The vascular endothelial growth factor receptor (VEGFR-1) supports growth and survival of human breast carcinoma

Authors


Abstract

Vascular endothelial growth factor receptor 1 (VEGFR-1) is present on endothelial cells and subsets of human tumor cells, raising the hypothesis that angiogenic factors may promote tumor growth both by inducing angiogenesis and directly signaling through activation of VEGFR-1 on tumor cells. Here, we report that VEGFR-1 is expressed on a panel of 16 human breast tumor cell lines, and the vasculature and the tumor cell compartment of a subset of breast carcinoma lesions, and that selective signaling through VEGFR-1 on breast cancer cells supports tumor growth through downstream activation of the p44/42 mitogen-activated protein kinase (MAPK) or Akt pathways. Ligand-stimulated proliferation of breast tumor cells was inhibited by specific blockade with an anti-VEGFR-1 neutralizing monoclonal antibody. Treatment with anti-VEGFR-1 mAb significantly suppressed the growth of DU4475, MCF-7, BT-474 and MDA-MB-231 breast xenografts in athymic mice. Histological examination of anti-VEGFR-1 mAb treated tumor xenografts showed a significant reduction of activation of the p44/42 MAPK or Akt pathways in tumor cells resulting in an increase in tumor cell apoptosis. Importantly, cotreatment with mAbs targeting human VEGFR-1 on tumor cells and murine VEGFR-1 on vasculature led to more potent growth inhibition of breast tumor xenografts. The results suggest that VEGF receptors may not only modulate angiogenesis, but also directly influence the growth of VEGF receptor expressing tumors. © 2006 Wiley-Liss, Inc.

Despite significant advances in early detection and treatment, breast carcinoma is the second most prevalent cancer in women in the United States, accounting for nearly 1 out of every 3 cancers diagnosed, and is the second leading cause of cancer-related mortality.1 At time of detection, approximately 80% of all breast carcinoma cases are pathologically diagnosed as invasive or infiltrating where they have spread beyond the duct or lobule of origin invading into the surrounding tissue of the breast. Although surgery with subsequent chemo- or radiotherapy is the primary course of treatment for most breast carcinomas, the recent clinical success of therapeutics, which target specific proteins expressed by tumor cells, has demonstrated that growth factor receptor and tyrosine kinase inhibitors have important clinical benefit.2

Growth and regulation of breast tumor cells involve a variety of steroid hormones and receptors, proteinases and growth factors and their cognate receptors. Several members of the epidermal growth factor receptor (EGFR) family, such as EGFR and HER2, have been shown to be over-expressed in breast carcinoma and are mediators of pathogenesis.3 Also, among growth factors, vascular endothelial growth factor (VEGF) has been indicated to play a major role in breast carcinoma, as higher levels of cytosolic VEGF-A represent a strong independent prognostic factor in node-negative as well as node-positive breast cancers.4

VEGF-A is a multifunctional cytokine, which is a central regulator of physiological and pathological angiogenesis.5, 6 VEGF-A exerts its effects predominantly through 2 receptor tyrosine kinases, VEGFR-1/Flt-1 and VEGFR-2/KDR/Flk-1. Although functional VEGF-A receptors are primarily expressed on endothelial cells,7, 8 it is now well established that VEGFR-1 is expressed on other cell types, including hematopoietic cells, monocytes and smooth muscle cells.9, 10, 11, 12, 13 Little is known about the signaling cascades downstream of VEGFR-1, which may convey signals for monocyte migration and survival14, 15 as well as positive or negative signals for endothelial cell mitogenesis and chemotaxis depending on the biological condition.16, 17 Importantly, another member of the VEGF family, placental growth factor (PlGF), a specific ligand for VEGFR-1, has been shown to promote hematopoiesis and pathological angiogenesis through activation of VEGFR-1.18, 19, 20, 21

Several studies have demonstrated the presence of VEGF-A receptors on hematological malignant cells and solid tumor cells including those of nonsmall cell lung carcinoma, melanoma, prostate carcinoma, leukemia and breast carcinoma.22, 23, 24, 25, 26, 27, 28 We have shown that functional VEGF-A/VEGFR-2 autocrine loops are present in subsets of human leukemias and support in vivo leukemic cell survival and migration.29, 30 Therefore, in subsets of human tumors, such as leukemias, VEGF-A may promote growth by directly acting on its receptors via an endothelial cell-independent pathway. In one report, it was demonstrated that VEGFR-1 is expressed in several breast carcinoma cell lines and that stimulation of T-47D breast carcinoma cells with VEGF-A induced invasion and signaling in vitro, suggesting a possible autocrine pathway leading to increased tumorigenesis.28 Increased VEGF expression was reported to be associated with more aggressive tumors through competing with the ligand SEMA3F binding to neuropilin-1 and reducing SEMA3F–mediated suppression of tumor angiogenesis in lung cancer.31 Recently, the expression of VEGFR-1 in breast carcinomas was determined as a significant prognostic indicator of poor outcome, high risk of metastasis and relapse.32 However, there have been no reports that have formally evaluated the physiological significance of VEGFR-1 expression in human breast carcinoma cells and the role of the VEGF-A/VEGFR-1 pathway in breast cancer cells in in-vivo models.

In this study, we examined the role of VEGFR-1 signaling in growth and survival of human breast tumor cells and determined the potential utility of anti-VEGFR-1 neutralizing monoclonal antibody (mAb) therapy in inhibition of human breast carcinoma cells in vitro and human breast carcinoma xenografts in vivo. VEGF-A or PlGF treatment stimulated the growth of breast carcinoma cells in vitro. Blockade of VEGFR-1 function on several human breast carcinomas by an anti-VEGFR-1 neutralizing mAb suppressed tumor growth in vivo. The antitumor effect was a result of reduction in activation of MAPK or/and Akt in tumor cells resulting in reduced proliferation and increased apoptosis. Concomitant treatment with neutralizing mAbs against human VEGFR-1 inhibiting functions in cancer cells and against murine VEGFR-1 blocking tumor angiogenesis led to a more potent inhibition of tumor growth than either treatment alone. Taken together, these findings suggest that VEGFR-1 has an essential and functional role in the growth of breast carcinoma and that targeting VEGFR-1 may be a novel antitumor strategy for the treatment of breast carcinoma.

