SEARCH

SEARCH BY CITATION

Keywords:

  • tumor suppressor gene;
  • methylation;
  • BRAF mutation;
  • thyroid cancer;
  • TIMP3;
  • SLC5A8;
  • DAP kinase;
  • RARβ2

Abstract

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The role of aberrant tumor suppressor gene methylation in the aggressiveness of papillary thyroid cancer (PTC) has not been documented. By showing promoter methylation-induced gene silencing in PTC-derived cell lines, we first demonstrated the functional consequence of methylation of several recently identified tumor suppressor genes, including those for tissue inhibitor of metalloproteinase-3 (TIMP3), SLC5A8, death-associated protein kinase (DAPK) and retinoic acid receptor β2 (RARβ2). We then investigated the role of methylation of these genes in the aggressiveness of PTC by examining the relationship of their aberrant methylation to clinicopathological characteristics and BRAF mutation in 231 primary PTC tumors. Methylation of TIMP3, SLC5A8 and DAPK was significantly associated with several aggressive features of PTC, including extrathyroidal invasion, lymph node metastasis, multifocality and advanced tumor stages. Methylation of these genes was also significantly associated with BRAF mutation in PTC, either individually or collectively in various combinations. Methylation of these genes, either individually or collectively, occurred more frequently in more aggressive classical and tall-cell PTC subtypes than in less aggressive follicular-variant PTC, with the latter known to infrequently harbor BRAF mutation. Several other tumor suppressor genes investigated were not methylated. These results suggest that aberrant methylation and hence silencing of TIMP3, SLC5A8, DAPK and RARβ2, in association with BRAF mutation, may be an important step in PTC tumorigenesis and progression. © 2006 Wiley-Liss, Inc.

Follicular epithelial cell-derived thyroid cancer is the most common endocrine malignancy, of which papillary thyroid cancer (PTC) is the most common form, accounting for 80% of all thyroid malignancies.1, 2 Although PTC is usually an indolent cancer, it can be associated with progression and aggressiveness, and patients often suffer recurrence with increased morbidity and mortality.3, 4, 5, 6 Many clinicopathological factors are known to be associated with increased risk for progression and aggressiveness of PTC, including extrathyroidal invasion, lymph node metastasis, advanced tumor stages, and certain subtypes of PTC.3, 4, 5, 6 The most common subtypes of PTC are classical, tall-cell, and follicular-variant PTC. In comparison with the latter, the former 2 subtypes are particularly associated with high risk for tumor progression and aggressiveness.

The specific molecular mechanisms underlying the progression and aggressiveness of PTC have not been well defined. Genetic alterations, such as BRAF mutation,7RET/PTC rearrangements,8Ras mutation9 and PAX8-PARγ rearrangements,10 are important genetic alterations in thyroid cancer. BRAF mutation is the most common oncogenic genetic alteration in PTC, occurring in 45% of cases of PTC on average.7 Several large studies showed an association of this mutation with progression and aggressiveness of PTC.11, 12, 13 The molecular events and mechanisms involved in BRAF mutation-promoted tumorigenesis and progression of PTC, however, remain largely undefined. Recently, aberrant methylation of various tumor suppressor genes was found in thyroid cancer.14 Whether this epigenetic alteration plays a role in the progression and aggressiveness of thyroid cancer has not been investigated.

Silencing of tumor suppressor genes by aberrant methylation plays an important role in tumorigenesis and progression of human cancers.15, 16 Among the major tumor suppressor genes are those for tissue inhibitor of metalloproteinase-3 (TIMP3), SLC5A8, death-associated protein kinase (DAPK), and retinoic acid receptor β2 (RARβ2). TIMP3 is one of the 4 known tissue inhibitors of metalloproteinases and may inhibit growth, angiogenesis, invasion, and metastasis of several cancers.17, 18TIMP3 gene was found to be hypermethylated in various human cancers,19, 20, 21, 22 including thyroid cancer.14 SLC5A8 belongs to the sodium solute symporter family (SLC5) and is expressed in various tissues, including thyroid tissue.23, 24, 25 SLC5A8 has been recently demonstrated to be a tumor suppressor and its gene is methylated and silenced in some human cancers.26, 27, 28, 29 DAPK is a calcium/calmodulin-dependent serine threonine kinase protein. Its tumor suppressor function, through proapoptosis, has been documented, and its gene is hypermethylated in several human cancers,30 including thyroid cancer.14 RARβ2 is expressed in most tissues and plays a central role in the regulation of epithelial cells growth and in their tumorigenesis, and the RARβ2 gene is often methylated in human cancers.31, 32

In the present study, we investigated the role of these tumor suppressor genes in PTC tumorigenesis by examining the relationship between methylation of these genes and tumor aggressiveness. The relationship of methylation of these genes with BRAF mutation in PTC was also investigated.

