SEARCH

SEARCH BY CITATION

Keywords:

  • Epstein-Barr virus;
  • Epstein-Barr virus nuclear antigen (EBNA)-2;
  • pyothorax-associated lymphoma

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Pyothorax-associated lymphoma (PAL) is a non-Hodgkin's lymphoma, which develops in the pleural cavity of patients who have had pyothorax for over 20 years, and is strongly associated with Epstein-Barr virus (EBV) infection. The expression of latent genes, especially EBV nuclear antigen-2 (EBNA-2), influences the growth characteristics and malignant features of EBV-infected cells. Here, the effect of EBNA-2 expression on clinical features was examined in 13 cases of PAL. The EBNA-2 transcript was detected in 8 cases but was absent in 5. There was a significant difference in survival between patients with the transcripts and those without: the 1-year survival rate was 87.5 and 0%, respectively (p < 0.01). There was a discrepancy between EBNA-2 expression and EBNA promoter usage in 6 cases. The Cp/Wp promoter was used in 3 EBNA-2-negative cases, whereas the Qp promoter or multiple promoters were used in 3 EBNA-2-positive cases. Analysis of PAL cell lines provided a clue as to the mechanism underlying the discrepancy between EBNA-2 expression and EBNA promoter usage. Loss of EBNA-2 expression, irrespective of the latency pattern, is correlated with a poor prognosis, suggesting that down-regulation of the EBNA-2 expression could be selection pressure for the progression of PAL. © 2005 Wiley-Liss, Inc.

Malignant lymphoma frequently develops in the pleural cavity of patients with at least a 20-year history of pyothorax.1 This tumor stands as a distinct clinicopathologic entity, and thus the term pyothorax-associated lymphoma (PAL) has been proposed by Aozasa and coworkers.2 PAL is now listed as a distinct disease entity in the World Health Organization's Classification of tumors.3 PAL is a non-Hodgkin's lymphoma, mostly a diffuse large B-cell lymphoma, and is strongly associated with Epstein-Barr virus (EBV) infection. PAL usually responds to chemotherapy. Among the 106 cases of PAL previously reported by us,1 the prognosis varies with survival times ranging from 1 to 178 months. Approximately 46.2% of the patients died within 8 months of being diagnosed with PAL, while the 3-year survival rate in the remaining patients was 47.0%, showing that PAL cases could be subdivided into 2 groups.

EBV-infected cells show 3 patterns of latency-associated viral gene expression known as latency (Lat) I, II and III.4, 5 EBV-infected lymphoblastoid cell lines and immunocompromised hosts with lymphoproliferative diseases express all of the 9 latency-associated viral proteins, including 6 EBNAs (1, 2, 3A, 3B, 3C and LP) and 3 LMPs (1, 2A and 2B).4, 6 This pattern of latent gene expression is designated Lat III. In Lat II, as observed in EBV-associated Hodgkin's lymphoma and nasopharyngeal carcinoma, the EBNA-1, LMP-1 and LMP-2 genes but not other EBNA genes are transcribed.7, 8 In Lat I, EBV-infected cells express only EBNA-1, which is essential for episomal replication of EBV. This pattern is observed in Burkitt's lymphomas9 and gastric carcinomas.10

Immunohistochemical (IHC) study of 106 clinical cases revealed that PAL cells showed a Lat III pattern at the protein level.11 However, the expression of EBNA-2 and LMP-1 varied among 6 PAL cell lines established in our laboratory from 6 patients with PAL.12, 13 A recent IHC study of a large number of PAL cases revealed that 67 and 70% were positive for EBNA-2 and LMP-1, respectively.1 Results of IHC analysis might be influenced by the conditions at fixation or the condition of the tissues themselves, including degeneration, necrosis and degree of inflammatory change. In addition, cross reactivity of the antibodies used should be taken into account. Therefore, the pattern of latency could be defined more accurately through an analysis of the promoter usage than IHC analysis. It is evident from recent studies that EBNA promoter usage differs among the Lat patterns, i.e., the CpWp promoter is used in Lat III and the Qp promoter in Lat I/II.14 In this study, EBNA promoter usage was examined in cell lines and clinical samples of PAL.