Material and methods

Materials

All reagents and chemicals were purchased from Sigma (St. Louis, MO), unless otherwise noted. Human VEGF165 (VEGF-A) and soluble recombinant extracellular domains of VEGFR-1-alkaline phosphatase (rhuVEGFR-1-AP) proteins were expressed in stably transfected cells and purified from cell culture supernatant, following the procedures described previously.33 Cell culture ware and assay plates were purchased from BD Biosciences (Bedford, MA).

Cell lines

The human breast carcinoma cell lines of DU4475, MCF-7, T-47D, SK-BR-3, MDA-MB-157, MDA-MB-175, MDA-MB-231, MDA-MB-435, MDA-MB-468, AU565, BT-474, BT-483, HCC38, UACC-812 and ZR-75-1, and mouse breast tumor cell line 4T1 and P3-X63-Ag8.653 myeloma cell line were purchased from American Type Tissue Culture Collection (ATCC, Manassas, VA). The human breast cancer cell line MX-1 was obtained from National Cancer Institute (NCI, Frederick, MD). These cell lines were maintained in RPMI1640, DMEM, Leibovitz's L-15, or MaCoy's 5A medium (Invitrogen/Life Technologies, Rockville, MD) containing 10% FCS (HyClone, Logan, UT) and supplements of L-glutamine, HEPES, glucose or insulin for some cell culture at 37°C in a humidified, 5% CO2 atmosphere, according to the instruction provided by ATCC and NCI. Porcine aorta endothelial (PAE) cells and VEGFR-1 expressing PAE (PAE-VEGFR-1) cell line were provided by Dr. L. Claesson-Welsh, Uppsala University, and cultured in F12 medium (Invitrogen/Life Technologies, Rockville, MD) containing 10% FCS (HyClone, Logan, UT). Human umbilical vein endothelial cells (HUVEC) were cultured in complete endothelial medium as previously described.30

Anti-VEGFR-1 antibodies

Monoclonal antibodies (mAbs) specifically bound to VEGFR-1 were generated by a standard hybridoma technology. Briefly, BALB/c mice or Lewis rats (Harlan Sprague Dawley, Indianapolis, IN) were immunized subcutaneously (s.c.) with the recombinant human or mouse VEGFR-1-AP proteins emulsified in complete Freund's adjuvant. Animals were intraperitoneally (i.p.) boosted 3 times with either VEGFR-1 protein in incomplete Freund's adjuvant. Splenocytes were harvested from the immunized animals and fused with myeloma cells. The cells were then cultured in HAT (hypoxanthine, aminopterin and thymidine) selection medium for establishing hybridomas. Hybridomas producing anti-VEGFR-1 specific antibodies were identified by ELISA-based binding and blocking, as previously described.34 Positive hybridomas were subcloned 3 times for establishment of monoclonal hybridoma cell lines. Antibodies were produced in serum-free fermentation and purified through a Protein-A affinity chromatography process.

VEGFR-1 blocking assay

To determine blocking activity of the anti-VEGFR-1 antibodies, mAbs 6.12 or MF1 in different concentrations were preincubated with human or mouse VEGFR-1 AP in the ELISA buffer for 1 hr and then incubated in VEGF-A or PlGF (R & D Systems, Minneapolis, MN) coated 96-well microtiter plates for another hour. After washing, p-nitrophenyl phosphate substrate for AP was added for color development, following the manufacturer's instruction. The absorbance at 405 nm was read on a microtiter plate reader (Molecular Devices Corp., Sunnyvale, CA) for quantification of VEGFR-1 binding to VEGF-A or PlGF. Data were analyzed using a GraphPad Prism Software (GraphPad Software Inc., San Diego, CA).

Immunohistochemical analysis of human breast carcinomas

Four to six micron of frozen sections or frozen tissue arrays of human normal breast and invasive ductal breast carcinoma of varying pathological stages were stained for VEGFR-1 using the EnVision+ Mouse kit (DAKO, Carpinteria, CA) per manufacturer's instructions with subtle modifications. Briefly, endogenous peroxidases were blocked using Peroxidase Block from the kit, for 5 min at RT. After washing, a mouse monoclonal antibody against human VEGFR-1 (FB5) or isotype control was incubated with the tissue sections at 1 ug/ml for 1 hr at RT, followed by 3 PBS washes to remove unbound antibody. Anti-mouse IgG HRP-labeled polymer was incubated with the sections for 30 min at RT, followed by PBS washes. Staining was developed using diaminobenzidine (DAB)+ for 5 min at RT, followed by brief counterstaining in Mayer's hematoxylin (DAKO), blueing, dehydration, clearing and coverslipping in a permanent mounting medium. Positive immunostaining was analyzed and imaged using an Axioskop light microscope with an Axiocam digital camera (Zeiss, Thornwood, NY).

RNA extraction, cDNA synthesis and RT-PCR

Total RNA was isolated using Trizol (Gibco BRL, Rockville, MD), first-strand cDNA was subsequently synthesized using SuperScript II reverse transcriptase, according to manufacturer's protocol (Amersham Pharmacia Biotech, Piscataway, NJ). A PCR was performed using Advantage 2 polymerase mix (Clontech Laboratories Inc., Palo Alto, CA) by the following steps: denaturation at 94°C for 5 min, annealing at 63°C for 45 sec, and extension at 72°C for 45 sec in a precycle reaction; followed by 35 cycles: 94°C for 1 min, 63°C for 45 sec, 72°C for 2 min and a final extension at 72°C for 7 min. Primers used for VEGFR-1 RT-PCR: 5′-primer ATTTGTGATTTTGGCCTTGC, 3′-primer CAGGCTCATGAACTTGAAAGC; VEGF: 5′-primer CGAAGTGGTGAAGTTCATGGATG, 3′-primer TTCTGTATCAGTCTTTCCTGGTGAG; PlGF: 5′-primer CGCTGG-AGAGGCTGGTGG, 3′-primer GAACGGATCTTTAGGAG CTG; Primers used for G3PDH: 5′-primer TGAAGGTCGGAGTCAACGGATTTGGT, 3′-primer CATGTGGGCCATGAGGTCCACCAC, and β-actin: 5′-primer TCATGTTTGAGACC TTCAA, 3′-primer GTCTTTGCGGATGTCCACG. We used oligonucleotide primers designed to amplify 3 of the VEGF splicing variants (121,165 and189).

