SEARCH

SEARCH BY CITATION

Keywords:

  • insulin-like growth factor;
  • insulin-like growth factor binding protein 3;
  • Ewing's sarcoma

Abstract

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The IGF/IGF-IR system plays a major role in the pathogenesis and progression of Ewing's sarcoma. In this article, the authors evaluated whether the insulin-like growth factor binding protein-3 (IGFBP-3), a molecule with growth-inhibitory and proapoptotic activities, may be exploited for therapeutic applications in the treatment of Ewing's sarcoma (EWS). Expression of IGFBP-3 was analyzed in a panel of EWS cell lines and clinical samples. Parameters related to malignancy (growth in anchorage-independent conditions, migration, invasion and angiogenesis properties) were studied to establish the potential in vitro anticancer effects of exogenous IGFBP-3. The activity of the molecule against metastasis was analyzed by taking advantage of selected clones in which IGFBP-3 endogenous production was induced by gene transfection. The authors observed a generally low expression of IGFBP-3 either in a panel of EWS cell lines or clinical samples. Exogenous IGFBP-3 remarkably inhibits EWS growth, both in monolayer and anchorage-independent conditions, and significantly reduces cell motility. Forced expression of IGFBP-3 in TC-71 EWS cells confirms the growth and migratory effects observed with the exogenous protein, decreases the production or activity of the matrixmetalloprotease MMP-9 and vascular endothelial factor (VEGF)-A and abrogates EWS metastasis ability. IGFBP-3 acts mainly through IGF-dependent mechanisms and the protein may therefore represent an alternative strategy to inhibit IGF-IR functions. The data indicate IGFBP-3 as a molecule of therapeutic potential in EWS. © 2006 Wiley-Liss, Inc.

There is compelling evidence that the IGF/IGF-IR system plays a major role in human neoplasia, and interfering with the IGF-signaling system may be an attractive strategy for the treatment of some human cancers, including EWS.1, 2 The biological functions of IGFs are initiated by their interaction with cell surface receptors, in particular the IGF-I receptor (IGF-IR).3, 4 In addition, IGF-signaling is also influenced by the IGF-binding proteins (IGFBPs) that modulate the bioavailability and bioactivity of the IGFs. The IGFBP family contains at least 6 high affinity members with variable functions and mechanisms of action. IGFBP-3 is the most abundant IGFBP in postnatal serum and has been shown to be a growth inhibitory, apoptosis-inducing molecule, capable of acting via IGF-dependent and IGF-independent mechanisms.5, 6 In particular, IGFBP-3 in serum forms a 150 kDa complex with acid-labile subunit and IGF-I or IGF-II, thus prolonging their half-life and regulating the distribution of IGFs and their endocrine actions. Locally produced IGFBP-3 acts as an autocrine/paracrine regulator of IGFs. IGFBP-3 has affinities for IGFs that are equal to or stronger than those of the IGF receptors and, therefore, inhibits the IGFs by sequestration in the extracellular compartment and preventing their interaction with IGF-IR. In addition, IGF-independent actions, including growth inhibition, apoptosis and sensitization to radiation and chemotherapeutic agents,5, 6 as well as successful in vivo treatment of cancer models with IGFBP-3 were reported.7, 8 Thus, these experimental evidences, together with epidemiological studies that correlated the level of IGFBP-3 with the risk to develop cancer,9, 10, 11 indicate IGFBP-3 as an anticancer molecule with potential therapeutic relevance.

Both the presence of active IGF-IR and the autocrine production of IGF-I have been observed in EWS cells12 and, although several other growth factor circuits are involved in deregulated EWS tumor cell growth,13, 14, 15 the contribution of the IGF-I/IGF-IR circuit to the malignant behavior of EWS cells has been clearly identified to be of major importance. IGF-IR is implicated in the autocrine and paracrine control of EWS growth and appears to be particularly relevant for the pathogenesis of this tumor.16, 17 Indeed, EWS/FLI1, the chimeric product of the t(11;22) translocation, which is the genetic hallmark of EWS, was found to have transformation abilities only in the presence of IGF-IR.17 More recently, Prieur et al.18 showed that EWS/FLI-1 can bind the IGFBP-3 promoter in vitro and in vivo and can repress its activity, and also demonstrated that IGFBP-3 can overcome the effects of expressing EWS/FLI-1, further supporting the impairment of IGF signaling system as a key event in the development of EWS. As a consequence, inactivation of IGF-IR reduces growth, increases apoptosis and sensitivity to conventional chemotherapeutic agents both in vitro and in vivo and decreases migration, invasion and metastatic spread of EWS cells to the bones.1, 2, 19, 20, 21 In our study, we explore the functions of exogenous IGFBP-3 in EWS cells and its potential for therapeutic applications in the control of this tumor.