The expression of latent genes correlates with the growth characteristics and malignant features of EBV-infected cells. EBNA-2 plays an especially important role in the transformation of EBV-infected B-lymphocytes through switching of the EBNA promoter usage from Wp to Cp,15, 16 induction of LMP-1 and LMP-2 expression,17, 18, 19 and control of key cellular growth-related genes.20 In this context, the effect of EBNA-2 expression on clinical features was examined in 13 cases of PAL. The results showed that loss of EBNA-2 expression was correlated with a poor prognosis. Analysis of PAL cell lines provided a clue as to the mechanism underlying the discrepancy between EBNA-2 expression and EBNA promoter usage. This is the first report demonstrating the relationship between loss of EBNA-2 gene expression and poor prognosis in cases of PAL.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Patients and clinical samples

Thirteen patients with PAL admitted to hospitals in the Osaka area, Japan, between 1995 and 2003 were selected for the present study. Informed consent was obtained from all patients. Age at first admission for PAL ranged from 65 to 82 (median, 72.0) years, with a male to female ratio of 8:5. Histological specimens obtained by biopsy or surgery were fixed in 10% formalin and routinely processed for paraffin embedding. Histological sections, cut 4 μm thick, were stained with hematoxylin and eosin, or subjected to the immunoperoxidase procedure. Tumors were histologically classified as diffuse large lymphomas (immunoblastic variant: 11 cases, centroblastic variant: 2 cases) according to the World Health Organization's criteria. Follow-up data was available for all these patients.

Cell lines

Five cell lines, OPL-1, -2, -3, -5 and -7, were established from 5 patients with PAL; their characteristics were reported in part elsewhere.12, 13 The original tumors in the 2 patients from whom OPL-2 and -5 were established showed rapid growth, and these patients died within 2 and 6 months after the biopsy, respectively. The patients from whom OPL-1, -3 and -7 were derived showed an indolent onset, and survived for 24, 30 and more than 36 months, respectively. Therefore, OPL-5, OPL-2, OPL-3, OPL-7 and OPL-1 were categorized as Agg-1, Agg-2, Ind-1, Ind-2 and Ind-3, respectively. A B95-8 EBV immortalized reference cell line (R-LCL) was established in our laboratory. Burkitt's lymphoma cell lines, Ramos and Namalwa, were purchased from the Japanese Collection of Research Bioresources (Tokyo, Japan). NAB-2, another Burkitt's lymphoma cell line, was generously provided by Dr. Tucker (University of Texas, Austin). These cell lines were grown in RPMI 1640 medium supplemented with 10% heat-inactivated FCS at 37°C in 5% CO2 in air.

RT-PCR analysis for detection of EBNA-1 promoter usage and latent gene expression

Fresh samples from 13 patients and 5 cell lines were subjected to analysis. Total RNA was extracted from the samples with the TRIzol reagent (Invitrogen, Inc., Rockville, MD), according to the manufacturer's instructions. Five micrograms of total RNA was reverse-transcribed by random hexamer priming using the Superscript first strand synthesis system (Invitrogen).

Patterns of EBV latent gene transcription were determined based on an analysis of gene promoter usage. The EBNA genes are transcribed as single polycistronic RNA molecules, which are spliced to generate the individual EBNA molecules.14 In Lat III, transcription initiates from the promoter located within the BamHI regions C and/or W (Cp, Wp), resulting in a Y/U/K-spliced EBNA-1 mRNA. Usage of Cp and Wp promoters was further distinguished using primer pairs C1/C2F and W2R, and W0/W1F and W2R, respectively. In Lat I or II, EBNA-1 is transcribed with the use of a downstream promoter located in the BamHI F and Q regions (the Q promoter, Qp), generating a Q/U/K-spliced mRNA without other EBNA products.21, 22 The Fp transcript, which is used in lytic cycles, was also analyzed. Expression of the EBV latent gene EBNA-2 was also analyzed. Lat I and Lat II were placed in the same category in the present study, because LMP-1 expression is sometimes very faint and unstable. The primer pairs used in the present study are summarized in Table I. All primer pairs were designed to cross the splice sites, thus one could distinguish cDNA from genomic DNA by size. To evaluate the sensitivity of RT-PCR for the detection of the latent genes, the R-LCL (predominantly latency III, with some cells in the lytic cycle) was tested as an undiluted population or diluted at 10−1 down to 10−5 in the EBV genome-negative Ramos line. cDNA diluted at 10−2 to 10−3 gave a positive signal for each RT-PCR (Fig. 1).

thumbnail image

Figure 1. Detection of EBV latent transcripts by RT-PCR analysis of RNA preparations containing EBV-positive R-LCL and EBV-negative B-cell Lines (Ramos). R-LCL (predominantly latency III, with some cells in the lytic cycle) was tested as an undiluted population (N) or diluted at 10−1 down to 10−4 in the EBV genome-negative Ramos line. The primer combinations used for the detection of EBNA-2, Cp-initiated mRNAs, Wp-initiated mRNAs, the Y3/U/K-spliced and Q/U/K-spliced forms of EBNA1 and Fp-initiated mRNA are shown as diagrams of the relevant transcripts; full details of primer and probe sequences are given in Table I. RT-PCR amplifications were carried out as described in Materials and methods.

Download figure to PowerPoint

Table I. Oligonucleotide Primers Used for PCR Reactions
 PrimerNucleotide sequence (5′–3′)Ta (°C)size (bps)Sensitivity
  1. Maximum dilutions of cDNA in which a positive signal could be detected for each RT-PCR.