Flow cytometry analysis

Aliquots of 106 breast carcinoma cells or PAE-VEGFR-1 cells were harvested from subconfluent cultures and incubated with VEGFR-1 specific mAb FB5, 6.12 or MF1 in PBS with 1% BSA and 0.02% sodium azide (staining buffer) for 1 hr on ice. A matched mouse IgG isotype (Jackson ImmunoResearch, West Grove, PA) was used as a negative control. For confirmation of MF1 binding activity with VEGFR-1, 4T1 cells were incubated with 2 μg/ml of VEGF-A prior to addition of MF1. Cells were washed twice with flow buffer and then incubated with a FITC-labeled goat anti-mouse IgG antibody (BioSource International) in staining buffer for 30 min on ice. Cells were washed as earlier and analyzed on an Epics XL flow cytometer (Beckman-Coulter, Hialeah, FL). Dead cells and debris were eliminated from the analysis, on the basis of forward and sideways light scatter. The mean fluorescent intensity ratio (MFIR) was calculated to quantitate relative expression levels of VEGFR-1 in these cell lines. The MFIR is the mean fluorescence intensity (MFI) of cells stained with VEGFR-1 specific mAb divided by the MFI of cells stained with an isotype control mAb.

Measurement of VEGF and PlGF levels in cell culture supernatants

Human breast carcinoma cells were cultured for 48 hr prior to analysis. VEGF-A and PlGF levels in the cell culture supernatants were assessed using ELISA Quantikine Kits (R & D Systems, Minneapolis, MN) per manufacturer's instructions and normalized to protein content equal to pg/106 cells/ml. Each sample was measured in duplicate.

Protein extraction and Western blotting

BT-474, DU4475, MCF-7 and MDA-MB-231 cells were seeded at a density of 5 × 105/dish in 100 × 20 mm2 petri dishes and cultured in serum-free medium for 18 hr. After replacing the culture medium, the cells were treated with 100 nM of mAb 6.12 or isotype control for 1 hr and then incubated with 50 ng/ml of VEGF-A or 100 ng/ml of PlGF for 10 min. After treatments, total cell protein extracts were isolated, immunoprecipitated and immunoblotted as described previously.25 For evaluation of MAPK and Akt phosphorylation, cell lyses were subjected to SDS-PAGE following electrotransfer. Membranes were incubated with antibodies against phosphorylated p44/p42 MAP kinases (Thr202/Tyr204; Cell Signaling Technology, Beverly, MA) or phosphorylated Akt (Ser473, Cell Signaling Technology, Beverly, MA), at a concentration of 1 μg/ml, followed by incubation with a secondary HRP conjugate (EMD Biosciences, San Diego, CA). To ensure equal loading of samples, membranes were stripped and reprobed with anti-p44/p42 (Cell Signaling Technology, Beverly, MA) or anti-Akt antibodies (Cell Signaling Technology, Beverly, MA). Proteins were detected using the ECL chemiluminescence system (Amersham Pharmacia Biotech, Piscataway, NJ), and quantified by densitometry using NIH Image (National Institute of Mental Health, Bethesda, MD).

Cell proliferation assays

DU4475 carcinoma cells were seeded at a density of 5 × 103/well into 96-well plates in serum-free conditions for 24 hr. For determination of stimulatory effect of growth factors on the tumor cells, the cells were incubated with VEGF-A (25–200 ng/ml) or PlGF (50–400 ng/ml) in 1 or 5% FCS containing RPMI1640 medium for additional 48 hr. To assess the inhibitory effect of anti-VEGFR-1 antibody on the tumor cell growth, the cells were incubated with mAb 6.12 at dose of 0.3, 1, 3, 10, 30 and 90 μg/ml in the presence of 50 ng/ml of VEGF-A or 200 ng/ml of PlGF for additional 48 hr. Viable cells were counted in triplicate using a Coulter cytometer (Coulter Electronics Ltd. Luton, Beds, England). Each experiment was done in triplicate. Following formula was used for calculation of percentages of the control. %Control = ((Tx − To)/(GC − To)) × 100. Tx, antibody-treated; To, untreated background; GC, growth control, i.e., VEGF-A or PlGF stimulated cell growth.

Treatment of human breast carcinoma xenografts

Athymic nude mice (Charles River Laboratories, Wilmington, MA) were injected subcutaneously in the left flank area with 2 × 106 of DU4475 cells or 5 × 106 of BT-474, MCF-7 and MDA-MB-231 cells mixed in Matrigel (Collaborative Research Biochemicals, Bedford, MA). For estrogen-dependent BT-474 and MCF-7 models, the mouse was implanted subcutaneously with a pellet containing 0.72 mg of 17-β-estradiol (Innovative Research of America, Sarasota, FL) 3 days prior to engraftment of tumor cells. Tumors were allowed to reach approximately 200 mm3 in size, and then, mice were randomized into groups of 10 animals per group. Animals received intraperitoneal administration of anti-human VEGFR-1 mAb 6.12 at a dose of 1 mg every 3 days or vehicle control. Anti-mouse VEGFR-1 mAb MF1 at the same dose was used in combination treatment with mAb 6.12 in the DU4475 tumor model. Treatment of animals was continued for the duration of the experiment. Tumors were measured twice each week with calipers. Tumor volumes were calculated using the formula [π/6 (w1 × w2 × w2)], where “w1” represents the largest tumor diameter and “w2” represents the smallest tumor diameter. All animal studies were conducted under approved IACUC protocols.