Material and methods

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Patients and clinicopathological data collection

With institutional review board approvals and patient consent, when appropriate, primary PTC tumor tissues and clinicopathological data were collected from patients who underwent total thyroidectomy over a period of 15 years (between 1990 and 2005) at the Johns Hopkins University School of Medicine, the Yale University School of Medicine, the Hospital for Endocrine Surgery in Kiev, Ukraine, and the University of Bologna Hospital in Bologna, Italy. Two hundred thirty-one cases of PTC were included. Table I summarizes the different subtypes of PTC contributed from the 4 institutions. To focus on sporadic PTC and to avoid confounding effects of radiation, patients from Ukraine who were younger than 20 years at the time of the Chernobyl nuclear accident were excluded. Clinicopathological data, such as patient age, gender, status of extrathyroidal invasion, lymph node metastasis, multifocality and stage of the tumor were collected retrospectively, as described previously.13 Thyroid tumors were staged using the staging system created by the National Thyroid Cancer Treatment Cooperative Study Registry Group (USA), whose predictive value for disease outcome and progress was among the highest of several different classification systems.6 Thyroid cancer recurrence was defined as occurrence of disease during follow-up as evidenced by specific test results, including positive thyroglobulin, positive radioiodine uptake, and/or cytology or pathology evidence.

Table I. Case Contribution and Composition of Tumor Subtypes from Four Institutions
CenterTotal casesConventional PTCFollicular-variant PTCTall-cell-variant PTC
Johns Hopkins156825816
Ukraine262150
Yale University181260
Italian3112136
Total2311278222

Human thyroid cancer cell lines

Human PTC-derived cell lines KAT-5 and KAT-10 were kindly provided by Dr. K. B. Ain (University of Kentucky Medical Center, Lexington, KY). The follicular thyroid cancer cell line WRO-82-1 was kindly provided by Dr. G. J. F. Juillard (University of California-Los Angeles School of Medicine, Los Angeles, CA). KAT-5 and KAT-10 cell lines were cultured in RPMI-1640 (Mediatech, Herdon, VA) supplemented with 10% heat-inactivated fetal bovine serum, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate and penicillin–streptomycin in a humidified incubator at 37°C with 5% CO2. WRO cells were cultured in RPMI-1640 containing 10% heat-inactivated fetal bovine serum, supplemented with, in each 500 ml medium, 750 mg sodium bicarbonate (Invitrogen, Carlsbad, CA), 77 mg sodium pyruvate (Irvine Scientific, Santa Ana, CA), 7 ml of 100× MEM nonessential amino acid (Irvine Scientific), 1 ml of 50 mg/ml gentamicin (Invitrogen) and 5 ml of 100× antimycotic solution (Omega Scientific, Tarzana, CA). In some experiments, cells were treated with 5-aza-2′-deoxycytidine (AdC) (Sigma, St. Louis, MO) for gene demethylation and re-expression studies.

Genomic DNA isolation and sodium bisulfite treatment

PTC samples were microdissected and DNA was isolated with SDS-proteinase K digestion, phenol–chloroform extraction and ethanol precipitation as described previously.33 For paraffin-embedded samples, tissue digestion was preceded by xylene treatment to remove paraffin. Cell line DNA was isolated by digesting cell pellets following a similar protocol. Genomic tumor and cell line DNA samples were subjected to bisulfite treatment as described.33 Briefly, about 2 μg of DNA was denatured in a volume of 20 μl by incubation with 0.2 M NaOH at 50°C for 20 min, followed by incubation in 500 μl of a freshly prepared solution containing 3 M sodium bisulfite and 10 mM hydroquinone for 2–3 hr at 70°C. DNA samples were then desalted using affinity chromatography columns (Wizard DNA Clean-Up System, Promega, Madison, WI), treated with 0.3 M NaOH for 10 min at room temperature, and precipitated with ethanol. Bisulfite-treated DNA was finally resuspended in 30 μl H2O for the use of gene methylation analysis.

