SEARCH

SEARCH BY CITATION

Keywords:

  • ALK gene fusion;
  • SEC31L1;
  • myofibroblastic tumor

Abstract

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. References

Inflammatory myofibroblastic tumor (IMT) is a neoplasm composed of myofibroblastic spindle cells and infiltrating inflammatory cells. Cytogenetic analyses have revealed that a subgroup of IMT, in particular among children and young adults, harbors clonal chromosomal rearrangements involving chromosome band 2p23. Further, molecular genetic studies have shown that these rearrangements target the ALK gene, serving as the 3′-partner in fusion genes with various translocation partners. In the present study, we describe the finding of a novel SEC31L1/ALK fusion gene in an intraabdominal IMT of a young man. G-band analysis revealed a translocation t(2;4)(p23;q21) and subsequent fluorescence in situ hybridization with locus-specific probes strongly indicated disruption of the ALK locus on chromosome 2. Immunostaining with monoclonal mouse anti-human CD246 ALK Protein showed diffuse cytoplasmic positivity. Using reverse primers for the ALK-gene, we could, by 5′-RACE methodology, amplify a single 1.2 kb fragment. Sequence analysis showed that the fragment was a hybrid cDNA product in which nt 3012 of SEC31L1 (NM_016211), located in band 4q21, was fused in-frame to nt 4080 of ALK (NM_004304). RT-PCR with two sets of primer pairs specific for SEC31L1 and ALK amplified two transcripts, which at sequencing corresponded to two types of chimeric SEC31L1/ALK transcripts. In the long, type I, transcript nt 3012 of SEC31L1 (NM_016211) was fused in-frame to nt 4080 of ALK. In the short, type II, transcript nt 2670 of SEC31L1 was fused in-frame to nt 4080 of ALK. Genomic PCR and subsequent sequencing showed that the breakpoints were located in intron 23 of SEC31L1 and intron 20 of ALK. © 2005 Wiley-Liss, Inc.

Inflammatory myofibroblastic tumor (IMT) is a distinctive neoplasm composed of varying proportions of myofibroblastic spindle cells, inflammatory cells and collagen fibers. IMTs can arise anywhere in the body, but are particularly common in the mesentery, omentum and lung.1 Surgery with radical margins is usually curative, but in rare cases an IMT may metastasize.2, 3, 4

Cytogenetic analyses have shown that a subset of IMTs harbors clonal chromosomal rearrangements involving band 2p23. In 1999, Griffin and co-workers demonstrated that such 2p23-rearrangements target the ALK locus and result in the creation of various fusion genes containing the catalytic domain of ALK.5 So far, 6 ALK fusion partners have been described in IMTs: ATIC (at 2q35), CARS (at 11p15), CLTC (at 17q23), RANBP2 (at 2q13), TMP3 (at 1p23) and TMP4 (at 19p13)2, 6, 7, 8, 9, 10, 11, 12 Immunohistostochemical studies have detected ALK expression in 40–60% of IMTs.11, 12 In the present study, we describe the cytogenetic and molecular characterization of an IMT with a novel fusion gene, SEC31L1/ALK.

Material and methods

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. References

Case history and histopathology

A 23-year-old man was admitted to hospital, with a three-day history of fever and lower abdominal pain. Hemoglobin and white blood cell counts were normal and CRP slightly increased. The abdomen was tender and there was no palpable mass. He had normal bowel function and no nausea, but an increased urge to urinate. Nine months earlier, he had fractured his seventh thoracic vertebra in a motorcycle accident. Extensive CT-scans of the abdominal region at that time did not show any intraabdominal tumor growth. After the accident, he had lost some, predominantly muscular, weight. Now, a CT-scan revealed a small amount of ascites and 3 tumorous lesions in the pelvic entrance, measuring 9, 6 and 3 cm in diameter. They were located close to the urinary bladder and rectum, but did not seem to infiltrate these organs, which were confirmed by cysto- and rectoscopy. There were no signs of liver or lung metastases. Ultrasonography of the testes did not show anything abnormal, and the HCG and alpha-fetoprotein (AFP) levels were within the reference range. A core needle biopsy was performed, suggesting the tumor to be a low-grade malignant leiomyosarcoma. Microscopic examination of the ascites showed only normal lymphocytes.

