Gender
 Female3221 (66)11 (34)0.01
 Male9136 (40)55 (60) 
Histological type
 Adenocarcinoma6931 (45)38 (55)0.72
 Squamous cell  carcinoma5426 (48)28 (52) 
Differentiation grade
 Well32 (67)1 (33)0.27
 Moderate7940 (51)39 (49) 
 Poor4115 (37)26 (63) 
Stage
 I4523 (52)22 (48)0.71
 II3113 (42)18 (58) 
 III4721 (45)26 (55) 
T factor
 T173 (43)4 (57)0.59
 T28840 (45)48 (55) 
 T32112 (57)9 (43) 
 T472 (29)5 (71) 
N factor
 N06329 (46)34 (54)0.47
 N12514 (56)11 (44) 
 N23514 (40)21 (60) 
Smoking status
 Negative6534 (52)31 (48)0.16
 Positive5823 (40)35 (60) 
ER mRNA
 Negative7427 (36)47 (64)0.01
 Positive4930 (61)19 (39) 

Relationships between ER hypermethylation and clinical pathological parameters of lung cancer patients

Among studied clinico-pathological parameters including age, gender, tumor type, differentiation grade, tumor stage, cigarette smoking status, T and N values, only gender factor was significantly correlated with ER hypermethylation (Table I). Male lung cancer patients had a higher frequency of ER hypermethylation than female lung cancer patients (p = 0.01). Male cancer patients that smoked had the highest frequency of ER hypermethylation, followed by male and female nonsmokers. It is notable that a significant difference was observed between male and female nonsmokers (p = 0.03) but not between male smokers and nonsmokers (Table II). Our results suggest that the impact of gender difference on ER hypermethylation was more profound than cigarette smoking.

Table II. Prevalence of ER Hypermethylation in Lung Tumors by Gender and Smoking Status
ER hypermethylationCases, nNonsmokingSmoking males2p
Females1Males12
  • 1

    Chi-square test for categorical variables (nonsmoking males vs. females), p = 0.03.

  • 2

    Chi-square test for categorical variables (nonsmoking vs. smoking males), p = 0.98.

Negative5721 (66)13 (39)23 (40)0.04
Positive6611 (34)20 (61)35 (60) 

Role of E2 in ER promoter methylation in lung cancer A549 cells

To verify whether E2 was involved in the elimination of ER hypermethylation and ER mRNA expression, a lung cancer A549 cell with ER hypermethylation and absence of ER mRNA expression was used. RT-PCR and MSP data indicated clearly that ER mRNA was only detectable in A549 lung cancer cells after a treatment with 1 nM and 5 nM of E2 (Fig. 2a). Although the methylation band disappeared after E2 treatment, the unmethylated band remained unaltered (Fig. 2b). Additionally, Western blot data showed that acetylated histone 3 (H3) and histone 4 (H4) of chromatin were increased significantly after a 40-min treatment of 5 nM E2 (Fig. 2c). Our data indicates that E2 may promote H3 and H4 acetylation to attenuate ER promoter methylation and cause ER re-expression. We suggest that a lower frequency of ER hypermethylation in female lung cancer patients compared to male patients may be due to a relatively higher E2 concentration in the blood of females.

thumbnail image

Figure 2. Estrogen receptor alpha re-expression by an estrogen treatment in lung cancer cells. Representative ER α expression (a) and ER alpha promoter methylation results (b) from A549 cell treated by various concentrations of estrogen, 1 nm or 5 nm, respectively. GAPDH mRNA was analyzed by RT-PCR. Lane M was 100 bps ladder marker. Lane P was a positive control with MCF-7 cDNA being the template. Methylated and unmethylated genes were analyzed by a duplex PCR reaction containing primers specific for both islands. M indicated the reaction with primers specific for methylated DNA whereas U indicated the reaction with primers specific for unmethylated DNA. N was a negative control with cDNA template being replaced with ddH2O. (c) Representative blots of acid-extracted histones from A549 cell line untreated (lane 1), or treated with solvent control (lane 2) or estrogen of 5 nm for 20 min (lane 3), 40 min (lane 4), or 60 min (lane 5), respectively, using various antibodies against acetylated histones as indicated. Coomassie Blue stained gel (CBB) indicated that the amount of histone loaded in each lane was similar.