Real-time quantitative methylation-specific PCR

Real-time quantitative methylation-specific PCR (QMSP) analysis for promoter methylation was performed on the indicated genes using bisulfite-treated DNA as templates and specific primers and probes (summarized in Table II) as previously described.14, 25 The primers and probes were designed to specifically amplify bisulfite-converted nucleotide sequences in the promoter areas of the genes of interest. The fluorescence-based QMSP (Taqman) protocol was as described previously.34 Briefly, to determine the relative level of methylation, the ratio of the value of the gene of interest over the value of the internal reference gene (β-actin) was used. Fluorogenic QMSP assay was carried out in a reaction volume of 20 μl on a 384-well plate using an Applied Biosystems 7900 Sequence Detector (Perkin-Elmer, Foster City, CA). The reaction mixture contained 200 nM probes, 600 nM forward and reverse primers, 200 μM each of dCTP, dTTP, dATP and dGTP, 0.6 units of platinum Taq polymerase enzyme, 16.6 mM ammonium sulfate, 6.7 mM MgCl2, 10 mM mercaptoethanol, 0.1% DMSO, 67 mM Tris (pH 8.8) and 2% Rox reference dye. About 3 μl of bisulfite-treated DNA was included in each reaction. QMSP was run at 95°C for 1 min, followed by 50 cycles at 95°C for 15 sec and 60°C for 1 min. Each sample was run in duplicates and each plate contained multiple water blanks, negative unmethylated DNA and serial dilutions of positive methylated DNA controls to construct the calibration curve. Methylated DNA samples, used as positive controls, were obtained by in vitro treatment of leukocyte DNA from healthy individuals with Sss I DNA methylase (New England Biolabs, Beverly, MA). A methylation+ result was defined for any detectable level of methylation, and a methylation− result represented zero value with the current detection system.

Table II. Primer and Probe Sequences for Real Time Quantitative Methylation-Specific PCR (QMSP) and RT-PCR1
GenesQMSPRT-PCR
Forward primer (5′–3′)Probes (5′–3′)Reverse primer (5′–3′)Forward primer (5′–3′)Reverse primer (5′–3′)
  • 1

    Probes were labeled as 5′ Fam-DNA sequence-Tamra 3′.

SLC5A8TCGAACGTATTTCGAGGCCAACGACGAATACAAAAACGACTACCAACACAACGAATCGATTTTCCGAGGCAGCACTCAGCGTATTTTTTGAGCTCCAATTCCAACC
TIMP3GCG TCG GAG GTTAAG GTT GTTAAC TCG CTC GCCCGC CGA ACTC TCC AAA ATT ACC GTA CGC GGCCTTCTGCAACTCCGACATCCGTGTACATCTTGCCATCATA
DAPKGGA TAG TCG GATCGA GTT AAC GTCTTC GGT AAT TCG TAG CGGTAG GGT TTG GCCC TCC CAA ACG CCG ATTCAGGCAGGAAAACGTGGATTTTTCTCACGGCATTTCTTCACA
RARβ2GGG ATT AGA ATTTTTTATGCG AGT TGTTGT CGA GAA CGC GAGCGA TTC GTAC CCC GAC GAT ACC CAA ACGACTGTATGGATGTTCTGTCAGATTTGTCCTGGCAGACGAAGCA
β-ACTINTGG TGA TGG AGGAGG TTT AGT AAG TACC ACC ACC CAA CACACA ATA ACA AAC ACAAAC CAA TAA AAC CTACTC CTC CCT TAA  
GAPDH   CAA CTA CAT GGT TTA CATGTT CGCC AGT GGA CTC CAC GAC

Isolation of total RNA and RT-PCR

Total RNA was isolated from cell lines using the TRIzol reagent (Invitrogen) according to manufacturer's instructions. About 1 μg of RNA was reverse-transcribed into cDNA using a superScript First-Strand Synthesis kit with an Oligo (dT) primer following the instructions of manufacturer (Invitrogen). PCR primers designed specifically for TIMP3, SLC5A8, DAPK and RARβ2 cDNA (summarized in Table II) were as described previously.20, 25, 35, 36 The PCR conditions on cDNA were as described for thyroid stimulating hormone receptor gene,33 with some modifications. Briefly, 5 μl of diluted cDNA was included in a final volume of 25 μl reaction mixture, containing 6.7 mM MgCl2, 67 mM Tris (pH 8.8), 1.25 mM of each deoxynucleotide triphosphate, 10 mM 2-mercaptoethanol, 225 ng of each primer (sense and antisense) and 0.5 unit of platinum DNA Taq polymerase (Invitrogen). PCR amplification was conducted using a step down protocol with the annealing temperature appropriate for the specific genes. Taking DAPK gene as an example, the PCR settings were: 1 cycle of 95°C for 5 min; 3 cycles of 95°C for 45 sec, 64°C for 45 sec and 72°C for 45 sec; 3 cycles of 95°C for 45 sec, 62°C for 45 sec and 72°C for 45 sec; 35 cycles of 95°C for 45 sec, 60°C for 45 sec and 72°C for 45 sec; and a final extension at 72°C for 5 min. Amplification of GAPDH cDNA was used to confirm RNA integrity for each sample. PCR products were separated and visualized by electrophoresis on a 2% agarose gel.