Immunohistochemical analysis of human breast xenografts

Paraffin-embedded BT-474, DU4475, MCF-7 and MDA-MB-231 xenografts were immunohistochemically stained with Ki-67 rabbit polyclonal antibody (pAb, 5 μg/ml; Lab Vision, Fremont, CA), phospho-specific p44/42 MAPK (Thr202/Tyr204) rabbit pAb (1 μg/ml; Cell Signaling Technology), phospho-specific AKT (Ser473) rabbit pAb (2 μg/ml; Cell Signaling Technology), followed by the EnVision+ System for rabbit antibodies (DAKO, Carpinteria, CA) per kit instructions. The peroxidase reaction was developed with DAB+ substrate per kit instructions. After brief counterstaining in Mayer's hematoxylin, all sections were dehydrated, cleared and coverslipped using a permanent mounting medium. Tumor apoptosis was assessed by TUNEL assay using in situ cell death detection kit (Roche Molecular Biochemicals, Indianapolis, IN), per kit instructions. Stained sections were coverslipped with Gelmount (Biomeda, Foster City, CA). Positive immunostaining and TUNEL positive immunofluorescence were analyzed and imaged using an Axioskop light microscope with an Axiocam digital camera (Zeiss, Thornwood, NY).

Statistical analysis

The difference of tumor volume and in vitro tumor cell growth rate were analyzed using Student's t-test. The difference of VEGFR-1 expression in cancer cells in tumor lesions between or among grade was analyzed using chi-square analysis. The statistic analysis was performed using the SigmaStat statistical package (v. 2.03; Jandel Scientific, San Rafael, CA). Differences of p < 0.05 were considered statistically significant.

Results

Specificity and binding and blocking activity of anti-VEGFR-1 antibodies

Anti-human VEGFR-1 neutralizing mAb 6.12 and a nonneutralizing mAb FB5 were raised from a human VEGFR-1 protein-immunized mouse. Anti-mouse VEGFR-1 neutralizing mAb MF-1 was raised from a rat immunized with mouse VEGFR-1 protein. Specificity of mAbs 6.12 and MF1 to human VEGFR-1 or mouse VEGFR-1 was reported previously.34 Binding assay indicated that the nonneutralizing anti-human VEGFR-1 mAb FB5 had a strong binding activity with human VEGFR-1 and a weak binding activity with mouse VEGFR-1 (data not shown). Flow cytometry analysis showed the binding activity of mAb 6.12 with surface expressed VEGFR-1 on PAE-VEGFR-1 transfectant cells (Fig. 1a). The antibody 6.12 displayed no binding activity with parental porcine aorta endothelial cells (data not shown). A similar result was observed with mAb FB5 in FACS (data not shown). Binding activity of anti-mouse VEGFR-1 neutralizing antibody MF1 with surface expressed VEGFR-1 on 4T1 tumor cells was demonstrated in flow cytometry where MF1 recognized VEGFR-1 on the cells and the binding activity was diminished by VEGF-A, confirming the specificity of MF1 to VEGFR-1 (Fig. 1b). Anti-human VEGFR-1 mAb 6.12 effectively blocked the binding of VEGF-A and PlGF to human VEGFR-1 with an IC50 of 0.6 and 0.3 nM, respectively (Figs. 1c and 1d). Anti-mouse VEGFR-1 mAb MF1 effectively blocked the binding of PlGF and VEGF-A to mouse VEGFR-1 with an IC50 of 0.1 and 0.3 nM, respectively (Figs. 1e and 1f). A control isotype-matched antibody did not interfere with the ligand binding to VEGFR-1.

Figure 1.

Specificity and blocking activity of the anti-VEGFR-1 mAbs. (a) The anti-human VEGFR-1 antibody 6.12 specifically binds to surface expressing VEGFR-1 on PAE-VEGFR-1 transfectant cells (open histogram). Gray histogram represents the staining with irrelevant isotype-matched IgG. (b) Anti-mouse VEGFR-1 antibody MF1 specifically binds to murine VEGFR-1 expressing 4T1 cells (green line histogram). The binding activity is diminished by VEGF-A (red line histogram). Anti-human VEGFR-1 mAb 6.12 effectively blocked the binding of VEGF-A (c) and PlGF (d) to human VEGFR-1. Anti-mouse VEGFR-1 mAb MF1 effectively blocked the binding of VEGF-A (e) and PlGF (f) to mouse VEGFR-1. A control isotype-matched antibody did not interfere with the ligand binding to VEGFR-1.

Expression of VEGF-A receptors in primary breast carcinoma tissue sections

We analyzed the pattern of VEGFR-1 expression in tissue sections of 65 cases of invasive ductal breast carcinomas and 18 cases of normal breast tissues. VEGFR-1 expression was detected on subsets of epithelial tumor cells in invasive ductal carcinoma in 15.4% of the cases studied, but was negative in the epithelial cells of normal breast tissues (data not shown). The staining pattern for VEGFR-1 expression in cancer cells was heterogeneous within the lesions analyzed (Fig. 2a,b). VEGFR-1 expression, in most cases, was detected on the tumor vascular endothelium (Fig. 2c). VEGFR-1 expression was also frequently detected on myoepithelial cells surrounding the intraductal tumor cells found within invasive carcinomas (Fig. 2d). These results suggest that VEGFR-1 expression in breast tumor cells, myoepithelial cells and tumor vascular endothelium may be indicative of malignant phenotype for invasive ductal carcinoma. Histology analysis indicates that the difference of VEGFR-1 expression in cancer cells between or among grades is not statistically significant (p > 0.4), suggesting that VEGFR-1 expression in ductal invasive breast carcinomas collected from different grades of 65 tumor samples may not be associated with invasiveness of disease. The correlation of VEGFR-1 expression with tumor grade is summarized in Table I.

Figure 2.