Primers for amplification of the EBV genes
 EBNA-2Y2F5′-TACGCATTAGAGACCACTTTGAGCC-3′5858210−3
HR5′-AAGCGCGGGTGCTTAGAAGG-3′   
 EBNA-1Y3F5′-TGGCGTGTGACGTGGTGTAA-3′55Y3*U*K*spliced 26510−2
KR5′-CATTTCCAGGTCCTGTACCT-3′   
QF5′-GTGCGCTACCGGATGGCG-3′55Q*U*K*spliced 23610−3
KR5′-CATTTCCAGGTCCTGTACCT-3′   
 Cp-transcriptsC1/C2F5′-CATCTAAACCGACTGAAGAA-3′5324010−3
W2R5′-CCCTGAAGGTGAACCGCTTA-3′   
 Wp-transcriptsW0/W1F5′-GTCCACACAAATCCTAG-3′5321010−3
W2R5′-CCCTGAAGGTGAACCGCTTA-3′   
 Fp-transcriptsFF5′-GACCACTGAGGGAGTGTTCC-3′5534010−2
KR5′-CATTTCCAGGTCCTGTACCT-3′   
 B-actinF5′ CTTCCTTCCTGGGCATGGAG 3′55315Not determined
R5′ TGGAGGGGCCGGACTCGTCA 3′   
Primers for inverse PCR
 BamHIF5′-GCACCACCATCGTCCACGAG-3′55  
 BamHIR5′-CGGGAACGGCTCATGGCCCTACC-3′   

In situ hybridization and immunohistochemistry

RNA in situ hybridization using the EBER-1 probe was performed as previously described with some modifications.23 Briefly, 30-base oligonucleotide probes; 5′-AGACACCGTCCTCACCACCCGGGACTTGTA-3′, which were the sense and antisense for a portion of the EBER-1 gene, a region of the EBV genome that is actively transcribed in latently infected cells, were synthesized using a DNA synthesizer. As a positive control, the Raji cell line was used. As negative controls, the hybridizing mixture containing sense probe or antisense probe after RNase treatment was used. Immunophenotyping of EBNA-2 protein was performed with the paraffin sections of original tumor specimens as well as established cell lines using the avidin–biotin-peroxidase complex method with anti-EBNA-2 antibody (PE2) (Dakopatts, Glostrup, Denmark).

Southern blot analysis and DNA probes

Aliquots (10 μg) of DNA extracted from the cell lines were digested with BamHI, electrophoresed on 0.7% agarose gels and transferred to a Hybond N+(Amersham) nylon membrane. The filters were hybridized with BamHI-C, W, -Y, -H, -F, -Q and -U of the EBV genome as well as 2 probes that contain the unique DNA sequences at either end of the EBV genome. The BamHI fragments mentioned above and BamHI-Nhet fragments used in the vector pUC119 to make the probes-L and -R were kindly provided by Dr. Kenzo Takada (Hokkaido University). Probes-L and -R are portions of Nhet containing nucleotides 4 to 3957 and 166615 to 169424, respectively (GenBank ACC M80517). Each probe was radiolabeled by the random prime method according to the instructions of the manufacturer (Amersham).

Inverse-PCR for recovery of junction sites in the BamHI-U fragment in Agg-2 lines

The primers, BamHI-UF1; 5′-GCACCACCATCGTCCACGAG-3′ and BamHI-UR1; 5′-CGGGAACGGCTCATGGCCCTACC-3′, were designed to extend outward from the BamHI-U fragments of EBV. DNA isolated from the Agg-2 cell line was digested with Bam HI. The DNA (100–1,000 ng/μl) was circularized by ligation using T4 DNA ligase, and subjected to inverse PCR as a template. Thermocycling conditions for each reaction were 35 cycles of denaturation at 98°C for 5 sec, and annealing and extension at 68°C for 5 min, followed by a final 7 min extension at 72°C. PCR products were purified and cloned into pCR 2.1-TOPO (Invitrogen, Carlsbad, CA). Sequencing was performed by the dideoxy chain termination method, using a DNA sequencing kit (Applied Biosystems, Foster City, CA). The samples were analyzed using a Genetic Analyzer (ABI PRISM 310′, Applied Biosystems).

Fluorescence in situ hybridization

To detect the EBV genome by FISH, the cosmid pJB8 containing an EcoRI fragment (37 kbp) of EBV DNA was used to create a probe labeled with biotinylated 14-deoxyadenosine triphosphate by nick translation. FISH was performed by the method described previously.24 The hybridized probe was detected by incubation with FITC-conjugated avidin. Cy3-labelled probes consisting of repeat sequences of α-satellite DNA that hybridize with the centromere regions of chromosomes were purchased from Vysis (Downers Grove, IL). The hybridization signals were observed with a BX50 epifluorescence microscope (Olympus, Tokyo, Japan), and microphotographs were taken on Provia Fujichrome 100 films (Fuji Film, Tokyo, Japan).