Download figure to PowerPoint

Correlation between ER hypermethylation and ERmRNA expression

To verify whether promoter hypermethylation was linked with ER transcription silencing, lung cancer A549 cells with ER hypermethylation were treated with demethylating agent 5-AZA-dCyd to understand whether the hypermethylation of CpG islands in ER exon 1 was responsible for the gene transcription silencing. Our RT-PCR data showed that ER mRNA was restored in A549 cells after a treatment with 5-AZA-dCyd. MSP data showed the absence of ER promoter hypermethylation in 5-AZA-dCyd treated-A549 cells (Fig. 3), but ER hypermethylation was observed in the parental and vehicle-treated cells. Our results suggest strongly that the location of ER promoter hypermethylation detected by the primer used in our study plays a crucial role in ER transcriptional regulation. The correlation of ER hypermethylation with ER mRNA was statistically analyzed in our lung tumor study. The representative results of RT-PCR and MSP for ER mRNA expression and hypermethylation are shown in Figure 1a. Direct sequencing of ER CpG islands was carried out to confirm the above results. For all patients studied, ER mRNA expression was correlated significantly with ER hypermethylation (Table I, p = 0.01). Our results suggest that ER hypermethylation may be responsible partially for ER transcriptional silencing in lung cancer patients.

thumbnail image

Figure 3. Effect of 5-AZA-dCyd on the activation of expression of ER in A549 lung carcinoma cell. (a) The cells were exposed to the drug for 5 days and total RNA was isolated after the treatment and determined by RT-PCR. MCF-7 cell was used to serve as ER mRNA positive controls and 18s rRNA acted as an internal standard. The amplified cDNA was separated on 2% agarose gel and stained with ethidium bromide. (b) MSP was used to assess the methylation status of promoter in ER CpG island. The result showed that the promoter of ER gene was demethylated by a treatment of 5-AZA-dCyd. DNA from MCF-7 remained unmethylated and served as positive controls for unmethylated reactions.

Download figure to PowerPoint

Prognostic value of ER hypermethylation in NSCLC patients

The association of ER hypermethylation with various clinico-pathological parameters with patients' survival was statistically investigated by univariate analysis (Table III). Results showed that several parameters, including ER hypermethylation, gender, tumor stage and N value, were associated independently and significantly with patient survival (p = 0.0058 for ER hypermethylation, p = 0.0125 for gender, p = 0.0081 for tumor stage, p = 0.0016 for N value). Patients with parameters including ER hypermethylation, Stage III, N1 and N2 nodal micrometastasis and males had a shorter survival than those with Stage I and II, N0 and females. Kaplan-Meier analysis showed that patients with ER hypermethylation had a poorer prognosis than those without ER hypermethylation (Table III). Additionally, ER hypermethylation as a valuable prognostic marker was only feasible for male lung cancer patients (Fig. 4b, p = 0.0044), but not for female lung cancer patients (Fig. 4c, p = 0.6369). Our results supported the hypothesis that there was a gender difference in the prognostic values of loss of ER expression by hypermethylation. Moreover, Cox regression analysis data indicated that patients with ER hypermethylation had a significantly shorter survival than those with the absence of ER hypermethylation (p = 0.007, Table IV). Among all study cases, the risk ratio (RR) of patients with ER hypermethylation was nearly 2.0-fold of patients in the absence of ER hypermethylation, which was quite similar to that of tumor stage (RR = 2.1) to make ER hypermethylation as well as tumor stage be an independent prognostic factor.

thumbnail image

Figure 4. Kaplan-Meier survival of NSCLC patients with or without ER hypermethylation. The survival curves of all studied cases (a), male patients (b) and female patients (c) with or without ER hypermethylation (ERM+ or ERM−) were shown.

Download figure to PowerPoint

Table III. Univariate analysis of Influences of Clinical Characteristics on Overall Survival Duration of NSCLC Patients
CharacteristicsNo. of patientsMedian survival (days)Survival (%)Log-rank1
  • 1

    Log-rank p-values for categorical variables were statistically analyzed by Kaplan-Meier test.

