Erratum


In the above referenced article, Table I (“Primers Used for Nested Amplification of Genomic DNA Sequences of EGFR, PIK3CA and K-RAS”) contains errors in the oligo-sequences used for amplification of the EGFR exons. A corrected table is presented here.

Table I. Primers used for Nested Amplification of Genomic DNA Sequences of EGFR, PIK3CA, and K-RAS
Gene, exonForwardReverse
  • a

    Internal primers were tagged on their 5′-ends with M13 sequences (see material and methods).

EGFR, exon 18InternalaCTGAGGTGACCCTTGTCTCTCCATGAGAGGCCCTA
ExternalATGGTGAGGGCTGAGGTGACTCCCCACCAGACCATGAGAG
EGFR, exon 19InternalTCTCACAATTGCCAGTTAACTGAGGTTCAGAGCCATGGAC
ExternalGTGGCACCATCTCACAATTGAAGGTGGGCCTGAGGTTCAG
EGFR, exon 20InternalCCCCTCCTTCTGGCCACCATATCCTGGCTCCTTATCTCCC
ExternalGTCCATGTGCCCCTCCTTCGCATGTGAGGATCCTGGCTC
EGFR, exon 21InternalAATTCGGATGCAGAGCTTCTCTGGTGTCAGGAAAATGCTG
ExternalATGACCCTGAATTCGGATGAGCCTGGTCCCTGGTGTCAG
EGFR, exon 22InternalGTCCAGAGTGAGTTAACTTTCTTGGCCTCAGTACAAACTC
ExternalTCGTAATTAGGTCCAGAGTGATAAAAGCCAGCTTGGCCTC
EGFR, exon 23InternalAAAGCAAGGGATTGTGATTGAGCCACCAAGGCTCAGCTAG
ExternalAATGATGACTAAAGCAAGGGGGCTAAGAGCAGCCACCAAG
EGFR, exon 24InternalCATCTTTATCATTTCTTCCAATGAGATGCTCATTAGAGGG
ExternalTAAGCAATGCCATCTTTATCATGAGATGCTCATTAGAGGG
PIK3CA, exon 9InternalGAGGGGAAAAATATGACAAAATTTTTTCTGTAATAAAGAA
ExternalTGTGAATCCAGAGGGGAAAAAAATTCAGTTATTTTTTCTG
PIK3CA, exon 20.1InternalGCTCCAAACTGACCAAACTGCTGTTTAATTGTGTGGAAGA
ExternalAACATCATTTGCTCCAAACTTCAATGCATGCTGTTTAATT
PIK3CA, exon 20.2InternalGACAACAAAAATGGATTGGATCACTTTTTCCTTCTCCATC
ExternalATGGTGGCTGGACAACAAAAAAAAAAACCATCACTTTTTC
k-Ras, exon 1InternalAGTCACATTTTCATTATTTTAGAAACCTTTATCTGTATCAAAGAATG
ExternalGTTCTAATATAGTCACATTTACTCATGAAAATGGTCAGAGAAACCTTTAT
k-Ras, exon 2InternalGTGCACTGTAATAATCCAGAACTCCTTAATGTCAGCTTAT
ExternalGAAGTAAAAGGTGCACTGTAAACTATAATTACTCCTTAAT

Ancillary