Material and methods

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Cell lines

A panel of 21 EWS cell lines was analyzed. The SK-ES-1, SK-N-MC and RD-ES were obtained from the American Type Collection (Rockville, MD). The TC-71 and 6,647 cell lines were kindly provided by T. J. Triche (Children's Hospital, Los Angeles, CA). Seven of the EWS cell lines here considered (LAP35; IOR/BRZ; IOR/CAR; IOR/NGR; IOR/RCH; IOR/BER; IOR/CLB) were obtained at the Laboratorio di Ricerca Oncologica, Istituti Ortopedici Rizzoli, Bologna, Italy, and previously characterized.22 The WE-68, RM-82, NT-68, VH-64, MM-83, JS-72, TC-83 AH EWS cell lines were kindly provided by F. Van Valen (Klinik und Poliklinik fur Allgemeine Orthopadie, Universitatsklinikum Munster, Germany). The H825 and H1474 EWS cell lines were obtained from the Department of Pathology, University of Valencia, Spain, and kindly provided by Dr. A. Llombart-Bosch. Cells were routinely cultured in Iscove's modified Dulbecco's medium (IMDM) supplemented with 20 U/ml penicillin, 100 μg/ml streptomycin (Sigma, St. Louis, MO) and 10% heat-inactivated fetal bovine serum (FBS) (Biowhittaker Europe, Verviers, Belgium). Cells were maintained at 37°C in a humidified 5% CO2 atmosphere.

Cell transfection

Stable transfectants expressing IGFBP-3 were obtained from TC-71 cells by using calcium–phosphate transfection method. The IGFBP-3 expression vector was a kind gift from Dr. Youngman Oh, University of Richmond, VA. Cells transfected with the empty vector pcDNA3 were also used as negative control. The TC-IGFBP-3 transfectants were selected and cultured in IMDM containing 10% FBS and 500 μg/ml neomycin (Sigma).

Patients

Serum samples were obtained from a total of 29 EWS patients for the study. All the serum samples were from previously untreated patients with primary EWS. The histology of the primary tumors was reviewed by a pathologist to confirm the original diagnosis. Serum were conserved at −20°C. All patients provided written informed consent according to the local investigational review board requirements.

Reverse transcription polymerase chain reaction

Reverse transcription polymerase chain reaction (RT-PCR) was performed to verify the expression of fusion transcription products in EWS cell lines. Total RNA was extracted by TRIzol extraction kit (Invitrogen Ltd., Paisley, UK) and the quality of the RNA samples was determined by electrophoresis. PCR was performed with a 60°C annealing temperature and for 35 amplification cycles. Specific primer pairs used are as follows: for β-actin, forward primer is 5′-CGA GCGGGAATCGTGCGTGACATTAAGGAGA-3′ and reverse primer 5′-CGTCATACTCCTGCTTGCTGATCCACATCTGC-3′; for EWS-FLI-1 translocation, forward primer is 5′-TCCTACAGCCAAGCTCCAAGTC-3′ and reverse primer 5′-ACTCCCCGTTGGTCCCCTCC-3′; for EWS-ERG translocation, forward primer is 5′-TCCTACAGCCAAGCTCCAAGTC-3′ and reverse primer is 5′-CATAGTAGTAACGGAGGGCGC-3′.

Quantitative real-time RT-PCR

TaqMan primers and probes for the quantitative detection of human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed by using Primer Express software (Applied Biosystems, Foster City, CA) as follows (all 5′ to 3′ direction): forward GAAGGT GAAGGTCGGAGTC, reverse GAAGATGGTGATGGGATTTC, probe: FAM-GAA GCTTCCCGTTCTCAGCC. IGFBP-3-specific primers and probe were purchased by Applied Biosystems (Ref. Seq. NM_000598). Universal Master Mix (Applied Biosystems) was used with 10 ng of cDNA and with 200 nM of primers for the evaluation of GAPDH and IGFBP-3 expression, respectively. Negative controls without cDNA template were run with each assay. All PCR reactions were performed by using ABI PRISM 7900 Sequence Detection System (PE Applied Biosystems). All samples were run in triplicate at the following conditions: 95°C for 10 min, followed by 40 cycles at 95°C for 15 sec and 60°C for 1 min. The target gene mRNA is quantified by measuring CT to determine the relative expression. Data were normalized to GAPDH. The relative mRNA expression of IGFBP-3 was also normalized to a calibrator, consisting of the TC-71 mRNA, and was expressed as: 2−ΔΔCT, where ΔCT = CT target genes − CT GAPDH, and ΔΔCT = ΔCT sample − ΔCT calibrator.

IGFBP-3 and VEGF-A ELISA assay

A total of 20,000 cells/cm2 were seeded in IMDM 10% FBS. After 24 hr, the medium was changed with IMDM 10% FBS to detect IGFBP-3 or IMDM 1% FBS for VEGF-A. After 48 hr and 72 hr, supernatants were collected and the production of IGFBP-3 or VEGF-A were measured by using the human VEGF ELISA kit (BIOSOURCE, Camarillo, CA) or the Quantikine human IGFBP-3 immunoassay (R & D System, Minneapolis, MN), according to manufacturer's instructions. Culture medium (IMDM 10% or 1% FBS, respectively) was also analyzed and used as blank control. To detect IGFBP-3 production in Ewing' sarcoma patients, serums from 29 patients were collected and quantified as described above. Normal serum values were reported in the kit and used as controls.