Statistics

Kaplan–Meier methods with a log-rank test were used to calculate survival rate and differences in survival curves. p-values of <0.05 were considered statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

EBNA-2 expression and EBNA promoter usage in PAL clinical samples

RNA in situ hybridization using the EBER-1 probes revealed positive signals in the nucleus of tumor cells in all 13 cases (data not shown). EBNA-2 protein was judged to be present in 9 of 12 cases. The rate of positive cases was similar to a previous report.1 The EBNA-2 transcript was detected in 8 cases (Case 1–8) but absent in 5 (Case 9–13) (Table II, Fig. 2). A discrepancy between the expression of the EBNA-2 transcript and protein was detected in 4 cases (Case 7, 9, 12 and 13).

thumbnail image

Figure 2. Detection of EBNA-2 and EBNA-1 transcripts by RT-PCR analysis products obtained after RT-PCR using RNA from PAL clinical samples were visualized on agarose gels stained with ethidium bromide. NK, NK92; IB, IB-4; C, negative control. NK-92 and IB-4 were diluted to 10−2 of cDNA prepared as described in Materials and methods.

Download figure to PowerPoint

Table II. Summary of EBV Transcripts in Clinical Samples
Case no.Age (yr)SexDuration of pyothorax (yr)Age at diagnosis of tuberculosis (yr)HistologyFollow up (months after diagnosis)IHCRT-PCR
LMP-1EBNA-2EBNA-2Cp-transcriptsWp-transcriptsEBNA1-Y3KEBNA1-QKFp-KPredicted latencyCell line established
  1. M, male; F, female; IB, immunoblastic; CB, centroblastic; ND, not determined; MP, multiple promoters; D, death; DT, death due to tumor; A, alive; LMP-1, latent membrane protein-1; EBNA-2, EB nuclear antigen 2.

168M4028IB3 (DT)++++++III 
272M5022IB30 (DT)++++++IIIInd-1
371F5219IB36 < (A)++++++IIIInd-2
474F5519CB36 < (A)+++NDND+NDIII 
582F6418IB13 (D)ND+NDND+NDIII 
668M3929IB24 (DT)+++++MP 
775M2540CB33 (DT)++++MP 
876M4630IB24 (DT)++++I/IIInd-3
965F4520IB4 (DT)+++III 
1068M4127IB8 (DT)NDND+NDIII 
1174F5618IB6 (DT)+++IIIAgg-1
1267M4027IB2 (DT)++I/IIAgg-2
1373M4330IB1 (DT)+++I/II 

In 5 of 8 cases in which the EBNA-2 transcript was detected, Cp and Wp promoters were used, indicating Lat III. In one case (Case 8), only EBNA1-QK was detected, indicating Lat I/II. In the remaining 2 cases (Case 6, 7), EBNA1-QK and Cp and Wp were present, indicating the usage of multiple promoters. In 2 of 5 cases, in which the EBNA-2 transcript was not detected, only EBNA1-QK was detected, thus indicating Lat I/II. In the remaining 3 cases, Wp and/or EBNA-Y3K were detected, indicating Lat III. In these cases, no switching of the promoter from Wp to Cp was observed. The Fp transcripts used in lytic cycles were not detected in any samples.

Tumor cells in all but 2 cases, in which data on EBNA-2 mRNA expression was available, had an immunoblastic morphology. Therefore, there was no significant difference in histology with EBNA-2 expression.

Prognosis of PAL patients

Follow-up study revealed that the median survival was 14 months. The estimated 1, 2, and 3-year survival rate was 46.2, 30.8 and 15.4%, respectively. There was a significant difference in survival between patients with the EBNA-2 transcript and those without: the 1-year survival rate was 87.5 and 0%, respectively (p < 0.01) (Fig. 3).

thumbnail image

Figure 3. Survival curves in patients with EBNA-2-positive and negative PAL. The 1-year survival rate was significantly better in EBNA-2-positive (87.5 %) than that in negative cases (0%) (p < 0.01).

Download figure to PowerPoint

Analysis of PAL cell lines

There was a discrepancy between EBNA-2 expression and EBNA promoter usage in 6 clinical samples. To understand the mechanism underlying this discrepancy, 5 cell lines established from PAL clinical samples were analyzed further.