BRAF mutation analysis

The T1799A transverse mutation in exon 15 of the BRAF gene is virtually the only BRAF mutation in PTC.7 We therefore analyzed this mutation in the present study by direct DNA sequencing as described previously.13 Briefly, exon 15 containing the site for the T1799A mutation was amplified with PCR using specific primers. The PCR settings were: 1 cycle of 95°C for 5 min; 2 cycles of 95°C for 1 min, 60°C for 1 min, and 72°C for 1 min; 2 cycles of 95°C for 1 min, 58°C for 1 min, and 72°C for 1 min; 35 cycles of 95°C for 1 min, 56°C for 1 min, and 72°C for 1 min, followed by an extension at 72°C for 5 min. The reaction mixture contained 67 mM Tris (pH 8.8), 16.6 mM ammonium sulfate, 10 mM 2-mercaptoethanol, 6.7 mM MgCl2, 5% DMSO, 1.5 mM of each deoxynucleotide triphosphate, 1.67 μM of forward and reverse primers, 60 ng genomic DNA and 0.5 unit of platinum DNA Taq polymerase. After quality confirmation by agarose gel electrophoresis, the PCR products were subjected to sequencing reaction with Big Dye reagents (Applied Biosystems, Foster City, CA) on a PCR cycler. The PCR settings were: 1 cycle at 95°C for 30 sec; 95°C for 15 sec, 35 cycles at 50°C for 15 sec, and 60°C for 4 min. The T1799A BRAF mutation was identified by analysis of DNA sequences on an ABI PRISM 3700 DNA Analyser (Applied Biosystems).

Statistical analysis

Categorical data were summarized using frequencies and percents. Continuous measures of age and tumor size were summarized using medians and interquartile ranges. Comparisons of methylation+ to methylation− groups for categorical variables were made using the χ2 test and continuous variables were compared using the non-parametric Wilcoxon rank sum test. Gene combination groups were defined as methylation+ for those patients who were positive for the specified genes regardless of the methylation status for the genes not listed in the combination. Therefore, the 34 patients who were positive for all 4 genes are included in the methylation+ group for each gene combination. All reported p-values are two-sided. p values <0.05 were considered statistically significant. SAS Version 9.1.3 software (SAS Institute, Cary, NC) was used for data analysis in this study.

Results

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Methylation of tumor suppressor genes is associated with their silencing in thyroid cancer cell lines

Methylation of the tumor suppressor genes TIMP3, SLC5A8, DAPK and RARβ2 was shown to be associated with their silencing in other human cancer cells. We therefore first attempted to investigate the functional consequence of methylation of these genes in thyroid cancer cells. To this end, we used human thyroid cancer cell lines to test the effects of demethylating agent 5-aza-2′-deoxycytidine (AdC) on methylation and expression of these genes. DAPK was expressed in KAT-5, KAT-10 and WRO cell lines (Fig. 1a), all 3 of which harbored no or a low level of DAPK gene methylation (Fig. 1b). Robust expression of TIMP3 and RARβ2 was seen in WRO cells, but not in KAT-5 and KAT-10 cells (Fig. 1a). Conversely, the TIMP3 and RARβ2 genes were methylated heavily in KAT-5 and KAT-10 cells, but only minimally in WRO cells (Fig. 1b). No expression of SLC5A8 was seen in KAT-5, KAT-10 and WRO cells (Fig. 1a) and significant methylation of the SLC5A8 gene was seen in all 3 cell lines (Fig. 1b). Treatment of the KAT-5 and KAT-10 cells with AdC could partially demethylate (Fig. 1b) and re-express (Fig. 1a) the SLC5A8, TIMP3 and RARβ2 genes in these 2 cell lines. Treatment with AdC also partially demethylated the SLC5A8 gene in the WRO cell line (Fig. 1b), but failed to restore the expression of the SLC5A8 gene in this cell (Fig. 1a). This was probably due to additional regulatory defects, such as missing certain transcription factors of the SLC5A8 gene in this cell. These cell line studies demonstrated that, as in other cancer cells, aberrant methylation of these tumor suppressor genes could silence them in thyroid cancer cells.