In vitro cell growth

IGFBP-3 was provided by Sigma. A panel of 6 Ewing' sarcoma cell lines were seeded at the density of 20,000 cells/cm2. After 24 hr, medium was replaced by IMDM plus 10% FBS or 1% FBS with or without (control) various concentrations of IGFBP-3 or the recombinant protein mutated at the nuclear localization signal BP-3NLS24 (100, 300, 500, or 1,000 ng/ml) for up to 3 days; BP-3NLS was provided by Mattel Children's Hospital at UCLA, David Geffen School of Medicine at UCLA, Los Angeles, CA. The effects of the compounds were tested in the presence or absence of 50 ng/ml IGF-I (Upstate, Charlottesville, Virginia) or the analogue of IGF-I with low affinity to bind IGFBP-3 Des-(1-3)-IGF-I (Immunological and Biochemical Testsystem GmbH, Reutlingen, Germany). The effects of the neutralizing monoclonal antibody (MAb) anti-IGF-IR αIR3 (0.1 μg/ml) (Calbiochem, St. Diego, CA) were also evaluated in the same conditions. The growth ability of TC-IGFBP-3 clones was tested at 24–96 hr after cell seeding. Cell growth was evaluated on harvested cells by Trypan blue vital cell count.

Cell cycle analysis

A total of 20,000 cells/cm2 were seeded in IMDM plus 10% FBS. A day later, medium was changed in IMDM plus 10% FBS with IGFBP-3 (500 ng/ml). After 24–72 hr of treatments, cell cultures were incubated with 10 μM bromodeoxyuridine (BrdUrd) (Sigma) for 1 hr in CO2 atmosphere at 37°C. Harvested cells were fixed in 70% ethanol for 30 min. After DNA denaturation with 2 N HCl, 1 × 106 cells were processed for indirect immunoflouresence staining using α-BrdUrd MAb diluted 1:4 as a primary antibody (Becton Dickinson, San Jose, CA), and analyzed by flow cytometry (FACSCalibur, Becton Dickinson). For the analysis of DNA content, cells were fixed with cold 70% ethanol, treated with 0.5 mg/ml RNase and stained with 20 μg/ml propidium iodide.

Analysis of apoptosis

Detection and quantification of apoptotic cells was obtained by the flow cytometric analysis of annexin-V-FITC-labelled cells. This test was performed according to the manufacturer's instructions (Medical & Biological Laboratories, Naka-ku Nagaya, Japan).

Soft-agar assay

Anchorage-independent growth was determined in 0.33% agarose (SeaPlaque; FMC BioProducts, Rockland, ME) with a 0.5% agarose underlay. Cell suspensions (cells/60-mmΦ dish: 3,300–10,000 for TC-71, TC-IGFBP-3 clones and SK-N-MC; 33,000−100,000 for LAP-35 cell lines) were plated in a semisolid medium (IMDM plus 10% or 1% FBS containing 0.33% agarose) with or without IGFBP-3 (500 ng/ml). Dishes were incubated at 37°C in a humidified atmosphere containing 5% CO2, and colonies counted after 7–10 days.

Motility assay

Motility assay was performed using Transwell chambers (Costar, Cambridge, MA) with 8-μm pore size, polyvinylpyrrolidone-free, polycarbonate filters (Nucleopore, Pleasanton, CA); 105 cells of TC71 or TC-IGFBP-3 clones in IMDM plus 1% FBS were seeded in the upper compartment, whereas IMDM plus 10% FBS was placed in the lower compartment of the chamber. The number of cells that migrated toward the filter to reach the lower chamber base was counted after fixation and Giemsa staining. To analyze the migratory inhibitory effects of IGFBP-3, TC-71 cells were incubated with 500 ng/ml of IGFBP-3 or BP-3NLS in the presence or absence of IGF-I or Des-(1-3)-IGF-I (50 ng/ml) for 18 hr at 37°C. Cell vitality evaluated by Tripan blue cell count was more than 90%.All the experiments were performed in triplicate.

Matrix metalloproteinase-9 activity

Matrix metalloproteinase (MMP)-9 activity was evaluated on semiconfluent TC-71 cells treated with or without IGFBP-3. Cell supernatants were concentrated with Centricon Plus-20 centrifugal filter devise provided with an ultrafiltration membrane with a 30,000 nominal molecular weight cutoff limit (Millipore Corporation, Bedford, MA). MMP-9 activity was determined by the ELISA test Biotrak MMP-9 activity assay systems (Amersham Pharmacia Biotech, Milan, Italy). The test was performed according to the manufacturer's instructions.

Metastatic ability in athymic mice

Female athymic 4- to 5-week-old Crl:C-1-nu/nu BR mice (Charles River Italia, Calco, Lecco, Italy) were used. Metastatic ability was determined after i.v. injection of 2 × 106 TC-71 or TC/BP3 transfected cells. Mice were checked once a week to verify development of bone metastases. The experimental procedures were approved by the local ethical committee.

Statistical analysis

Differences among means were analyzed using Student's t-test. Fisher's exact test was used for frequency data.