The patient was operated twice, with 3 weeks apart. During the initial lower midline mini-laparotomy, ascites were sampled and the 3 cm tumor, located in the omentum majus, was extirpated. In addition, multiple 1 cm tumors were palpated in the omentum.

Since the disease appeared disseminated, the aim of the secondary surgery was to reduce tumor burden. However, at the second laparotomy, the 9 and the 6 cm tumors and the multiple 1 cm tumors were found to be strictly localised within the omentum majus. By omentectomy, the surgery was thus considered macroscopically radical.

In the resected omentum, multiple nodules ranging in size from a few mm to 10 cm were seen. The nodules were well-circumscribed and lobulated, with greyish-white cut surfaces and central scar-like formations (Fig. 1a). Microscopically, they were composed of bland-looking myofibroblastic cells loosely distributed in the collagenous or myxoid matrix with a variable admixture of collagen fibers and lymphoplasmacytic infiltrate and with occasional admixture of eosinophils and neutrophils (Fig. 1b). There were also sparsely cellular collagenous areas, and only a few mitotic figures and no necrosis were seen (Figs. 1c and 1d). Slight nuclear atypia and inconspicuous nucleoli were observed focally in the histological sections. Immunostains showed multifocal positivity for smooth-muscle actin and desmin as well as diffuse cytoplasmic positivity for ALK (Fig. 1d).

thumbnail image

Figure 1. Histopathologic appearance. (a) Surgical specimen showing omentum with multiple nodules varying in size; Greyish-white cut sections of the 2 largest nodules. (b) Low-power view showing mixture of bland-looking spindle cells, collagen fibers and lymphoplasmacytic infiltrate (H&E stain, ×25). (c) Sparsely cellular collagen areas (asterisk) and (d) Positive immunostaining with monoclonal mouse anti-human CD246 ALK Protein, Clone ALK1 (DakoCytomation, Copenhagen, Denmark). [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

Download figure to PowerPoint

Three months postoperatively, the patient works full-time and practices ice hockey 4 times weekly. He has regained his previously lost weight. Laboratory values are normal, and CT- and PET-scans have not shown any signs of recurrence.

Chromosome banding and fluorescence in situ hybridization (FISH) analyses

The methods used for cell culturing and cytogenetic analysis have been described previously.13 The description of the karyotype followed the recommendations of ISCN (1995).14 FISH was performed as described.15 To detect rearrangement of the ALK gene, the Vysis LSI ALK Dual Color Break Apart Rearrangement Probe was used (Abbott Scandinavia, Stockholm, Sweden). SEC31L1 rearrangement was detected by 2 bacterial artificial chromosome (BAC) probes (RP11-163O17 in red and RP11-57B24 in green) flanking the SEC31L1 locus.