Age (year)
 < 6557780470.7555
 ≧ 656692441 
Gender
 Female321502660.0125
 Male9174536 
Histological type
 Adenocarcinoma69722390.0553
 Squamous cell  carcinoma5499050 
Differentiation grade
 Well, moderate82979460.0654
 Poor4138439 
Stage
 I, II761372510.0081
 III4761231 
T factor
 T1, T295816420.6967
 T3, T42879750 
N factor
 N0631372540.0016
 N1, N26063033 
Smoking status
 Negative65893490.3692
 Positive5878038 
ER hypermethylation
 Negative571385540.0058
 Positive6652835 
Table IV. Cox Regression Analysis of Various Potential Prognostic Factors in NSCLC Patients1
VariablesRRUnfavorable/Favorablep95% CI
  • 1

    Adjusted for age, stage, gender and smoking status.

ER hypermethylation1.994+/−0.0071.203–0.305
Age1.058≧ 65/<650.8260.638–1.757
Tumor stage2.111III/I, II0.0041.274–3.496
Gender2.002male/female0.0680.951–4.214
Smoking1.067+/−0.8240.603–1.886

Disscussion

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Disscussion
  6. References

ER hypermethylation was responsible for ER gene inactivation not only in breast cancer,19, 20, 26 but also in adult acute myeloid leukemia,27 endometrial cancer,28 prostate cancer29 and hepatocellular carcinoma.30 The prognostic value of ER hypermethylation in lung cancer, however, remains unclear. To our knowledge, this is the first study to show that ER hypermethylation may act as an unfavorable prognostic factor of NSCLC patients. In our study, we also observed that ER hypermethylation was occurred in lung tumor, but not in adjacent normal part (Fig. 1). Additionally, our cell line experiment indicated that the exon 1 of ER promoter hypermethylation was responsible for the ER transcriptional silencing (Fig. 3). These results seem to show that ER promoter hypermethylation in exon 1 CpG islands may play a role in lung tumorigenesis.

The prevalence of ER hypermethylation observed in lung cancer patients that smoke seemed to give rise to the speculation that tobacco smoke could affect ER hypermethylation in NSCLC.21 Previous studies have indicated that the prevalence of some specific gene hypermethylation (i.e., p16 and RASSF1A), was increased by the duration of cigarette smoking or an early age at starting smoking.31, 32 A previous study indicated, however, that NNK-induced rodent and rat lung tumors had relatively lower frequencies of ER hypermethylation compared to those induced by X-ray, plutonium and spontaneous tumors.22 For a few primary human lung tumors used in the same study (n = 46), there was no difference in the prevalence of ER hypermethylation with respect to gender, tumor type or tumor stage. Moreover, the frequency of ER hypermethylation in lung cancer patients that smoke was significantly higher than those of nonsmoking patients. There was no difference in ER hypermethylation between male smokers and nonsmokers (Table II) in the 123 lung tumors tested in our study. Our results suggest that other environmental factors may play a more important role than cigarette smoking in the occurrence of ER hypermethylation. The precise mechanism should be further defined.

We found a significant gender difference in ER hypermethylation. The frequency of ER hypermethylation in male lung cancer patients was significantly higher than that in female lung cancer patients (Tables I, II). A previous study for ER mRNA expression on fewer lung cancer patients, including 13 females and 13 males, has also found that ER mRNA expression was more prevalent in females than in males.33 This is consistent with our results. Furthermore, we hypothesized that E2 may play a role in ER hypermethylation based on the study of Sakai et al.34 showing that a treatment of E2 and progesterone increased significantly the levels of acetylated histone 3 and 4 of chromatin in human endometrial stromal cells. A consistent result was observed in our study indicating that ER demethylation and ER mRNA re-expression occurred simultaneously in A549 lung cancer cell after a treatment with E2 (Fig. 2a,b). Furthermore, acetylated histone 3 and 4 of chromatin were gradually increased by E2 treatments (Fig. 2c). Our present data showed the occurrence of ER demethylation after estrogen treatment in A549 lung cancer cell, but the detail mechanism needs further investigation. It was conceivable that female lung cancer patients had relatively higher levels of E2 than male patients to protect ER gene inactivation through ER hypermethylation. In our study, ER hypermethylation occurred in about 60% of male lung cancer patients, but in only 34% of female patients. Comparing with that in male lung cancer patients, a higher prevalence of ER hypermethylation was also observed in hepatocellular carcinoma (62%, 53/85)30 and prostate cancer (95%, 36/38).35 Both cancers were well known to occur in men more frequently. Additional experiments will be carried out to elucidate the role of testosterone in ER hypermethylation of lung cancer patients.