Results

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Expression and production of IGFBP-3 in cell lines and clinical samples

We observed a generally low expression of IGFBP-3 either in a panel of cell lines or clinical samples. Among the 21 EWS cell lines considered here, only 3 EWS cell lines showed a high expression and production of the protein (Fig. 1a, b). The serum of 29 EWS patients revealed a range of values similar or lower than that of controls (Normal range: 835–3089 ng/ml; EWS serum: 1088–3431 ng/ml). No remarkable differences were observed among EWS samples that carry an EWS/FLI1 type I fusion product and those expressing EWS/FLI1 type II or EWS/ERG hybrid transcripts. No statistical correlation was observed between IGFBP-3 serum level and clinical outcome.

thumbnail image

Figure 1. Expression of IGFBP-3 in a panel of 21 EWS cell lines carrying different chromosome translocations and relative hybrid transcripts. (a) IGFBP-3 mRNA relative expression, expressed as 2−ΔΔCT, evaluated by Quantitative Real Time RT-PCR. The breast cancer cell line MCF7 was used as control and calibrator (2 −ΔΔCT = 1). Results represent the mean (SE of duplicate experiments. (b) IGFBP-3 production in cell supernatants of the EWS cell lines after 72 hr of in vitro culture. Results represent the mean ± SE of duplicate experiments.

Download figure to PowerPoint

Exogenous IGFBP-3 inhibits EWS cell growth by an IGF-dependent mechanism

Using the EWS cell line TC-71 as a model, which does not express IGFBP-3, we evaluated the in vitro growth effects of exogenous IGFBP-3. The addition of the molecule induced a dose-dependent growth inhibition of TC-71 cells either in low serum medium or in standard conditions (Fig. 2a). Similar inhibitory effects were also observed in other EWS cell lines, both in monolayer and in soft-agar conditions, confirming the therapeutic potential of this strategy (Fig. 2b, c).

thumbnail image

Figure 2. Effects of exogenous IGFBP-3 in EWS cells growth. (a) Inhibition of TC-71 cell growth after 72 hr treatments with different doses of IGFBP-3 (100–1000 ng/ml) in low (1%) and standard (10%) serum condition. Results represent the mean ± SE of triplicate experiments. (b) In vitro sensitivity of 6 EWS cell lines to IGFBP-3 (500 ng/ml). Results represent the mean ± SE of triplicate experiments. (c) Anchorage-independent growth inhibition. Results represent the mean SE of triplicate experiments. *, p < 0.05, Student's t-test, compared to controls.

Download figure to PowerPoint

The proliferative action of IGF-I was attenuated in the presence of 100 ng/ml of IGFBP-3 and completely abolished starting from the dose of 300 ng/ml, as shown in Fig. 3a. A similar pattern was observed after the exposure of cells to a standard IGFBP-3 concentration (300 ng/ml) and increased doses of IGF-I (10–250 ng/ml) (Fig. 3b). Since IGFBP-3 is capable of acting via IGF-dependent and IGF-independent mechanisms, we tested which mechanisms are involved in EWS cells by using desIGF-I, an analogue of IGF-I showing similar affinity for IGF-IR but reduced ability to bind IGFBP-3, and a neutralizing antibody directed against IGF-IR (αIR3 MAb 0.1 μg/ml). As expected, both IGF-I and desIGF-I induced a similar increase in cell proliferation, whereas the neutralizing antibody showed a reduction in cell growth that was reverted by exposure to IGF-I or desIGF-I (Fig. 3c). With respect to IGFBP-3 effects, IGF-I did not revert the growth inhibition due to IGFBP-3, whereas desIGF-I completely overcomes this effect, supporting an IGF-dependent mechanism. In addition, when cells were simultaneously exposed to the IGF-IR neutralizing antibody and IGFBP-3, we did not observe any additive effects (Fig. 3c), further suggesting that IGFBP-3 acts in these cells by sequestering IGF-I. The IGFBP-3 activity through IGF/IGF-IR system was also observed in LAP-35 and SK-N-MC EWS cell lines (data not shown) and we definitively confirmed that the inhibition of the IGF-I pathway is sufficient to explain IGFBP-3 inhibitory effects by exposing the TC-71 cells to a recombinant IGFBP-3 mutated in the nuclear localization signal (BP-3NLS) and observing similar growth inhibitory effects with the wild-type IGFBP-3 and its mutated form (58% of growth inhibition with wt-IGFBP-3; 62% with BP-3NLS). This mutant of IGFBP-3 has been shown to bind IGF-I similarly to wild-type IGFBP-3 and to inhibit IGF-I interaction with the receptor, but it is unable to enter cells and mediate the IGF-independent intracellular actions of IGFBP-3.23 Therefore, in our system, IGFBP-3 acts mainly through IGF-dependent mechanisms and the protein may represent an alternative strategy to inhibit IGF-IR functions.

thumbnail image

Figure 3. Evaluation of the IGFBP-3 effect-dependency on IGF-I/IGF-IR system. (a) Growth inhibitory effects of different doses of IGFBP-3 (100–1000 ng/ml) in the presence of IGF-I (50 ng/ml). Results represent the mean ± SE of triplicate experiments and are shown as % of growth increase/decrease with respect to control. (b) Growth inhibitory effects of 300 ng/ml IGFBP-3 in the presence of different doses of IGF-I (10–250 ng/ml). Results represent the mean ± SE of duplicate experiments and are shown as % of growth increase/decrease with respect to control. (c) Growth inhibition of TC-71 cells treated with IGFBP-3 (500 ng/ml) or the neutralizing IGF-IR MAb αIR3 (0.1 μg/ml) in the presence of IGF-I (50 ng/ml) or Des-(1-3)-IGF-I (50 ng/ml). Combined treatments with IGFBP-3 and the neutralizing IGF-IR MAb αIR3 are also shown. Results represent the mean ± SE of triplicate experiments and are shown as % of growth increase/decrease with respect to control.