5′-RACE

From the same fresh tumor sample that had been used for short-term culturing, 1 piece had been frozen at −80°C and total RNA was extracted using the Trizol reagent according to the manufacturer's instructions (Invitrogen, Stockholm, Sweden). Two micrograms of total RNA was then used for cDNA preparation, and 5′-RACE was performed using the Smart RACE cDNA amplification kit (BD Biosciences, Stockholm, Sweden) according to the manufacturer's protocol. In brief, first, round polymerase chain reaction (PCR) was done with the Universal Primer A Mix (UPM) and ALK reverse primer ALK-4441R (5′- TCA CCC CAA TGC AGC GAA CAA TG). Second round PCR was performed with the Nested Universal Primer A (NUP) and ALK reverse primer ALK-4391R (5′- TCA GGG CTT CCA TGA GGA AAT CCA G). For PCR, the GC-RICH PCR System kit was used (Roche, Penzberg, Germany). The template (5 μl cDNA) was amplified in a 50 μl volume containing 0.8 mM dNTPs, 5 μl of UPM (10×), 0.2 μM ALK-4441R primer, 1.5 M GC-RICH resolution solution, 1× GC-RICH reaction buffer and 2 U Enzyme Mix. One microliter of the PCR products was reamplified in a second PCR using 0.2 μM of each NUP and ALK-4391R primers. After an initial denaturation for 3 min at 95°C, a first 15 cycles of 5 sec at 98.5°C, 4 min at 56°C and 6 min at 69°C were run, followed by 15 cycles of 5 sec at 98.5°C (with auto-extension of 0.1°C per cycle), 4 min at 56°C and 6 min at 69°C and a final extension for 10 min at 72°C. Fifteen microliters of the PCR products was analyzed by electrophoresis through 1.3% agarose gels, stained with ethidium bromide, and photographed.

PCR analyses

Five micrograms of total RNA was reverse-transcribed in a 20 μl reaction volume containing 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 1 mM of each dNTP, 37 units RNA guard (Pharmacia, Uppsala, Sweden), 500 pmol random hexamers and 400 units M-MLV Reverse Transcriptase (Invitrogen). The reaction was carried out at 37°C for 60 min, heated for 10 min at 65°C and then kept at 4°C. A one-step PCR was performed for amplification of the SEC31L1/ALK fusion transcript. The 50 μl PCR volume contained 2 μl of the cDNA, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.25 mM MgCl2, 0.2 mM of each dNTP, 1 unit PlatinumTaq DNA polymerase (Invitrogen) and 0.5 μM of each of the forward SEC31L1-2598F: AAT GCT GCT GGT CAG CTT CCC ACA and reverse ALK-4441R: TCA CCC CAA TGC AGC GAA CAA TG primers or 0.5 μM of each of the SEC31L1-2902F: TCC AGC ATG GCG GAC CAG GAG and reverse ALK-4391R: TCA GGG CTT CCA TGA GGA AAT CCA G primers. The PCR was run on a PCT-200 DNA Engine (MJ Research, Waltham, MA), and both amplifications had an identical cycling profile: an initial denaturation at 94°C for 5 min, followed by 30 cycles of 1 min at 94°C, 1 min at 60°C, 1 min at 72°C and a final extension for 10 min at 72°C. Fifteen microliters of the PCR products was analyzed by electrophoresis through 1.5% agarose gel, stained with ethidium bromide, and photographed.

For the detection of the genomic SEC31L1-ALK fusion, nested extra long (XL) PCR was carried out using the XL PCR kit (Perkin Elmer, Foster City, CA). XL PCR was performed in 100 μl of 1:3 diluted 3.3× XL buffer II, 1.1 mM Mg(OAc)2, 0.2 mM of each dNTP, 1 unit of rTth DNA polymerase, XL, 0.4 μM of each of the forward and reverse primers and 300 ng genomic DNA extracted from the tumor sample, according to standard methods.16 Two microliters of the first PCR product was reamplified in the second round PCR. For the first and second round PCR, we used the the primers SEC31L1-2695F (CCTTCGGAACAGGGG GGTCAGCAA) and ALK4222R (CGCGGCACCTCCTTCAG GTCACTG), and SEC31L1-2822F (CGCAGCACAGCACCAGGCCTCTTC)and ALK4149R (TGATGGTCGAGGTGCGGAGCTTGC), respectively. After an initial denaturation for 1 min at 94°C, 32 cycles of 15 sec at 94°C and 10 min at 68°C were run using a PCT-200 DNA Engine (MJ Research), followed by a final extension for 10 min at 72°C.