An early transfection report indicated that a significant cell growth inhibition and cell apoptosis were observed in ER transfected breast cancer cell compared to the parental cells.36 Approximately 60% of proliferating cells were seen in the mammary gland without ER. Some investigators have observed increased doubling times after they introduced ER into ER negative cells.37 This role played by ER α is very similar the role of P14ARF tumor suppressor, which binds to p53 and mdm2 and protects p53 from being downregulated by mdm2.38 The involvement of ER transcription silencing by promoter hypermethylation in lung tumor progression was at least in part mediated through an alteration of p53-mdm2 feedback regulation.

ER gene inactivation has been correlated closely with the resistance to anti-hormonal treatments. Accumulated data indicated that a high level of ER α could increases endocrine-base therapy response in the control of ovarian, endometrial and breast cancers.39, 40, 41 A recent study reported by Stabile et al.2 indicated that E2 produced a proliferative response in vitro in normal lung fibroblasts and cultured non-small cell lung tumor cells. They also demonstrated that E2 stimulated transcription of an estrogen response element-luciferase construct transfected in lung tumor cell lines. These results suggested that estrogen signaling plays a biological role in normal lung fibroblasts and lung cancer cell lines. More importantly, another study showed that the proliferation of lung cancer cells stimulated by E2 was reduced significantly by the treatment of tamoxifen.3 Some clinical studies have pointed out that female gender exerts a significant positive effect on survival after lung surgical resection therapy for early stages of NSCLC patients and favorable response rates and survival times were obtained in the treatment of antiestrogen drug, tamoxifen, in the combination with cisplatin and etoposide to advanced NSCLC patients.42, 43 We observed different prognostic values of ER hypermethylation for male and female lung cancer patients. A positive ER expression in female lung cancer patients may indicate a favorable response of surgical resection and antiestrogen therapy. Antiestrogens may have an enormous value in treating or preventing lung cancer, especially for female lung cancer patients who were frequently ER-positive.