Download figure to PowerPoint

The growth inhibitory effects of IGFBP-3 were mainly related to a decrease in cell proliferation rather than an increase in apoptosis. Treatments with 500 ng/ml of IGFBP-3 induced a significant reduction in the S phase of the cell cycle of EWS cells (Fig. 4a), whereas only a modest increase in the apoptotic rate was observed in these cells (Fig. 4b).

thumbnail image

Figure 4. (a) Effects of IGFBP-3 (500 ng/ml) on the proliferative rate of 3 representative EWS cell lines after 24 hr treatment. Results, expressed as mean of 2 different similar experiments, indicate percentage of cells in the different cell cycle phases, as determined by flow cytometry. (b) Cytofluorometric analysis of apoptotic cells by annexin-V and propidium iodide after 24 hr treatment of cells with 500 ng/ml IGFBP-3. The simultaneous application of propidium iodide as a DNA stain, which is used for dye exclusion tests, allows the discrimination of necrotic cells. Apoptotic cells were annexin V-positive and propidium iodide negative (LR region). Necrotic cells were annexin V and propidium iodide positive (UR region). Results of individual experiments, representative of different similar experiments are shown.

Download figure to PowerPoint

IGFBP-3 gene transfection inhibits cell motility, invasion and metastasis

The influence of IGF-I signaling on cell motility, angiogenesis and metastasis of EWS cells is well known.1, 2, 20 Here we show that IGFBP-3 dose dependently inhibits the migratory ability of EWS cells (Fig. 5a). Again, the protein acts through an IGF-dependent mechanism since the simultaneous presence of desIGF-I, which does not bind IGFBP-3, completely reverses the IGBP-3-induced reduction of migration (Fig. 5b). Moreover, similar inhibitory effects were observed when using recombinant IGFBP-3 or IGFBP-3 mutated in the nuclear localization signal (BP-3NLS) (Fig. 5b), further confirming the lack of additional IGF-independent mechanism.

thumbnail image

Figure 5. Effects of IGFBP-3 on migration of TC-71 cells. (a) Inhibition of TC-71 cells migration was evaluated after 18 hr of treatment with different doses of exogenous IGFBP-3 (300–1000 ng/ml). Each column represents the mean ± SE of at least 3 independent experiments. *, p < 0.05, **, p < 0.001, Student's t-test, compared to control. (b) To evaluate the IGF-I dependency, TC-71 cells were treated with 500 ng/ml IGFBP-3 or the recombinant protein mutated at the nuclear localization signal BP-3NLS in the presence or absence of 50 ng/ml IGF-I or desIGF. Each column represents the mean ± SE of 3 independent experiments. *, p < 0.05, Student's t-test, compared to control.

Download figure to PowerPoint

To evaluate the antimetastatic potential of IGFBP-3, we transfected TC-71 cells with the pcDNA3 plasmid containing IGFBP-3 cDNA and selected 3 stable clones overexpressing the protein (Fig. 6a, b). The 3 clones showed reduced growth ability either in monolayer cultures or in anchorage-independent conditions (Fig. 6c, d) as well as a lower migratory potential (Fig. 6e). In vivo, forced production of IGFBP-3 completely abrogated the metastasis ability of TC-71 cells (Table I). Besides the inhibitory actions on growth and migration, this therapeutically relevant effect may be due to the ability of IGFBP-3 to reduce the activity of MMP-9 (Fig. 6f), a proteolytic enzyme involved in the cell migration and invasion, and the production of VEGF-A (Fig. 6g), a major angiogenetic factor.

thumbnail image

Figure 6. In vitro growth characteristics of IGFBP-3 transfected TC-71 clones. (a) Relative expression of IGFBP-3 mRNA in TC-71 transfected clones compared to the parental cell line used as calibrator (2−ΔΔCT = 1), by Real Time PCR. Triplicate for each sample were performed and results are shown as mean ± SE. (b) IGFBP-3 protein level in cell supernatants of TC-71 derived clones, measured by Quantikine ELISA test. Results represent the mean ± SE of triplicate experiments. (c) Growth curves of TC-71 cells and derived IGFBP-3 expressing clones in monolayer conditions. Results represent one experiment representative of three. (d) Growth of TC/BP3 clones in anchorage-independent conditions. Data are expressed as means of 4–6 plates ± SE. **, p < 0.001, Student's t-test, compared to TC-71 parental cells. (e) Migration ability of TC/BP3 clones. Each column represents the mean ± SE of 3 independent experiment. *, p < 0.05;**, p < 0.001, Student's t-test, compared to TC-71 parental cells. (f) MMP-9 activities in cell supernatants of TC/BP3 transfected cells. Results represent the mean ± SE of triplicate experiments. *, p < 0.05, Student's t-test, compared to parental cell line TC-71. (g) VEGF-A production in cell supernatants of TC/BP3 transfected cells. Results represent the mean ± SE of triplicate experiments. *, p < 0.05, Student's t-test, compared to parental cell line TC-71.