For sequence analyses, the RT-PCR- and XL-PCR-amplified SEC31L1-ALK fragments were run on 1.3% agarose gels, purified using the Qiagen gel extraction kit (Qiagen, Hilden, Germany), and directly sequenced using the dideoxy procedure, with an ABI Prism BigDye terminator v1.1 cycle sequencing kit (PE Applied Biosystems, Foster City, CA) on the Applied Biosystems Model 3100-Avant DNA sequencing system. The BLAST software (http://www.ncbi.nlm.nih.gov/BLAST/) was used for computer analysis of sequence data.

Results

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. References

G-banding and FISH findings

The G-banding and FISH analyses yielded the karyotype 46,XY,der(2)t(2;4)(p23;q21),der(4)t(2;4)(p23;q21)del(4)(p1?6) (Fig. 2a). When metaphase spreads were hybridized with the ALK-specific probe, 1 split signal was seen, indicating that the translocation breakpoint on chromosome 2 was within the ALK locus (Fig. 2b). Similarly, FISH with BAC probes flanking the SEC31L1 locus resulted in split signals (Fig. 2c).

thumbnail image

Figure 2. G-band and FISH results. (a) G-banding showing the 46, XY,der(2)t(2;4)(p2?3;q21),der(4)t(2;4)(p2?3;q21)del(4)(p1?6) karyotype. (b) Metaphase FISH with the LSI ALK Dual Color, Break Apart Rearrangement Probe shows 1 intact (yellow) and 1 disrupted (split red and green signals) ALK copy. (c) Metaphase FISH with 2 BAC probes (RP11-163O17 in red and RP11-57B24 in green) flanking the SEC31L1 locus, revealing 1 intact (yellow) and 1 disrupted (split red and green signals) copy. [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

Download figure to PowerPoint

Molecular genetic findings

5′-RACE methodology amplified a single 1.2 kb fragment. Sequence analysis showed that the fragment was a hybrid cDNA product in which nt 3012 of the SEC31L1 gene (NM_016211), mapped to subband 4q21.22, was fused in-frame to nt 4080 of ALK (NM_004304). Subsequently, RT-PCR with primer combination SEC31L1-2598F and ALK-4441R amplified 2 fragments of 457 bp and 799 bp, and amplification with the SEC31L1-2902F and ALK-4391R primer combination generated a 447 bp cDNA fragment (Fig. 3a). To verify the presence of SEC31L1/ALK chimeric transcripts, the fragments were analyzed by direct sequencing, which verified the existence of 2 types of chimeric transcripts. In the long, type I, transcript, nt 3012 of SEC31L1 (NM_016211) was fused in-frame to nt 4080 of ALK (NM_004304) (Fig. 3). In the short, type II, transcript, nt 2670 of SEC31L1 was also fused in-frame to nt 4080 of ALK (Fig 3b).

thumbnail image

Figure 3. SEC31L1/ALK chimera. (a) RT-PCR with SEC31L1-2598F and ALK-4441R amplified 2 cDNA fragments of 457 bp and 799 bp (lane 1), and amplification with SEC31L1-2902F and ALK-4391R primer combination generated a 447 bp cDNA fragment (lane 3). M, 100 bp DNA ladder, lanes 2 and 4 are blank. (b) Partial sequence chromatograms showing the junction of the SEC31L1 and ALK genes (arrow). In the long, type I transcript, exon 22 of SEC31L1 (nt 3012 of NM_016211) was fused in-frame with exon 21 of ALK (nt 4080 of NM_004304). In the short, type II transcript, exon 21 of SEC31L1 (nt 2670) was also fused in-frame with exon 21 of ALK. (c) Partial sequencing of the 2 kb genomic SEC31L1/ALK fragment showing that the breakpoints were located in intron 22 of SEC31L1 and intron 20 of ALK. [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

Download figure to PowerPoint

Nested-XL PCR amplified a 2 kb genomic fragment. Partial sequencing showed that the breakpoints were located in intron 23 of SEC31L1, 2329 bp downstream of exon 22 and intron 20 of ALK, 158 bp upstream of exon 21 (Fig. 3c). Attempts to amplify a reciprocal ALK/SEC31L1 genomic fragment using ALK forward primers in exon 20 and SEC31L1 reverse primers in exon 24 or intron 23 were unsuccessful (data not shown).