Morphologic features and growth characteristics

Growth characteristics differed between the lines derived from aggressive tumors (Agg-1 and Agg-2) and indolent tumors (Ind-1, Ind-2 and Ind-3) (Fig. 4a). Both Agg-1 and -2 grew as single cells while Ind-1, -2 and -3 grew as aggregates. Ind-1 and -2 tended to attach to the bottom of the culture plate. The doubling time of the cells was shorter in Agg-2 (24 hr) and Agg-1 (36 hr) than that in Ind-1 (72 hr), Ind-2 (108 hr) and Ind-3 (48 hr).

thumbnail image

Figure 4. (a) The appearance of PAL cells. Both Agg-1 and -2 grow as single cells, while Ind-1 and -3 grow as aggregates (×200). (b) Detection of EBV latent transcripts by RT-PCR of RNA preparations from PAL cell lines. (c) R-LCL (10−1) dilution.

Download figure to PowerPoint

EBNA-2 expression and EBNA promoter usage

In situ hybridization revealed the EBV genome in the nucleus of all 5 cell lines (data not shown). EBNA-2 was expressed in Ind-1, -2 and -3, but not in Agg-1 and -2, consistent with the findings obtained with the biopsy samples from which the cell lines were derived. EBV latent gene transcripts found in each cell line were similar to those found in the clinical samples except for Ind-3, which was derived from Case 3. Besides EBNA1-QK, Wp and EBNA1-Y3K were used in Ind-3 (Fig. 4b, Table III).

Table III. Summary of EBV Transcripts in Clinical Samples
Case no.Age (yr)SexDuration of pyothorax (yr)Age at diagnosis of tuberculosis (yr)HistologyPrognosis (months after diagnosis)IHCRT-PCRPredicted latency
EBNA-2 biopsy sampleCell linesLMP-1 biopsy sampleCell linesEBNA-2 transcriptsCp-transcriptsWp-transcriptsEBNA1-Y3KEBNA1-QKFp-K
  1. M, male; F, female; IB, immunoblastic; CB, centroblastic; MP, multiple promoters.

Agg-174F5618IB6+++III
Agg-267M4027IB2++I/II
Ind-172M5022IB30++++++++III
Ind-271F5219IB36<+++++++III
Ind-376M4630IB24+++++++MP

EBV genomic structure

There was a discrepancy between EBNA-2 expression and EBNA promoter usage in Agg-1 and Ind-3. In this context, the structure of the EBV genome was investigated in 5 lines. First, Southern blotting was performed with probes at either end of the EBV genome; i.e., probe-L and -R. A single fragment of the same size was detected in all lines but Agg-2 (Fig. 5a). In Agg-2, probe-L was hybridized with a single fragment of 9.5 kbp, while probe-R was not hybridized at all, indicating that the EBV genome may not join at the terminal repeat as a circular form in Agg-2.

thumbnail image

Figure 5. EBV genomic structure in PAL cell lines. Ten micrograms of DNA from each cell line was digested with BamHI, electrophoresed in a 0.7% agarose gel, and transferred to a Hybond N+ (Amersham) nylon membrane. (a) The filters were hybridized with either probe R or probe L. A single fragment of the same size was detected in all lines but Agg-2. (b) The filters were hybridized with probes-Y, -H, -F and -U, respectively. All probes hybridized with the bands of expected size in the Burkitt's lymphoma cell line, NAB-2, (N), while the EBV genomic regions BamHI-Y and -H could not be detected in Agg-1. Aberrant fragments of 15 kbp (*) and 5.4 kb (**) were detected in Agg-1 with probe-W and in Agg-2 with probe-U, respectively.

Download figure to PowerPoint

The filters were hybridized with probes-C, -W, -Y, -H, -F, -Q and -U, respectively. All probes hybridized with the bands of expected size in Ind-1, -2 and -3, (data not shown), but not in Agg-1 and -2 (Fig. 5b). In Agg-1, probes-Y and -H did not hybridize with any fragments. Probe-W hybridized with aberrant bands of about 15 kbp besides BamHI-W and Y fragments, indicating a structural abnormality, such as deletion or rearrangement of the EBV genome in these regions. The EBNA-2 gene is located in the BamHI-Y and -H fragments, therefore it might not be expressed in Agg-1. In Agg-2, probe-U hybridized with an aberrant fragment of 5.4 kbp in addition to the expected fragment of 3.3 kbp.

Analysis of the aberrant fragment in Agg-2

To analyze the aberrant fragment detected with probe-U, inverse-PCR was designed to extend outward from the BamHI-U fragment of EBV. Through inverse PCR with the primers of BamHI-UF and BamHI-UR, a single band of 4.6 kbp was detected (data not shown). Sequencing revealed that the fragment contained an unknown sequence of ˜4.5 kbp that was sandwiched between the 2 BamHI-U fragments, and arranged in the opposite direction to each other. There was only 1 BamHI cleavage site between the unknown sequence and BamHI-U fragment, indicating that this cleavage site was ligated artificially. Standard nucleotide–nucleotide BLAST analysis revealed that the unknown sequence corresponded to nucleotides 38785 to 43245 of clone RP11-1H20 on chromosome 4 (GenBank accession no. AC139724). This suggests that nucleotide 59690 of clone RP1-104D1 was the integration site of the EBV genome.