Subsets of ductal breast carcinoma cells express VEGFR-1. Frozen sections of human ductal breast carcinoma were immunostained with anti-VEGFR-1 mAb FB5. VEGFR-1 expression pattern was variable between different tumor samples. VEGFR-1 immunoreactivity was observed on subsets of tumor cells in invasive ductal carcinoma (a) and (b); Inset, isotype control). VEGFR-1 was detected on the tumor vascular endothelium in most breast ductal carcinoma specimens (c). VEGFR-1 immunoreactivity was observed in the myoepithelial layer surrounding intraductal tumor cells within invasive carcinomas (d). Original magnifications: 200×.

Table I. Correlation of VEGFR-1 Expression with Grade in Breast Carcinomas
GradeVEGFR-1
No. of lesionsNo. of positive (%)p-value*
  • *

    *p-value was calculated using χ2 analysis.

I30 (0) 
II326 (18.8)0.41 (vs. I)
III304 (13.3)0.49 (vs. I), 0.56 (vs. II)
Total6510 (15.4)0.63

VEGF-A, PlGF and VEGFR-1 are coexpressed by human breast carcinoma cell lines

VEGF-A, PlGF and VEGFR-1 expression were analyzed in 16 breast carcinoma cell lines. VEGF-A was expressed at the mRNA and protein levels in all cell lines tested (Table II). PlGF transcripts were detected in all cell lines, but PlGF protein was barely detectable in the supernatant collected from these cultured cell lines. VEGFR-1 mRNA was detected in 100% of the breast carcinoma cell lines (Table II). All cell lines were positive for cell surface expressed VEGFR-1 as examined by flow cytometry. Expression of the VEGFR-1 on the cell lines BT-474, DU4475, MCF-7 and MDA-MB-231 is shown in Figure 3a as a representative result. Figure 3b shows the mRNA expression of VEGFR-1 in 4 representative cell lines BT-474, DU4475, MCF-7 and MDA-MB-231. These results indicate that VEGFR-1 and its ligand VEGF-A are widely coexpressed in breast carcinoma cell lines.

Figure 3.

Gene and protein expression of VEGFR-1 in the breast carcinoma cell lines. (a) Surface expression of VEGFR-1 on breast carcinoma cells was detected by flow cytometry using anti-human VEGFR-1 mAb FB5 (gray histograms). Open histograms represent the staining with irrelevant isotype-matched IgG. Expression of VEGFR-1 on BT-474, DU4475, MCF-7 and MDA-MB-231 cell lines is shown as a representative result. Mean fluorescence intensity ratio for the VEGFR-1+ cells was summarized in Table I. B. VEGFR-1 gene expression. RT-PCR relative to genes of VEGFR-1 and β-actin were detected by RT-PCR, using the cDNA isolated from the breast carcinoma cancer cells. HUVEC was used for the positive control for VEGFR-1 expression. All breast carcinoma cell lines expressed comparable level of VEGFR-1 messenger RNA. A representative result with 4 cell lines is shown.

Table II. Analysis of VEGFR-1, VEGF and PLGF Expression in Human Breast Carcinoma Cell Lines
Cell LineVEGFR-1VEGFPlGF
FACSRT-PCRELISART-PCRELISART-PCR
  • ND, not determined.

  • 1

    MFIR, Mean fluorescence intensity ratio; MFIR indicates relative expression level of VEGFR-1 in the cells.

  • 2

    Value = pg/106 cells per ml.

DU447591+2502+<302+
AU5655+250+<30+
T-47D5+1000+<30+
MCF76+680+<30+
MDA-MB-2314+10,500+45+
MDA-MB-15711+526+<30+
MDA-MB-1753+150+<30+
MDA-MB-43511+250+<30+
MDA-MB-4686+429+<30+
MX-15+1,525+<30+
BT-4746+1,050+<30+
BT-483ND+350+<30+
HCC384+200+<30+
SKBR-37+500+<30+
UACC-812ND+410+<30+
ZR-75-112+900+<30+

VEGF and PlGF induce activation of downstream signalings in breast cancer cells

To address whether VEGF-A or PlGF stimulation induces VEGFR-1-mediated activation of downstream signaling pathways, the ligand-induced phosphorylation of p44/p42 MAP kinase and Akt was examined in BT-474, DU4475, MCF-7 and MDA-MB-231 cells. VEGF-A or PlGF stimulation induced phosphorylation of MAPK in MCF-7 cells (Fig. 4a). The ligand-induced MAPK activation was inhibited by treatment with the anti-VEGFR-1 mAb 6.12. Isotype-matched irrelevant IgG did not have effect on the MAPK activation. A high level of constitutive phosphorylation of MAPK was detected in BT-474, DU4475 and MDA-MB-231 cells and was not affected by either stimulation with exogenous VEGF-A and PlGF or treatment with anti-VEGFR-1 mAb 6.12 as shown in Figures 4b4d, respectively. VEGF-A and PlGF treatment markedly increased phosphorylation of Akt in BT-474 cells (Fig. 4b). The ligands-induced Akt activation in the cells was blocked by treatment with the anti-human VEGFR-1 mAb 6.12. Isotype-matched irrelevant IgG did not have effect on the Akt activation. Activation of Akt via VEGFR-1 stimulation was not induced by ligand stimulations in the MCF-7, DU4475 and MDA-MB-231 cells as shown in Figures 4a, 4c and 4d, respectively. These results suggest that the ligand-stimulated VEGFR-1 activation can induce subsequent MAPK or Akt downstream signaling cascades in certain breast tumor cell lines in low serum culture conditions.

Figure 4.

Ligands-induced activation of the downstream MAP kinase and Akt signaling pathways in breast carcinoma cells. (a) VEGF-A and PlGF induced an increase in p44/p42 MAPK phosphorylation in MCF-7 cells. Treatment with anti-VEGFR-1 mAb 6.12 inhibited the MAPK activation. A constitutive activation of p44/p42 MAPK phosphorylation was detected in BT-474 (b), DU4475 (c) and MDA-MB-231 (d) cells. Western blots were probed for phosphorylated p44/p42 MAPK (top) and reprobed with an antibody for total MAPK (second) in each panel. (b) Akt phosphorylation was increased by the treatment with VEGF or PlGF, and inhibited by anti-VEGFR-1 mAb 6.12 in the BT-474 cells. Akt phosphorylation was not altered in the presence of ligands and mAb 6.12 in MCF-7 (a), DU4475 (c) and MDA-MB-231 (d) cells. The activation status of Akt kinase was assessed using an Akt phospho-specific antibody (third) and total Akt levels were evaluated using an anti-Akt antibody (4th) in each panel.