thumbnail image

Figure 1. Correlation between silencing and hypermethylation of tumor suppressor genes in thyroid cancer cells lines. Shown in panel a are the RT-PCR results for the 4 tumor suppressor genes in KAT-5, KAT-10 and WRO cells. Where indicated, cells were treated with or without 5 μM 5-aza-2′-deoxycytidine (AdC) for 24 hr before harvest for total RNA isolation and RT-PCR analysis for gene expression as described in Material and Methods. Shown in panel b are the results of corresponding methylation analysis on the 4 tumor suppressor genes in the 3 thyroid tumor cell lines. Cells were treated with or without AdC as described in panel a. The methylation level (on y-axis) is represented by ratios of the gene of interest/β-actin × 1,000 for the fluorescence emission intensity values of the 2 genes obtained by QMSP. Shown is a representative experiment. M, molecular ladder marker; N, normal human thyroid tissue. GAPDH, glyceraldehyde-3-phosphate dehydrogenase (used as quality control).

Download figure to PowerPoint

Methylation of tumor suppressor genes was associated with high-risk pathological features of PTC

We next examined the clinicopathological consequences of methylation of the 4 tumor suppressor genes to investigate its role in the pathogenesis and aggressiveness of primary PTC tumors.

Methylation of the TIMP3 gene and its relationship with clinicopathological characteristics of PTC.

Methylation of the TIMP3 gene occurred in 122/231 (53%) cases of PTC. Methylation of this gene was associated with extrathyroidal invasion [46/122 (38%) for the methylation group vs. 25/108 (23%) for the group without methylation, p = 0.02], lymph node metastasis [53/122 (43%) for the methylation group vs. 31/107 (29%) for the group without methylation, p = 0.02] and multifocality [60/122 (49%) for the methylation group vs. 37/108 (34%) for the group without methylation, p = 0.02] of the tumor (Table III). A higher prevalence of advanced tumor stages (stages III/IV) was also seen in TIMP3 methylation+ group (27% vs. 19%), but this was not statistically significant. No significant association of methylation of this gene was seen with patient age or gender and tumor size or recurrence.

Table III. Correlation between TIMP3 Methylation and Clinicopathological Characteristics in Papillary Thyroid Cancer. Median (Interquartile Range) or N (%)
 TIMP3+TIMP3p-Value
  • 1

    Five patients missing; 1 from TIMP3+, 4 from TIMP3−.

  • 2

    One patient missing from TIMP3−.

  • 3

    Two patients missing from TIMP3−.

  • 4

    Thirty-seven patients missing; 26 from TIMP3+, 11 from TIMP3−.

N (total)122109 
Age at diagnosis45 (36–56)44 (35–55)0.61
Gender, male28 (23)33 (30)0.21
Tumor size (cm)12 (1–3)2 (2–4)0.11
Extrathyroidal invasion246 (38)25 (23)0.02
Lymph node metastasis353 (43)31 (29)0.02
Multifocality260 (49)37 (34)0.02
Tumor stage3  0.20
 I37 (30)43 (40) 
 II52 (43)44 (41)
 III32 (26)18 (17)
 IV1 (1)2 (2)
Tumor stage, III/IV333 (27)20 (19)0.13
Tumor recurrence414 (15)13 (13)0.79
Methylation of the SLC5A8 gene and its relationship with clinicopathological characteristics of PTC.

Methylation of the SLC5A8 gene occurred in 76/231 (33%) cases of PTC. Methylation of this gene was closely associated with extrathyroidal invasion [31/76 (41%) for methylation group vs. 40/154 (26%) for the group without methylation, p = 0.02] and multifocality [40/76 (53%) for methylation group vs. 57/154 (37%) for the group without methylation, p = 0.02] (Table IV). The association of SLC5A8 methylation with advanced tumor stages (III/IV) was also remarkable, which just marginally fell out of statistical significance (p = 0.07). A higher prevalence of lymph node metastasis was seen in the SLC5A8 methylation group (42% vs. 34%), but this was not statistically significant. Male gender tended to be less frequently associated with SLC5A8 methylation. No association of SLC5A8 methylation was seen with patient age, tumor size and disease recurrence.

Table IV. Correlation between SLC5A8 Methylation and Clinicopathological Characteristics in Patients with Papillary Thyroid Cancer. Median (Interquartile Range) or N (%)
 SLC5A8+SLC5A8p-Value
  • 1

    Five patients missing from SLC5A8−.