To corroborate evidence for viral integration, metaphase chromosomes of Agg-2 cells were examined by FISH. As shown in Figure 6a, symmetrical signals on both sister chromatids of a specific chromosome were observed in essentially all metaphase spreads, indicating integration of EBV DNA in Agg-2 cells. In parallel control experiments, Namalwa cells, known to carry 2 copies of EBV per cell, showed a single site of viral integration on chromosome 1, as reported previously (Fig. 6b).25

thumbnail image

Figure 6. FISH on metaphase chromosomes with the EBV-specific probe in Agg-2 and Namalwa.

Download figure to PowerPoint

The EBV genomic structure in Agg-1 and Agg-2 cells is summarized in Figure 7.

thumbnail image

Figure 7. Schematic representation of aberrant EBV genomic structure observed in Agg-1 and Agg-2. The EBV genome in Agg-1 has abnormalities in BamHI-Y and -H fragments, which encode the latent gene EBNA-2 and lytic genes BHLF1 and BHRF1. An integration site for the EBV genome was found in the BamHI-U fragment in Agg-2. The sequence at the junctions is shown.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

A previous study on a relatively small number of PAL cases found a Lat III pattern of EBV infection at the protein level.11 Theoretically, EBNA-2 is expressed in the Lat III pattern of EBV infection, not Lat I/II.4, 5, 6 However, conflicting results were found between EBNA-2 expression and EBNA promoter usage in 6 of 13 clinical samples in the present series. Qp, Cp and Wp were used in 2 EBNA-2-positive cases (Case 6 and 7). Only Qp was used in Case 8. Multiple promoters were used (Qp and Wp) in Ind-3 derived from Case 8. In another PAL-derived cell line, Deglis, multiple promoters were also used (unpublished data). Multiple usages of EBNA promoters may be relatively frequent in PAL cases.

PAL cell lines derived from cases showing an aggressive clinical course, Agg-1 and -2, possessed EBV structural abnormality, deletion and/or rearrangement in Agg-1 and integration into the host genome in Agg-2. In Agg-1, a structural abnormality around the EBNA-2 gene was suggested by Southern blotting. Because Y3UK transcripts were detected, deletion and/or rearrangements might occur in a part of BamHI-Y and BamHI-H, which could explain the loss of EBNA-2 expression. Kelly et al. reported similar findings in clinical samples and cell lines derived from BL, i.e., deletion and loss of expression of the EBNA-2 gene.26 A similar kind of deletion was also reported in P3HR127 and Daudi.28 Furthermore, the integration of EBV into the host genome of Raji cells was identified in this region.29 Taken together, the BamHI-Y and -H region of the EBV genome might be a hotspot for mutations such as deletions, rearrangements and integration. In Agg-2, integration of EBV into the host genome was demonstrated. Recently, Daibata et al. also reported an aggressive case of PAL, in which the EBV genome was integrated into Chromosome 1.30 Such EBV structural abnormality might be caused by chromosomal instability, as indicated by the complicated karyotypes found in PAL cells.12, 13 An abnormality in the EBV genome, such as deletion, rearrangement and integration into the host genome, might also have caused loss of EBNA-2 expression in the remaining cases (Case 9,10).

The present study showed that the poor prognosis of the PAL patients correlated with loss of EBNA-2 expression irrespective of the Lat pattern. It is well known that EBNA-2 plays an important role in B-cell transformation; EBNA-2 expression induces a Wp-to-Cp switch,15, 16 LMP-1 and LMP-2 expression17, 18, 19 and the activation of key cellular growth-related genes.20 Loss of EBNA-2 gene expression results in the downregulation of other latent genes15, 16, 17, 18, 19, 20 and no Wp-to-Cp switch. Recent study showed that a decrease in endogenous EBNA-2 expression allows lymphoma cells to escape immune pressure from host immune surveillance through a loss of antigen processing capacity.31 This might be important for the progression of lymphoma, whereas EBNA-2 expression could have a positive effect on lymphomagenesis.

In Burkitt's lymphoma with the Lat I pattern of EBV infection, only EBNA-1 is expressed. In this lymphoma, however, cMYC is constitutively active through rearrangement, and thus involved in the malignant transformation of lymphoma cells. EBNA-2 and cMYC are reported to have opposite effects: cMYC contributes to the phenotypes of the BL cells through upregulation of CD 10 and CD38 and downregulation of the adhesion molecules.20, 31 When cMYC was expressed, EBNA-2-negative cell lines grew in single cell suspensions.20, 31 In the present study, EBNA-2-negative lines, Agg-1 and -2, also grew in single cell suspensions. A comparable level of cMYC was detected in Ind-3 and Agg-2 in a previous study,13 but it was not determined whether cMYC is abnormally activated or not. The involvement of the cMYC gene in PAL cases should be clarified.