References

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Disscussion
  6. References
  • 1
    Wingo PA, Ries LA, Parker SL, Heath CWJr. Long-term cancer patient survival in the United States. Cancer Epidemiol Biomarkers Prev 1998; 7: 27182.
  • 2
    Stabile LP, Davis AL, Gubish CT, Hopkins TM, Luketich JD, Christie N, Finkelstein S, Siegfried JM. Human non-small cell lung tumors and cells derived from normal lung express both estrogen receptor alpha and beta and show biological responses to estrogen. Cancer Res 2002; 62: 214150.
  • 3
    Mollerup S, Jorgensen K, Berge G, Haugen A. Expression of estrogen receptors alpha and beta in human lung tissue and cell lines. Lung Cancer 2002; 37: 1539.
  • 4
    Green S, Walter P, Kumar V, Krust A, Bornert JM, Argos P, Chambon P. Human estrogen receptor cDNA: sequence,expression and homology to v-erbA. Nature 1986; 320: 1349.
  • 5
    Greene GL, Gilna P, Waterfield M, Baker A, Hort Y, Shine J. Sequence and expression of human estrogen receptor complementary DNA. Science 1986; 231: 11504.
  • 6
    Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P. The nuclear receptor superfamily: the second decade. Cell 1995; 83: 8359.
  • 7
    Beato M, Herrlich P, Schutz G. Steroid hormone receptors: many actors in search of a plot. Cell 1995; 83: 8517.
  • 8
    Tsai MJ, O'Malley BW. Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 1994; 63: 45186.
  • 9
    Russo J, Hu YF, Yang X, Russo IH. Developmental,cellular, and molecular basis of human breast cancer. J Natl Cancer Inst Monogr 2000; 27: 1737.
  • 10
    Jensen EV, Cheng G, Palmieri C, Saji S, Makela S, Van Noorden S, Wahlstrom T, Warner M, Coombes RC, Gustafsson JA. Estrogen receptors and proliferation markers in primary and recurrent breast cancer. Proc Natl Acad Sci USA 2001; 98: 197202.
  • 11
    Pujol P, Rey JM, Nirde P, Roger P, Gastaldi M, Laffargue F, Rochefort H, Maudelonde T. Differential expression of estrogen receptor-alpha and -beta messenger RNAs as a potential marker of ovarian carcinogenesis. Cancer Res 1998; 58: 536773.
  • 12
    Lau KM, Mok SC, Ho SM. Expression of human estrogen receptor-alpha and -beta, progesterone receptor, and androgen receptor mRNA in normal and malignant ovarian epithelial cells. Proc Natl Acad Sci USA 1999; 96: 57227.
  • 13
    Bonkhoff H, Fixemer T, Hunsicker I, Remberger K. Estrogen receptor expression in prostate cancer and premalignant prostatic lesions. Am J Pathol 1999; 155: 6417.
  • 14
    Cheng YW, Chen CY, Lin P, Huang KH, Lin TS, Wu MH, Lee H. DNA adduct level in lung tissue may act as a risk biomarker of lung cancer. Eur J Cancer 2000 Jul; 36: 13818.
  • 15
    Cheng YW, Hsieh LL, Lin PP, Chen CP, Chen CY, Lin TS, Su JM, Lee H. Gender difference in DNA adduct levels among nonsmoking lung cancer patients. Environ Mol Mutagen 2001; 37: 30410.
  • 16
    Lapidus RG, Nass SJ, Davidson NE. The loss of estrogen and progesterone receptor gene expression in human breast cancer. J Mammary Gland Biol Neoplasia 1998; 3: 8594.
  • 17
    McGuire WL. Hormone receptors: their role in predicting prognosis and response to endocrine therapy. Semin Oncol 1978; 5: 42833.
  • 18
    Davidson NE. Combined endocrine therapy for breast cancer—new life for an old idea? J Natl Cancer Inst 2000; 92: 85960.
  • 19
    Ottaviano YL, Issa JP, Parl FF, Smith HS, Baylin SB, Davidson NE. Methylation of the estrogen receptor gene CpG island marks loss of estrogen receptor expression in human breast cancer cells. Cancer Res 1994; 54: 25525.
  • 20
    Lapidus RG, Ferguson AT, Ottaviano YL, Parl FF, Smith HS, Weitzman SA, Baylin SB, Issa JP, Davidson NE. Methylation of estrogen and progesterone receptor gene 5′ CpG islands correlates with lack of estrogen and progesterone receptor gene expression in breast tumors. Clin Cancer Res 1996; 2: 80510.
  • 21
    Issa JP, Baylin SB, Belinsky SA. Methylation of the estrogen receptor CpG island in lung tumors is related to the specific type of carcinogen exposure. Cancer Res 1996; 56: 36558.
  • 22