VEGF-A and PlGF induce in vitro proliferation of breast cancer cells

To assess growth of breast cancer cells in response to ligand stimulation, the suspension DU4475 cell line was selected for proliferation assay. The tumor cells were cultured in serum-free medium for 24 hr and then treated with exogenous VEGF-A or PlGF for additional 48 hr. Stimulation with VEGF-A or PlGF resulted in a dose-dependent increase in DU4475 cell proliferation (data not shown). Treatment with the neutralizing anti-human VEGFR-1 mAb 6.12 for 72 hr significantly inhibited either VEGF-A or PlGF stimulated proliferation of DU4475 carcinoma cells in dose response (Figs. 5a and 5b). An IgG isotype control did not show inhibitory effect on cell proliferation. The inhibitory effect of anti-VEGFR-1 mAb was not observed in the assay where the cells were cultured in medium containing serum greater than 5% (data not shown), likely due to lack of effect of the mAbs on the stimulation of the tumor cells induced by other growth factors in high concentration serum.

Figure 5.

Inhibition of VEGF-A and PlGF-induced proliferation of VRGFR-1 expressing breast tumor cells. An increase in proliferation was induced when DU4475 tumor cells was stimulated with ligands (open diamond) VEGF-A (a) or PlGF (b). Treatment with anti-VEGFR-1 mAb 6.12 (closed diamond) significantly inhibited VEGF-A (a) and PlGF (b) stimulated proliferation of DU4475 tumor cells in a dose response compared to control antibody treatment (closed triangle). Growth of cells untreated with ligands and antibodies (open square) represents basal activity. Data are represented as percentage change of the number of antibody-treated cells versus the control as described in the Methods. Asterisks indicate statistic significance (p < 0.005) of the difference in percent inhibition of cells treated with mAb 6.12 and mAb control. This is a representative experiment of 3 with similar results.

Inhibition of VEGFR-1 by a specific mAb suppresses in vivo growth of human xenograft breast carcinomas

To evaluate the functional role of VEGFR-1 on the breast cancer cells in vivo, we performed xenograft studies with neutralizing anti-human VEGFR-1 mAb 6.12 to test whether VEGFR-1 blockade prevent the growth of VEGFR-1 expressing human breast tumors established in athymic mice. Systemic administration of mAb 6.12 at a dose of 1 mg/mouse every 3 days led a statistically significant (p < 0.05) suppression of the growth of DU4475, BT-474, MCF-7 and MDA-MB-231 tumor xenografts (Table III, Figs. 6a6d). These results demonstrate that blockade of the VEGF-A/VEGFR-1 signaling pathway in VEGFR-1 positive breast carcinoma cells can lead to a significant inhibition of breast tumor growth. The antitumor effects are likely in part due to inhibition of activation of p44/42 MAP kinase or Akt signaling by the anti-human VEGFR-1 mAb 6.12 as observed in histology analysis of tumor sections of the treated xenografts.

Figure 6.

Inhibition of the growth of xenografts of VEGFR-1 expressing human breast tumor cells. (a)–(d) Athymic nude mice bearing established breast tumor xenografts of DU4475 (a), BT-474 (b), MDA-MD-231 (c) and MCF-7 (d) were administered with anti-human VEGFR-1 mAb 6.12 (closed circle) at dose of 1 mg/dose × 3 per week when average tumor size reached ∼200 mm3. Mice in control groups (opened circle) were injected with vehicle (PBS). The antibody-mediated blockade of VEGFR-1 significantly suppressed the growth of all human breast tumor xenografts. p-Values and % T/C are summarized in Table II. E, Combined treatments with 1 mg/dose of anti-human VEGFR-1 mAb 6.12 and anti-mouse VEGFR-1 mAb MF1 (closed triangle) resulted in a more potent antitumor effect compared to either mAb 6.12 (closed circle) or MF1 (closed square) alone. Single asterisk indicates statistic significance (p < 0.05) when comparing treatment with antibody to control. Double asterisks indicate statistic significance (p < 0.05) when comparing dual antibody treatment to treatment with either antibody alone. (f) Treatment with mAb 6.12 and MF had a comparable efficacy in mice bearing 200 mm3 (closed circle) and 1200 mm3 (closed triangle) established tumors. Treatment of mice bearing 4000 mm3 (closed diamond) tumors with both anti-human and mouse VEGFR-1 mAbs induced a tumor remission. Arrows indicate initiation of the treatment. Data represent 1 of 2 individual experiments. Bar: Mean ± SEM.

Table III. Summary of Tumor Growth Inhibition with Anti-VEGFR-1 mAb 6.121
XenograftNo. of mice/group% T/C2 (day)p-value
  • 1

    Anti-VEGFR-1 mAb 6.12 was administered i.p. at 1 mg/dose every 3 days.

  • 2

    Percentage of tumor growth inhibition, where T is the mean tumor volume of treated group and C is the mean tumor volume of control group on the designated day.

DU44751032 (26)<0.001
MDA-MB-2311046 (49)<0.02
BT-4741047 (52)<0.05
MCF-71062 (49)<0.05

In vivo blockade of human and murine VEGFR-1 leads to regression of human breast carcinoma xenograft

To assess the antitumor effects of dual blockade of host (mouse) VEGFR-1, thereby blocking endogenous hemangiogenesis, and VEGFR-1 present on human breast tumor cells in vivo, neutralizing anti-human VEGFR-1 mAb 6.12 and anti-mouse VEGFR-1 mAb MF1 were concomitantly given to mice bearing DU4475 breast carcinoma xenografts. Combination treatment with mAbs 6.12 and MF1 at a dose of 1 mg/mouse every 3 days resulted in an increased antitumor activity than that of either treatment alone (Fig. 6e). The difference between dual antibody treatment and treatment with either antibody alone is statistically significant (p < 0.05). Moreover, regressions of established tumors of 4000 mm3 were observed after combination treatment with mAbs 6.12 and MF1 (Fig. 6f). These data suggest that the anti-VEGFR-1 therapy may directly interfere with autocrine ligand stimulation of the VEGFR-1 expressing tumor cells in addition to disrupting tumor vascularization, thereby resulting in more effective antitumor effects in vivo.