In the present study, expression of the EBNA-2 transcript in PAL cases correlated with prognosis, suggesting that PAL could be subdivided into 2 groups. However, most PAL cases are histologically categorized as immunoblastic. Further histopathological analysis might provide a clue to distinguishing between the 2 groups.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

We thank Dr. K Takada (Hokkaido University, Japan) for providing the EBV BamHI fragments in the vector pUC119. We thank Dr. PW Tucker (University of Texas, Austin) for providing NAB-2 cell lines.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • 1
    Nakatsuka S, Yao M, Hoshida Y, Yamamoto S, Iuchi K, Aozasa K. Pyothorax-associated lymphoma: a review of 106 cases. J Clin Oncol 2003; 20: 425560.
  • 2
    Iuchi K, Aozasa K, Yamamoto S, Mori T, Tajima K, Minato K, Mukai K, Komatsu H, Tagaki T, Kobashi Y, Yamabe H. Shimoyama M. Non-Hodgkin's lymphoma of the pleural cavity developing from long-standing pyothorax. Summary of clinical and pathological findings in thirty-seven cases. Jpn J Clin Oncol 1989; 19: 24957.
  • 3
    Banks PM, Harris NL, Warnke RA, Gaulard PH. Lymphomas. In: TravisWD, BrambillaE, Mueller-HermelinkHK, HarrisCC, eds. World health organization classification of tumors: pathology and genetics of tumors of the lung, pleura, thymus and heart. Lyon: IARC Press, 2004. p 13740.
  • 4
    Rowe M, Rowe DT, Gregory CD, Young LS, Farrell PJ, Rupani H, Rickinson AB. Differences in B cell growth phenotype reflect novel patterns of Epstein-Barr virus latent gene expression in Burkitt's lymphoma cells. EMBO J 1987; 6: 274351.
  • 5
    Kerr BM, Lear AL, Rowe M, Croom CD, Young LS, Rookes SM, Gallimore PH, Rickinson AB. Three transcriptionally distinct forms of Epstein-Barr virus latency in somatic cell hybrids: cell phenotype dependence of virus promoter usage. Virology 1992; 187: 189201.
  • 6
    Young L, Alfieri C, Hennessy K, Evans H, O'Hara C, Anderson KC, Ritz J, Shapiro RS, Rickinson A, Kieff E. Expression of Epstein-Barr virus transformation-associated genes in tissues of patients with EBV lymphoproliferative disease. N Engl J Med 1989; 321: 10805.
  • 7
    Brooks L, Yao QY, Rickinson AB, Young LS. Epstein-Barr virus latent gene transcription in nasopharyngeal carcinoma cells: coexpression of EBNA1, LMP1, and LMP2 transcripts. J Virol 1992; 66: 268997.
  • 8
    Deacon EM, Pallesen G, Niedobitek G, Crocker J, Brooks L, Rickinson AB, Young LS. Epstein-Barr virus and Hodgkin's disease: transcriptional analysis of virus latency in the malignant cells. J Exp Med 1993; 177: 33949.
  • 9
    Tao Q, Robertson KD, Manns A, Hildesheim A, Ambinder RF. Epstein-Barr virus (EBV) in endemic Burkitt's lymphoma: molecular analysis of primary tumor tissue. Blood 1998; 91: 137381.
  • 10
    Sugiura M, Imai S, Tokunaga M, Koizumi S, Uchizawa M, Okamoto K, Osato T. Transcriptional analysis of Epstein-Barr virus gene expression in EBV-positive gastric carcinoma: unique viral latency in the tumour cells. Br J Cancer 1996; 74: 62531.
  • 11
    Fukayama M, Ibuka T, Hayashi Y, Ooba T, Koike M, Mizutani S. Epstein-Barr virus in pyothorax-associated pleural lymphoma. Am J Pathol 1993; 143: 10449.
  • 12
    Takakuwa T, Luo WJ, Ham MF, Mizuki M, Iuchi K, Aozasa K. Establishment and characterization of unique cell lines derived from pyothorax-associated lymphoma which develops in long-standing pyothorax and is strongly associated with Epstein-Barr virus infection. Cancer Sci 2003; 94: 85863.
  • 13
    Kanno H, Yasunaga Y, Ohsawa M, Taniwaki M, Iuchi K, Naka N, Torikai K, Shimoyama M, Aozasa K. Expression of Epstein-Barr virus latent infection genes and oncogenes in lymphoma cell lines derived from pyothorax-associated lymphoma. Int J Cancer 1996; 67: 8694.
  • 14