Discussion

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. References

In this study, a novel SEC31L1/ALK chimera was identified and characterized in an IMT associated with a t(2;4)(p23;q21). Similar to what has been described for the other known fusion genes in IMT, the SEC31L1/ALK hybrid would retain the last 563 amino acids of the ALK kinase, including its catalytic domain. The SEC31L1 gene, serving as 5′-partner in the fusion, is ubiquitously and abundantly expressed and encodes the functional homologue of the yeast Sec31p protein.17, 18 The SEC31L1 protein has been shown to localize to vesicular structures that are scattered throughout the cell but are concentrated in the perinuclear region.18 Its structural, biochemical and functional features suggest that the SEC31L1 protein is a component of the COPII coat complex, which mediates transport from the endoplasmatic reticulum to the Golgi machinery.17, 18 In this context, it is interesting to note that also another ALK fusion partner, the clathrin heavy chain (CLTC) gene, is involved in intracellular transport.7 CLTC is a component of the three-legged clathrin molecule, which is the major protein constituent of the coat that surrounds the cytoplasmic face of the organelles (coated vesicles) mediating selective protein transport. Clathrin coats are involved in receptor-mediated endocytosis, localization of resident membrane proteins to the trans-Golgi network and transport of proteins to the lysosome/vacuole.19, 20

The SEC31L1 protein together with SEC13 forms a SEC13/SEC31 protein complex, a 700 kDa heterotetramer consisting of 2 copies of SEC13 and SEC31, respectively.21 The SEC31L1 protein contains a proline-rich C-terminal part, an intervening region without any distinct functional structural domain and an N-terminal part (aa 1–470) with 7 WD-40 repeats.17, 18 The WD repeat comprises a 44–60 residue sequence that typically contains the glycine-histidine dipeptide (11–24) residues from its N-terminus and the tryptophan (W)–aspartic acid (D) residues at the C-terminus.22, 23 A variable number of repeats form a compact β-propeller structure on which other proteins bind to form macromolecular complexes in cells.22, 23 The WD region of SEC31L1 has been shown to interact with SEC13, but may well bind other proteins.17, 18 Thus, the SEC31L1 gene shares several characteristics with the various other ALK fusion partners previously described in IMT: it is constitutively transcribed and it contains a known or putative N-terminal oligomerization motif.24, 25 The fusion of various N-terminal oligomerization motifs from partner proteins to a truncated tyrosine kinase has been demonstrated to lead to activation of the catalytic domain, mimicking activation of a given receptor by its natural ligand, but in an unregulated, constitutive fashion.26, 27

The orientation of the SEC31L1 and ALK genes, found rearranged in the present case, is worthy of further comment: SEC31L1 (at 4q21) is oriented from the telomere (5′) to the centromere (3′) whereas ALK (at 2p23) is transcribed from the centromere (5′) to the telomere (3′). These opposite orientations preclude the generation of a fusion gene by a simple, balanced translocation, and yet, a fusion product between the 2 genes was demonstrated. This indicates the presence of additional and cryptical genomic rearrangements in the chromosomal regions containing the genes. Indeed, FISH experiments demonstrated that multiple genomic rearrangements, probably including a pericentric inversion of chromosome 4, took place for the generation of the SEC31L1/ALK chimera. Metaphase FISH with the LSI ALK Dual Color, Break Apart Rearrangement Probe showed that the 3′end of ALK was inserted into chromosome 4 (Fig 2b; red signal). Metaphase FISH with 2 BAC probes (RP11-163O17 in red and RP11-57B24 in green) flanking the SEC31L1 locus revealed a pericentric inversion on chromosome 4, with the 3′ end of SEC31L1 on the p-arm of 4 (Fig 2c; RP11-57B24, green signal) and the 5′part of the gene remaining at 4q21 (Fig 2c; RP11-163O17, red signal). These results strongly indicate that the SEC31L1/ALK chimeric gene is transcribed from the derivative chromosome 4.