Anti-human VEGFR-1 treatment inhibits in vivo signaling of MAPK and Akt, and induces tumor cell apoptosis

To further analyze the effects of anti-human VEGFR-1 mAb 6.12 treatment on intracellular activity in breast tumor xenografts, cellular proliferation (Ki-67), apoptosis (TUNEL), phospho-specific p44/42 MAP kinase and Akt were examined by immunohistochemistry on the treated xenograft tumors. As shown in Figure 7a, activity of proliferative molecule Ki-67 was significantly reduced in the mAb 6.12 treated BT-474, MCF-7, and MDA-MB-231 tumor tissues, but such inhibitory effect was less pronounced in treated DU4475 tumors. Furthermore, anti-VEGFR-1 mAb treatment resulted in a markedly decreased activation of downstream p44/p42 MAP kinases signaling in tumor cells in all treated xenograft tumors (Fig. 7b). A significant decrease in Akt phosphorylation was detected in the mAb 6.12 treated BT-474 tumors in addition to an increase in apoptosis as measured by TUNEL positive events (Fig. 7c). These results suggest that the antitumor effects of anti-VEGFR-1 mAb treatment on human breast tumor xenografts is at least in part due to the disruption of cellular proliferation and survival signaling mechanisms specifically mediated by this receptor in breast cancer cells.

Figure 7.

Inhibition of intracellular activity and signaling activation in treated tumor xenografts. BT-474, DU4475, MCF-7 and MDA-MB-231 breast tumor xenografts treated with anti-VEGFR-1 mAb 6.12 were immunohistochemically stained with polyclonal antibodies specific for proliferation marker Ki-67 (a) and phospho-specific p44/42 MAP kinase (b). Activities of Ki-67 molecule and phospho-p44/42 MAP kinase were significantly reduced in tumor cells in the xenografts treated with mAb 6.12 compared to controls, expect for insignificant reduction of Ki-67 activity in DU4475 xenografts. (c) BT-474 xenografts were evaluated for apoptosis by TUNEL assay and Akt activation by staining with anti-phospho-Akt specific antibody. Increased apoptosis and reduced Akt activation were found in tumor cells in the antibody treated xenografts. Original magnifications: 200×.

Discussion

The recent success of “antiangiogenic” strategies to treat human cancers has opened up new avenues of research to improve the therapeutic outcome of existing therapies. Recently, a neutralizing mAb to VEGF-A was shown to improve clinical outcome in colorectal cancer patients when used in combination with existing chemotherapeutic regimens.35, 36 However, the complex expression pattern of VEGF-A and its receptors within the tumor and other host tissues have raised important questions related to the precise mechanism whereby antiangiogenic agents exert their antitumor or “antivascular” effect.

The angiogenic factor VEGF-A promotes tumor angiogenesis primarily through activation of VEGFR-1 and VEGFR-2 signaling pathways in endothelial cells. VEGFR-2 expression is primarily restricted to endothelial cells. In contrast, functional VEGFR-1 expression is found not only on endothelium, but also in other normal cell types, such as various hematopoietic lineages and smooth muscle cells.9, 10, 11, 12, 13 In addition, VEGFR-1 expression has been detected on certain tumor cells, such as leukemias, melanoma, nonsmall cell lung carcinoma, prostate carcinoma and breast carcinoma.22, 23, 24, 25, 26, 27, 28 The significance of this observed expression has not been studied. Therefore, it is conceivable that angiogenic factors support tumor growth not only by inducing angiogenesis, but also by acting directly through VEGFR-1 expressed on the tumor cells. Here, we provide the first demonstration of VEGFR-1 expression on breast cancer cells in situ and VEGFR-1 activation in tumor cells contributing to tumor growth in preclinical models. Using neutralizing mAb that selectively targets human but not murine VEGFR-1, we demonstrate that inhibition of VEGFR-1 is effective in blocking tumor growth in established breast tumor xenografts. Furthermore, interference with the murine VEGFR-1 signaling by using selective antimurine VEGFR-1 mAb in combination with mAb specific for human VEGFR-1 had an additive effect in diminishing tumor growth and angiogenesis. Collectively, these data introduce the novel concept that antiangiogenic agents may target vascular and nonvascular targets within subsets of the breast cancers. Since the vast majority of solid tumors and a variety of hematologic malignancies have the capacity to express VEGF-A, expression of VEGFR-1 by tumor cells implicates a potential role for VEGF-A/VEGFR-1 autocrine loops in these tumors in addition to the paracrine loops in the stroma and endothelium. Consistent with this hypothesis, recent studies have shown that for certain leukemias VEGFR-1 may be essential for tumor cell growth by promoting a VEGF-A/VEGFR-1 autocrine loop, that when disrupted induces tumor growth arrest and apoptosis.25, 27 In breast cancer cell lines, reports have demonstrated an increase in survival and mitogenic signals promoted by VEGF-A, but the receptor and mechanisms responsible for this observed activity have not been fully characterized.28, 37, 38

Considerable experimental evidence has linked signaling through VEGFR-2 to mitogenesis, migration, survival and permeability in endothelial cells. Activation of PLC γ, focal adhesion kinase, MAPK and Akt pathways downstream of VEGFR-2 activation are all strongly implicated in mediating these diverse cellular processes.39, 40 In contrast, VEGFR-1 has been reported to be markedly less effective in mediating such functions, and the signaling pathways downstream of VEGFR-1 activation are less clearly understood. VEGFR-1 has been implicated as an inert “decoy” receptor by some studies or as a negative regulator of VEGFR-2 signaling in endothelial cells.17, 41 This inhibitory effect has been shown to be mediated through a PI-3K-dependent Rac1 and CDC42 pathways.42 In addition, studies have shown that the juxtamembrane region of VEGFR-1 prevents key signaling functions in endothelial cells.16 In contrast, other studies have shown that VEGFR-1 plays a significant role in certain conditions of pathological angiogenesis.20, 21 Our results suggest that VEGFR-1 activation promotes proliferation and survival signals through the MAPK and Akt pathways in breast tumor cells, activities that are uniquely different from those induced in endothelial cells. These findings raise the possibility that VEGFR-1 activation may elicit mitogenic and/or survival signals, which are cell-type specific, and that are distinctly different from those observed in endothelial cells. Alternatively, it is possible that other, as yet unidentified membrane bound or intracellular mediators of VEGFR-1 signaling are present in subsets of breast tumor cells.