    Belinsky SA, Snow SS, Nikula KJ, Finch GL, Tellez CS, Palmisano WA. Aberrant CpG island methylation of the p16 (INK4a) and estrogen receptor genes in rat lung tumors induced by particulate carcinogens. Carcinogenesis 2002; 23: 3359.
  • 23
    Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA 1996; 93: 98216.
  • 24
    Lapidus RG, Nass SJ, Butash KA, Parl FF, Weitzman SA, Graff JG, Herman JG, Davidson NE. Mapping of ER gene CpG island methylation-specific polymerase chain reaction. Cancer Res 1998; 58: 25159.
  • 25
    Yoshida M, Kijima M, Akita M, Beppu T. Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A. J Biol Chem 1990; 265: 171749.
  • 26
    Nass SJ, Herman JG, Gabrielson E, Iversen PW, Parl FF, Davidson NE, Graff JR. Aberrant methylation of the estrogen receptor and E-cadherin 5′ CpG islands increases with malignant progression in human breast cancer. Cancer Res 2000; 60: 43468.
  • 27
    Li Q, Kopecky KJ, Mohan A, Willman CL, Appelbaum FR, Weick JK, Issa JP. Estrogen receptor methylation is associated with improved survival in adult acute myeloid leukemia. Clin Cancer Res 1999; 5: 107784.
  • 28
    Hori M, Iwasaki M, Shimazaki J, Inagawa S, Itabashi M. Assessment of hypermethylated DNA in two promoter regions of the estrogen receptor alpha gene in human endometrial diseases. Gynecol Oncol 2000; 76: 8996.
  • 29
    Li LC, Chui R, Nakajima K, Oh BR, Au HC, Dahiya R. Frequent methylation of estrogen receptor in prostate cancer: correlation with tumor progression. Cancer Res 2000; 60: 7026.
  • 30
    Shen L, Ahuja N, Shen Y, Habib NA, Toyota M, Rashid A, Issa JP. DNA methylation and environmental exposures in human hepatocellular carcinoma. J Natl Cancer Inst 2002; 94: 75561.
  • 31
    Yanagawa N, Tamura G, Oizumi H, Takahashi N, Shimazaki Y, Motoyama T. Frequent epigenetic silencing of the p16 gene in non-small cell lung cancers of tobacco smokers. Jpn J Cancer Res 2002; 93: 110713.
  • 32
    Kim DH, Kim JS, Ji YI, Shim YM, Kim H, Han J, Park J. Hypermethylation of RASSF1A promoter is associated with the age at starting smoking and a poor prognosis in primary non-small cell lung cancer. Cancer Res 2003; 63: 37436.
  • 33
    Fasco MJ, Hurteau GJ, Spivack SD. Gender-dependent expression of alpha and beta estrogen receptors in human nontumor and tumor lung tissue. Mol Cell Endocrinol 2002; 188: 12540.
  • 34
    Sakai N, Maruyama T, Sakurai R, Masuda H, Yamamoto Y, Shimizu A, Kishi I, Asada H, Yamagoe S, Yoshimura Y. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem 2003; 278: 1667582.
  • 35
    Sasaki M, Tanaka Y, Perinchery G, Dharia A, Kotcherguina I, Fujimoto S, Dahiya R. Methylation and inactivation of estrogen, progesterone, and androgen receptors in prostate cancer. J Natl Cancer Inst 2002; 94: 3849.
  • 36
    Levenson AS, Jordan VC. Transfection of human estrogen receptor (ER) cDNA into ER-negative mammalian cell lines. J Steroid Biochem Mol Biol 1994; 51: 22939.
  • 37
    Warner M, Saji S, Gustafsson JA. The normal and malignant mammary gland: a fresh look with ER beta onboard. J Mammary Gland Biol Neoplasia 2000; 5: 28994.
  • 38
    Liu G, Schwartz JA, Brooks SC. Estrogen receptor protects p53 from deactivation by human double minute-2. Cancer Res 2000; 60: 18104.
  • 39
    Geisler JP, Wiemann MC, Miller GA, Zhou Z, Geisler HE. Estrogen and progesterone receptors in malignant mixed mesodermal tumors of the ovary. J Surg Oncol 1995; 59: 457.
  • 40
    Martin JD, Hahnel R, McCartney AJ, Woodings TL. The effect of estrogen receptor status on survival in patients with endometrial cancer. Am J Obstet Gynecol 1983; 147: 3224.
  • 41
    Clark GM, McGuire WL. Prognostic factors in primary breast cancer. Breast Cancer Res Treat. 1983; 3( Suppl): S6972.
  • 42
    Yang CH, Cheng AL, Yeh KH, Yu CJ, Lin JF, Yang PC. High dose tamoxifen plus cisplatin and etoposide in the treatment of patients with advanced,inoperable nonsmall cell lung carcinoma. Cancer 1999; 86: 41520.
  • 43
    Chen YM, Perng RP, Yang KY, Lin WC, Wu HW, Liu JM, Tsai CM. Whang-Peng J. A phase II trial of tamoxifen, ifosfamide, epirubicin, and cisplatin combination chemotherapy for inoperable non-small-cell lung cancer. Am J Clin Oncol 2000; 23: 137.