From a clinical point of view, it is of interest to note that the tumor grew very rapidly. At surgery, multiple up to 10 cm tumors were found. However, 9 months prior to surgery, the patient had undergone detailed CT scan analysis of the abdominal region, and in spite of careful reexamination of these images, no tumorous lesions could be seen at that time. Despite the rapid increase in tumor size, the patient did not, except for the weight loss that to some extent might be accounted for by his previous accident, display any of the symptoms or signs (e.g., fever, weight loss, anemia and thrombocytosis) known to form a clinically distinct syndrome in a subset of IMT patients.28 To what extent tumor growth characteristics and clinical features might be associated with type of fusion gene in IMT patients remains to be elucidated.

References

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. References
  • 1
    Karnak I, Senocak ME, Ciftci AO, Caglar M, Bingol-Kologlu M, Tanyel FC, Buyukpamukcu N. Inflammatory myofibroblastic tumor in children: diagnosis and treatment. J Pediatr Surg 2001; 36: 90812.
  • 2
    Debelenko LV, Arthur DC, Pack SD, Helman LJ, Schrump DS, Tsokos M. Identification of CARS-ALK fusion in primary and metastatic lesions of an inflammatory myofibroblastic tumor. Lab Invest 2003; 83: 125565.
  • 3
    Lacoste-Collin L, Roux FE, Gomez-Brouchet A, Despeyroux ML, Uro-Coste E, Coindre JM, Delisle MB. Inflammatory myofibroblastic tumor: a spinal case with aggressive clinical course and ALK overexpression. Case report. J Neurosurg Spine 2003; 98: 21821.
  • 4
    Petridis AK, Hempelmann RG, Hugo HH, Eichmann T, Mehdorn HM. Metastatic low-grade inflammatory myofibroblastic tumor (IMT) in the central nervous system of a 29-year-old male patient. Clin Neuropathol 2004; 23: 15866.
  • 5
    Griffin CA, Hawkins AL, Dvorak C, Henkle C, Ellingham T, Perlman EJ. Recurrent involvement of 2p23 in inflammatory myofibroblastic tumors. Cancer Res 1999; 59: 277680.
  • 6
    Lawrence B, Perez-Atayde A, Hibbard MK, Rubin BP, Dal Cin P, Pinkus JL, Xiao S, Yi ES, Fletcher CD, Fletcher JA. TPM3-ALK and TPM4-ALK oncogenes in inflammatory myofibroblastic tumors. Am J Pathol 2000; 157: 37784.
  • 7
    Bridge JA, Kanamori M, Ma Z, Pickering D, Hill DA, Lydiatt W, Lui MY, Colleoni GW, Antonescu CR, Ladanyi M, Morris SW. Fusion of the ALK gene to the clathrin heavy chain gene, CLTC, in inflammatory myofibroblastic tumor. Am J Pathol 2001; 159: 4115.
  • 8
    Cools J, Wlodarska I, Somers R, Mentens N, Pedeutour F, Maes B, De Wolf-Peeters C, Pauwels P, Hagemeijer A, Marynen P. Identification of novel fusion partners of ALK, the anaplastic lymphoma kinase, in anaplastic large-cell lymphoma and inflammatory myofibroblastic tumor. Genes Chromosomes Cancer 2002; 34: 35462.
  • 9
    Debiec-Rychter M, Marynen P, Hagemeijer A, Pauwels P. ALK-ATIC fusion in urinary bladder inflammatory myofibroblastic tumor. Genes Chromosomes Cancer 2003; 38: 18790.
  • 10
    Ma Z, Hill DA, Collins MH, Morris SW, Sumegi J, Zhou M, Zuppan C, Bridge JA. Fusion of ALK to the Ran-binding protein 2 (RANBP2) gene in inflammatory myofibroblastic tumor. Genes Chromosomes Cancer 2003; 37: 98105.