    Young LS, Dawson CW, Eliopoulos AG. The expression and function of Epstein-Barr virus encoded latent genes. Mol Pathol 2000; 53: 23847.
  • 15
    Woisetschlaeger M, Jin XW, Yandava CN, Furmanski LA, Strominger JL, Speck SH. Role for the Epstein-Barr virus nuclear antigen 2 in viral promoter switching during initial stages of infection. Proc Natl Acad Sci USA 1991; 88: 39426.
  • 16
    Sung NS, Kenney S, Gutsch D, Pagano JS. EBNA-2 transactivates a lymphoid-specific enhancer in the BamHI C promoter of Epstein-Barr virus. J Virol 1991; 65: 21649.
  • 17
    Abbot SD, Rowe M, Cadwallader K, Ricksten A, Gordon J, Wang F, Rymo L, Rickinson AB. Epstein-Barr virus nuclear antigen 2 induces expression of the virus-encoded latent membrane protein. J Virol 1990; 64: 212634.
  • 18
    Fahraeus R, Jansson A, Ricksten A, Sjoblom A, Rymo L. Epstein-Barr virus-encoded nuclear antigen 2 activates the viral latent membrane protein promoter by modulating the activity of a negative regulatory element. Proc Natl Acad Sci USA 1990; 87: 73904.
  • 19
    Wang F, Tsang SF, Kurilla MG, Cohen JI, Kieff E. Epstein-Barr virus nuclear antigen 2 transactivates latent membrane protein LMP1. J Virol 1990; 64: 340716.
  • 20
    Kaiser C, Laux G, Eick D, Jochner N, Bornkamm GW, Kempkes B. The proto-oncogene c-myc is a direct target gene of Epstein-Barr virus nuclear antigen 2. J Virol 1999; 73: 44814.
  • 21
    Sample J, Brooks L, Sample C, Young L, Rowe M, Gregory C, Rickinson A, Kieff E. Restricted Epstein-Barr virus protein expression in Burkitt's lymphoma is due to a different Epstein-Barr nuclear antigen 1 transcriptional initiation site. Proc Natl Acad Sci USA 1991; 88: 63437.
  • 22
    Schlager S, Speck SH, Woisetschlager M. Transcription of the Epstein-Barr virus nuclear antigen 1 (EBNA1) gene occurs before induction of the BCR2 (Cp) EBNA gene promoter during the initial stages of infection in B cells. J Virol 1996; 70: 356170.
  • 23
    Weiss LM, Jaffe ES, Liu XF, Chen YY, Shibata D, Medeiros LJ. Detection and localization of Epstein-Barr viral genomes in angioimmunoblastic lymphadenopathy and angioimmunoblastic lymphadenopathy-like lymphoma. Blood 1992; 79: 178995.
  • 24
    Daibata M, Taguchi T, Taguchi H, Miyoshi I. Integration of human herpesvirus 6 in a Burkitt's lymphoma cell line. Br J Haematol 1998; 102: 130713.
  • 25
    Lawrence JB, Villnave CA, Singer RH. Sensitive, high-resolution chromatin and chromosome mapping in situ: presence and orientation of two closely integrated copies of EBV in a lymphoma line. Cell 1988; 52: 5161.
  • 26
    Kelly G, Bell A, Rickinson A. Epstein-Barr virus-associated Burkitt's lymphomagenesis selects for downregulation of the nuclear antigen EBNA2. Nat Med 2002; 8: 10981104.
  • 27
    Bornkamm GW, Hudewentz J, Freese UK, Zimber U. Deletion of the nontransforming Epstein-Barr virus strain P3HR-1 causes fusion of the large internal repeat to the DSL region. J Virol 1982; 43: 95268.
  • 28
    Jones MD, Foster L, Sheedy T, Griffin BE. The EB virus genome in Daudi Burkitt's lymphoma cells has a deletion similar to that observed in a non-transforming strain (P3HR-1) of the virus. EMBO J 1984; 3: 81321.
  • 29
    Takakuwa T, Luo WJ, Ham MF, Sakane IF, Wada N, Aozasa K. Integration of Epstein-Barr virus into chromosome 6q15 of Burkitt's lymphoma cell line (Raji) induces loss of BACH2 expression. Am J Pathol 2004; 164: 96774.
  • 30
    Daibata M, Taguchi T, Nemoto Y, Saito T, Machida H, Imai S, Miyoshi I, Taguchi H. Epstein-Barr virus (EBV)-positive pyothorax-associated lymphoma (PAL): chromosomal integration of EBV in a novel CD2-positive PAL B-cell line. Br J Haematol 2003; 117: 54657.
  • 31
    Pajic A, Staege MS, Dudziak D, Schuhmacher M, Spitkovsky D, Eissner G, Brielmeier M, Polack A, Bornkamm GW. Antagonistic effects of c-myc and Epstein-Barr virus latent genes on the phenotype of human B cells. Int J Cancer 2001; 93: 8106.