Download figure to PowerPoint

Table I. Parameters Related to Malignancy of IGFBP-3 Expressing TC-71 Clones
CellsMetastasis to bones
IncidenceLatency (days)Total number
  • 1

    p = 0.004, Fisher Exact test, compared to TC-71 parental cells.

TC-719/16 (56%)45 ± 414
TC/BP3-40/101  
TC/BP3-110/101  

Discussion

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The IGF/IGF-IR signalling system is widely upregulated in solid tumors and mediates many features of the malignant phenotype, including resistance to inhibitors of the EGF receptor and HER2 as well as to conventional new agents,24, 25, 26, 27, 28 protection from apoptosis, tumor cell motility, invasion and metastases. Therefore, IGF/IGF-IR system appears as a very promising therapeutic target for innovative tailored therapies in several malignancies. EWS, a very aggressive tumor with severe clinical history affecting children and adolescents, has been shown to be highly dependent on IGF-IR activation and, as a consequence, impairing IGF-IR functions was found to substantially contribute to the control of sarcoma malignancy.1, 2, 29 In this respect, IGFBP-3 may provide an interesting additional opportunity to inhibit IGF/IGF-IR system. Multiple lines of in vitro, in vivo and clinical findings point to IGFBP-3 as an anticancer molecule.6 Regarding EWS, a recent article18 showed how the aberrant product EWS/FLI-1, the genetic hallmark of EWS, can bind to the IGFBP-3 promoter and repress its activity, identifying inhibition of IGFBP-3 as a key event in the development of this tumor. In agreement with these findings, we observed a generally low expression of IGFBP-3 either in a panel of cell lines or clinical samples, therefore indicating that the constitutive activation of IGF-I pathway in EWS12, 16 is also a consequence of the transcriptional inhibition of IGFBP-3.

The novel observation of our study is that IGFBP-3 acts as a potent anticancer molecule for EWS, completely abrogating EWS metastatization in athymic mice. The mechanism of action appears essentially due to sequestration of IGF-I, whereas no IGF-independent activity was observed with respect to growth and migration. This observation is in agreement with previous studies that indicate how the IGF-independent effects of IGFBP-3 are primarily related with the induction of apoptosis and not with inhibition of cell growth, and that these IGF-independent actions are cell-type and binding-partner specific. EWS cell lines may likely not contain all of the necessary molecular machinery to respond directly to IGFBP-3, including, for example, the RXR and Nur77 pathways.30, 31, 32, 33, 34, 35, 36 Therefore, acting mainly through IGF-dependent mechanisms, IGFBP-3 may represent an alternative strategy to inhibit IGF-IR functions. Consistent with data obtained by using IGF-IR neutralizing antibodies approaches,20, 37 IGFBP-3 severely affects metastasis and acts as a regulator of the activity of MMP-9 and VEGF-A, which being major mediators of basement membrane degradation, tumor invasion and angiogenesis may regulate the interactions between tumor cells, extracellular environment and metastasis process. With respect to a possible antibody-based therapy, IGFBP-3 may have the advantage of being a small, diffusible protein. Of course, when considering the therapeutic use of IGFBP-3, several important issues remain to be dealt with. It is conceivable that systemic administration of IGFBP-3 may result in toxic effects because of the alteration of IGFBP-3/IGF ratio in serum, which may lead to insulin resistance or osteoporosis. Therefore, local administration should also be considered. In this respect, the skeletal localization of primary as well as one third of EWS metastatic lesions may be an advantage for the therapeutic use of IGFBP-3 in the treatment of this tumor.

In conclusion, we confirmed that IGFBP-3 expression is generally inhibited in Ewing's sarcoma cells. Exposure of neoplastic cells to IGFBP-3 inhibits their growth, migratory, invasive, angiogenic and metastatic potential, therefore indicating the protein as a molecule of therapeutic relevance to be considered in the design of innovative therapeutic regimens to treat patients with EWS.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The authors thank Rosaria Strammiello and Caterina Curato for their technical contribution.