  • 11
    Coffin CM, Patel A, Perkins S, Elenitoba-Johnson KS, Perlman E, Griffin CA. ALK1 and p80 expression and chromosomal rearrangements involving 2p23 in inflammatory myofibroblastic tumor. Mod Pathol 2001; 14: 56976.
  • 12
    Cook JR, Dehner LP, Collins MH, Ma Z, Morris SW, Coffin CM, Hill DA. Anaplastic lymphoma kinase (ALK) expression in the inflammatory myofibroblastic tumor: a comparative immunohistochemical study. Am J Surg Pathol 2001; 25: 136471.
  • 13
    Mandahl N, Heim S, Arheden K, Rydholm A, Willen H, Mitelman F. Three major cytogenetic subgroups can be identified among chromosomally abnormal solitary lipomas. Hum Genet 1988; 79: 2038.
  • 14
    Mitelman F, ed. ISCN: an international system for human cytogenetic nomenclature. Basel: S Karger, 1995.
  • 15
    Andreasson P, Johansson B, Arheden K, Billström R, Mitelman F, Höglund M. Deletions of CDKN1B and ETV6 in acute myeloid leukemia and myelodysplastic syndromes without cytogenetic evidence of 12p abnormalities. Genes Chromosomes Cancer 1997; 19: 7783.
  • 16
    Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, 1989.
  • 17
    Shugrue CA, Kolen ER, Peters H, Czernik A, Kaiser C, Matovcik L, Hubbard AL, Gorelick F. Identification of the putative mammalian orthologue of Sec31P, a component of the COPII coat. J Cell Sci 1999; 112: 454756.
  • 18
    Tang BL, Zhang T, Low DY, Wong ET, Horstmann H, Hong W. Mammalian homologues of yeast sec31p. An ubiquitously expressed form is localized to endoplasmic reticulum (ER) exit sites and is essential for ER-Golgi transport. J Biol Chem 2000; 275: 13597604.
  • 19
    Kirchhausen T. Clathrin. Annu Rev Biochem 2000; 69: 6994.
  • 20
    Mousavi SA, Malerod L, Berg T, Kjeken R. Clathrin-dependent endocytosis. Biochem J 2004; 377: 116.
  • 21
    Duden R. ER-to-Golgi transport: COP I and COP II function. Mol Membr Biol 2003; 20: 197207.
  • 22
    Smith TF, Gaitatzes C, Saxena K, Neer EJ. The WD repeat: a common architecture for diverse functions. Trends Biochem Sci 1999; 24: 1815.
  • 23
    Li D, Roberts R. WD-repeat proteins: structure characteristics, biological function, and their involvement in human diseases. Cell Mol Life Sci 2001; 58: 208597.
  • 24
    Duyster J, Bai RY, Morris SW. Translocations involving anaplastic lymphoma kinase (ALK). Oncogene 2001; 20: 562337.
  • 25
    Armstrong F, Duplantier MM, Trempat P, Hieblot C, Lamant L, Espinos E, Racaud-Sultan C, Allouche M, Campo E, Delsol G, Touriol C. Differential effects of X-ALK fusion proteins on proliferation, transformation, and invasion properties of NIH3T3 cells. Oncogene 2004; 23: 607182.
  • 26
    Rodrigues GA, Park M. Oncogenic activation of tyrosine kinases. Curr Opin Genet Dev 1994; 4: 1524.
  • 27
    Bischof D, Pulford K, Mason DY, Morris SW. Role of the nucleophosmin (NPM) portion of the non-Hodgkin's lymphoma-associated NPM-anaplastic lymphoma kinase fusion protein in oncogenesis. Mol Cell Biol 1997; 17: 231225.
  • 28
    Coffin CM, Fletcher JA. Inflammatory myofibroblastic tumour. In: Fletcher CDM, Unni KK, Mertens F, eds. Pathology and genetics of tumours of soft tissue and bone. Lyon: IARC Press, 2002. 913.