Our findings are consistent with a number of studies showing that VEGF-A can be a survival factor for breast tumor cells. In previous studies, Price and colleagues demonstrated that VEGF-A stimulation induced the intracellular signaling of p44/42 MAP kinase and PI 3-kinase/Akt pathways in T-47D breast cancer cells and in vitro invasion of the tumor cells.28 Bachelder et al. demonstrated a role for VEGF-A in the survival and invasive potential of human breast tumor cell lines in vitro.38 VEGF-mediated survival of breast tumor cells was found to be regulated through an Akt-dependent signaling pathway in these studies; however, the VEGF receptor responsible for this survival signal was not identified. More recent studies have suggested that VEGF-A regulated expression of the chemokine receptor CXCR4 is essential for breast tumor cell migration, but not for tumor cell survival.43 Interestingly, expression of neuropilin-1 (NP-1), but not VEGFR-1, was identified as essential for this function. A study has suggested that VEGF-A and NP-1 pathway may promote progression of lung cancer through facilitating VEGF receptor activation and delocalization of NP-1 ligand SEMA3F in lung cancer cells.44 Notably, we have observed coexpression of VEGFR-1 and NP-1 in all breast tumor cell lines examined (data not shown). It will be of interest to determine in future studies whether cooperative signaling mechanisms between VEGFR-1 and NP-1 play a role in diverse signaling pathways in breast tumor cells.

Our in vitro observations were extended to studies of several human VEGFR-1 expressing breast carcinoma xenograft models. In these studies, treatment with anti-human VEGFR-1 neutralizing mAb 6.12 resulted in significant suppression of breast tumor growth. Histological examination of tumor xenografts revealed extensive tumor necrosis suggesting that anti-VEGFR-1 treatment in these models was not merely cytostatic, but that therapy also inflicted significant tumor cell death. Histological analysis of 6.12-treated breast tumor xenografts showed a marked reduction of tumor cell proliferation, activated p44/42 MAPK and Akt, and an increase in apoptosis. These findings suggest that the efficacy of anti-VEGFR-1 treatment involves the disruption of both growth and survival signaling mechanisms specifically mediated by VEGFR-1 in breast cancer cells. It should be noted, however, that VEGFR-1 therapy did not completely inhibit tumor growth in any of the models tested. In this regard, it will be of interest in future studies to determine whether combined anti-VEGFR-1 treatment with anti-VEGFR-2 agents or cytotoxic agents will enhance the efficacy of VEGFR-1 therapy.

The anti-VEGFR-1 neutralizing mAb 6.12 used in these studies is specific for human VEGFR-1 and does not crossreact with mouse VEGFR-1.34 To recapitulate dual blockade of VEGFR-1 on breast tumor cells and host (mouse) tumor vasculature, we performed in vivo studies using a murine VEGFR-1 specific neutralizing mAb (MF1) that was previously showed to inhibit tumor angiogenesis.21 Blockade of both the endothelial cell-dependent VEGFR-1 pathway on tumor vasculature (MF1) and the endothelial cell-independent VEGFR-1 loop on the breast tumor cells (6.12) resulted in an enhanced antitumor effect. This observation is consistent with previous evidence demonstrating that VEGFR-1 is expressed by the tumor vasculature and involved in pathological angiogenesis.21, 22 Moreover, the presence of VEGFR-1 on inflammatory cells such as monocytes and hematopoietic progenitor and stem cells, suggests that these cells may be recruited specifically to sites of neovascularization, where they can contribute to the process of angiogenesis through MMP-9 release.45 We and others have shown that incorporation of VEGFR-1-positive myeloid cells contributes to the growth of xenotransplanted murine lymphomas and lung cancer.11 However, it remains to be determined whether inhibition of mobilization and incorporation of VEGFR-1 positive inflammatory cells play a role in the growth of breast cancer cells. Nonetheless, combination therapy against both human and mouse VEGFR-1 resulted in a greater antitumor effect, even in models of established breast tumors. Additional studies will be necessary to specifically address the contribution of VEGFR-1+ tumor endothelium versus VEGFR-1+ bone marrow-derived myeloid progenitors on the growth of solid tumors. Nevertheless, the effects of both anti-human and anti-mouse VEGFR-1 treatments would inhibit different components of a growing tumor, acting as an antiangiogenic therapy by affecting the tumor vasculature and directly as an antitumor therapy, demonstrating the relevance of specifically targeting growth factor/receptor tyrosine kinase pathways on different cell types in human cancer.

In conclusion, we have demonstrated a functional role for VEGFR-1 in the subsets of human breast carcinoma cells, and that specific blockade of this receptor by a neutralizing mAb can significantly suppress the growth of breast tumor cells in vitro and in vivo. These studies provide further insight into the contribution of the VEGF-A/VEGFR pathways in human cancers beyond their role in tumor vasculature. This observation supports further evaluation of a targeted approach to therapy of subsets of breast carcinoma with novel inhibitors of VEGFR-1.

Acknowledgements

We thank following coworkers Rajiv Bassi, Bridget Finnerty and Huiling Li for their excellent technical assistance. Shahin Rafii was supported by National Institutes of Health (NHLBI), American Cancer Society and Leukemia and Lymphoma Society of America.

Ancillary