References

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • 1
    Scotlandi K, Benini S, Nanni P, Lollini PL, Nicoletti G, Landuzzi L, Serra M, Manara MC, Picci P, Baldini N. Blockage of insulin-like growth factor-I receptor inhibits the growth of ES in athymic mice. Cancer Res 1998; 58: 412731.
  • 2
    Scotlandi K, Maini C, Manara MC, Benini S, Serra M, Cerisano V, Strammiello R, Baldini N, Lollini PL, Nicoletti G, Picci P. Effectiveness of insulin-like growth factor I receptor antisense strategy against Ewing's sarcoma cells. Cancer Gene Ther 2002; 9: 296307.
  • 3
    LeRoith D, Roberts CT,Jr. The insulin-like growth factor system and cancer. Cancer Lett 2003; 195: 12737.
  • 4
    Baserga R. The contradictions of the insulin-like growth factor 1 receptor. Oncogene 2000; 19: 557481.
  • 5
    Mohan S, Baylink DJ. IGF-binding proteins are multifunctional and act via IGFdependent and -independent mechanisms. J Endocrinology 2002; 175: 1931.
  • 6
    Ali O, Cohen P, Lee KW. Epidemiology and biology of insulin-like growth factor binding protein-3 (IGFBP-3) as an anti-cancer molecule. Horm Metab Res 2003; 35: 72633.
  • 7
    Lee HY, Moon H, Chun KH, Chand YS, Hassan K, Ji L, Lotan R, Khuri FR, Hong WK. Effects of insulin-like growth factor binding protein-3 and farnesyltransferase inhibitor SCH66336 on Akt expression and apoptosis in non-small-cell lung cancer cells. Natl Cancer Inst 2004; 96: 153648.
  • 8
    Kirman I, Poltoratskaia N, Sylla P, Whelan RL. Insulin-like growth factor-binding protein 3 inhibits growth of experimental colocarcinoma. Surgery 2004; 136: 2059.
  • 9
    Yu H, Spitz MR, Mistry J, Gu J, Hong WK, Wu X. Plasma levels of insulin-like growth factor-I and lung cancer risk: a case-control analysis. J Natl Cancer Inst 1999; 91: 1516.
  • 10
    Petridou E, Skalkidou A, Dessypris N, Moustaki M, Mantzoros C, Spanos E, Trichopoulos D. Insulin-like growth factor binding protein-3 predicts survival from acute childhood leukemia. Oncology 2001; 60: 2527.
  • 11
    Renehanw AG, Zwahlen M, Minder C, O'Dwyer ST, Shalet SM, Egger M. Insulin-like growth factor (IGF)-I, IGF binding protein-3, and cancer risk: systematic review and meta-regression analysis. Lancet 2004; 363: 134653.
  • 12
    Scotlandi K, Benini S, Sarti M, Serra M, Lollini P-L, Maurici D, Picci P, Triche TJ, Baldini N. Insulin-like growth factor I receptor-mediated circuit in Ewing's sarcoma/peripheral neuroectodermal tumor: a possible therapeutic target. Cancer Res 1996; 56: 45704.
  • 13
    Girnita L, Girnita A, Wang M, Meis-Kindblom JM, Kindblom LG, Larsson O. A link between basic fibroblast growth factor (bFGF) and EWS/FLI-1 in Ewing's sarcoma cells. Oncogene 2000; 19: 4298301.
  • 14
    Zwerner JP, May WA. PDGF-C is an EWS/FLI induced transforming growth factor in Ewing family tumors. Oncogene 2001; 20: 62633.
  • 15
    Dalal S, Berry AM, Cullinane CJ, Mangham DC, Grimer R, Lewis IJ, Johnston C, Laurence V, Burchill SA. Vascular endothelial growth factor: a therapeutic target for tumors of the Ewing's sarcoma family. Clin Cancer Res 2005; 11: 236478.
  • 16
    de Alava E, Panizo A, Antonescu CR, Huvos AG, Pardo-Mindan FJ, Barr FG, Ladanyi M. Association of EWS-FLI1 type 1 fusion with lower proliferative rate in Ewing's sarcoma. Am J Pathol 2000; 156: 84955.
  • 17
    Toretzky JA, Kalebic T, Blakesley V, Le Roith D, Helman LJ. The insulin-like growth factor-I receptor is required for EWS/FLI-1 transformation of fibroblasts. J Biol Chem 1997; 272: 308227.
  • 18
    Prieur A, Tirode F, Cohen P, Delattre O. EWS/FLI1 silencing and gene profiling of Ewing cells reveal downstream oncogenic pathways and a crucial role for repression of insulin-like growth factor binding protein 3. Mol Cell Biology 2004; 24: 727583.
  • 19
    Benini S, Manara MC, Baldini N, Cerisano V, Serra M, Mercuri M, Lollini P-L, Nanni P, Picci P, Scotlandi K. Inhibition of insulin-like growth factor I receptor increases the antitumor activity of doxorubicin and vincristine against Ewing's sarcoma cells. Clin Cancer Res 2001; 7: 17907.
  • 20
    Strammiello R, Benini S, Manara MC, Perdichizzi S, Serra M, Spisni E, Picci P, Scotlandi K. Impact of IGF-I/IGF-IR circuit on the angiogenetic properties of Ewing's sarcoma cells. Horm Metab Res 2003; 11/12: 67584.
  • 21
    Scotlandi K, Manara MC, Nicoletti G, Lollini P-L, Lukas S, Benini S, Croci S, Perdichizzi S, Zambelli D, Serra M, Garcia-Echeverria C, Hofmann F, et al. Antitumor activity of the insulin-like growth factor-I receptor kinase inhibitor NVP-AEW541 in musculoskeletal tumors. Cancer Res 2005; 65: 386876.
  • 22
    Manara MC, Perbal B, Benini S, Strammiello R, Cerisano V, Perdichizzi S, Serra M, Astolfi A, Bertoni F, Alami J, Yeger H, Picci P, et al. The expression of ccn3(nov) gene in musculoskeletal tumors. Am J Pathol 2002; 160: 84959.
  • 23
    Lee KW, Liu B, Ma L, Li H, Bang P, Koeffler HP, Cohen P. Cellular internalization of insulin-like growth factor binding protein-3: distinct endocytic pathways facilitate re-uptake and nuclear localization. J Biol Chem 2004; 279(1): 46976.
  • 24
    Dunn SE, Hardman RA, Kari FW, Barrett CJ. Insulin-like growth factor 1 (IGF-I) alters drug sensitivity of HBL 100 human breast cancer cells by inhibition of apoptosis induced by diverse anticancer drugs. Cancer Res 1997; 57: 268793.
  • 25
    Lu Y, Zi X, Zhao Y, Mascarenhas D, Pollak M. Insulin-like growth factor-I receptor signaling and resistance to trastuzumab (Herceptin). J Natl Cancer Inst 2001; 93: 18527.
  • 26
    Chakravarti A, Loeffler JS, Dyson NJ. Insulin-like growth factor receptor I mediates resistance to anti-epidermal growth factor receptor therapy in primary human glioblastoma cells through continued activation of phosphoinositide 3-kinase signaling. Cancer Res 2002; 62: 2007.
  • 27
    Scotlandi K, Manara MC, Hattinger CM, Benini S, Perdichizzi S, Pasello M, Bacci G, Zanella L, Bertoni F, Picci P, Serra M. Prognostic and therapeutic relevance of HER2 expression in osteosarcoma and Ewing's sarcoma. Eur J Cancer 2005; 41: 134961.
  • 28
    Manara MC, Perdichizzi S, Serra M, Pierini R, Hattinger CM, Benini S, Astolfi A, Zaffaroni M, D'Incalci M, Scotlandi K, Picci P. Molecular mechanisms responsible for the resistance to ET-743 (Trabectidin; Yondelis) in Ewing's sarcoma cells. Int J Oncol 2005; 27: 160516.
  • 29
    Scotlandi K, Avnet S, Benini S, Manara MC, Serra M, Cerisano V, Perdichizzi S, Lollini PL, De Giovanni C, Landuzzi L, Picci P. Expression of an IGF-I receptor dominant negative mutant induces apoptosis, inhibits tumorigenesis and enhances chemosensitivity in Ewing's sarcoma cells. Int J Cancer 2002; 101: 116.
  • 30
    Rajah R, Valentinis B, Cohen P. Insulin-like growth factor (IGF)-binding protein-3 induces apoptosis and mediates the effects of transforming growth factor-beta1 on programmed cell death through a p53- and IGF-independent mechanism. J Biol Chem 1997; 272: 121818.
  • 31
    Oh Y, Muller HL, Pham H, Rosenfeld RG. Demonstration of receptors for insulin-like growth factor binding protein-3 on Hs578. T human breast cancer cells. J Biol Chem 1993; 268: 260458.
  • 32
    Gill ZP, Perks CM, Newcomb PV, Holly JM. Insulin-like growth factor-binding protein (IGFBP-3) predisposes breast cancer cells to programmed cell death in a non-IGF-dependent manner. J Biol Chem 1997; 272: 256027.
  • 33
    Hollowood AD, Lai T, Perks CM, Newcomb PV, Alderson D, Holly JM. IGFBP-3 prolongs the p53 response and enhances apoptosis following UV irradiation. Int J Cancer 2000; 88: 3364.
  • 34
    Spagnoli A, Hwa V, Horton WA, Lunstrum GP, Roberts CT,Jr, Chiarelli F, Torello M, Rosenfeld RG. Antiproliferative effects of insulin-like growth factor-binding protein-3 in mesenchymal chondrogenic cell line RCJ3.1. C5.18. relationship to differentiation stage. J Biol Chem 2001; 276: 553340.
  • 35
    Liu B, Lee HY, Weinzimer SA, Powell DR, Clifford JL, Kurie JM, Choen P. Direct functional interactions between insulin-like growth factor-binding protein-3 and retinoid X receptor-alpha regulate transcriptional signaling and apoptosis. J Biol Chem 2000; 275: 3360713.
  • 36
    Lee KW, Ma L, Yan X, Liu B, Zhang XK, Cohen P. Rapid apoptosis induction by IGFBP-3 involves an insulin-like growth factor-independent nucleomitochondrial translocation of RXRalpha/Nur77. J Biol Chem 2005; 280: 169428.
  • 37
    Zhang D, Bar-Eli M, Meloche S, Brodt P. Dual regulation of MMP-2 expression by the type 1 insulin-like growth factor receptor: the phosphatidylinositol 3-kinase/Akt and Raf/ERK pathways transmit opposing signals. J Biol Chem 2004; 279: 1968390.