  • 2

    One patient missing from SLC5A8−.

  • 3

    Two patients missing from SLC5A8−.

  • 4

    Thirty-seven patients missing; 16 from SLC5A8+, 21 from SLC5A8−.

N (total)76155 
Age at diagnosis46 (37–59)44 (35–54)0.22
Gender, male13 (17)48 (31)0.02
Tumor size (cm)12 (2–3)2 (2–4)0.72
Extrathyroidal invasion231 (41)40 (26)0.02
Lymph node metastasis332 (42)52 (34)0.23
Multifocality240 (53)57 (37)0.02
Tumor stage3  0.04
 I19 (25)61 (40) 
 II34 (45)62 (41)
 III23 (30)27 (18)
 IV0 (0)3 (2)
Tumor stage, III/IV323 (30)30 (20)0.07
Tumor recurrence49 (15)18 (13)0.77
Methylation of the DAPK gene and its relationship with clinicopathological characteristics of PTC.

Methylation of the DAPK gene occurred in 78/231 (34%) cases of PTC. Methylation of this gene was significantly associated with tumor multifocality [40/78 (51%) for methylation group vs. 57/152 (38%) for the group without methylation, p = 0.045] and marginally associated with female gender (Table V). Tumor size tended to be smaller in the DAPK methylation group. No significant association of DAPK methylation was seen with other clinicopathological characteristics of PTC, including patient age, extrathyroidal invasion, lymph node metastasis, tumor stage and tumor recurrence.

Table V. Correlation between SLC5A8 Methylation and Clinicopathological Characteristics in Patients with Papillary Thyroid Cancer. Median(Interquartile Range) or N (%)
 DAPK +DAPKp-Value
  • 1

    Five patients missing from DAPK−.

  • 2

    One patient missing from DAPK−.

  • 3

    Two patients missing from DAPK−.

  • 4

    Thirty-seven patients missing; 16 from DAPK+, 21 from DAPK−.

N (total)78153 
Age at diagnosis45 (37–56)44 (36–55)0.93
Gender, male15 (19)46 (30)0.08
Tumor size (cm)12 (1–3)2 (2–4)0.03
Extrathyroidal invasion229 (37)42 (28)0.14
Lymph node metastasis332 (41)52 (34)0.33
Multifocality240 (51)57 (38)0.045
Tumor stage3  0.60
 I26 (33)54 (36) 
 II32 (41)64 (42)
 III20 (26)30 (20)
 IV0 (0)3 (2)
Tumor stage, III/IV320 (26)33 (22)0.52
Tumor recurrence49 (15)18 (14)0.87
Methylation of the RARβ2 gene and its relationship with clinicopathological characteristics of PTC.

Methylation of the RARβ2 gene occurred in 50/231 (22%) cases of PTC and was less prevalent than methylation of TIMP3, SLC5A8 and DAPK genes. We did not see a statistically significant association of this gene methylation with any of the common clinicopathological characteristics of PTC (data not shown).

Methylation of tumor suppressor genes occurred more frequently in PTC subtypes that are known to be associated with increased aggressiveness

To investigate further the role of methylation of tumor suppressor genes in the aggressiveness of PTC, we compared methylation of the 4 tumor suppressor genes in different subtypes of PTC that are known to differ in progression and aggressiveness. Methylation of each of the 4 tumor suppressor genes occurred more frequently in tall-cell and classical PTC than in follicular-variant PTC (Fig. 2). When we examined the patterns of collective methylation of multiple genes in various tumor types, we found concurrent methylation of these tumor suppressor genes to be even more strongly associated with classical and tall-cell PTC (Table VI), which are well known to be more aggressive than follicular-variant PTC. Thus, the tumor subtype-specific methylation patterns of these tumor suppressor genes in PTC are also consistent with a role of methylation of these genes in the pathogenesis and aggressiveness of PTC.

thumbnail image

Figure 2. Preferential association of methylation of individual tumor suppressor genes with classical and tall-cell PTC. Values on y-axis represent the percentage of tumors of the type indicated that were methylated in the indicated gene. *p < 0.01; **p < 0.001.

Download figure to PowerPoint

Table VI. Preferential Association of Collective Methylation of Multiple Tumor Suppressor Genes with Classical and Tall-Cell PTC. Number of Cases with Cocurrent Methylation of the Genes in the Indicated Combination/Total Number of the Cases of the Indicated Tumor Type (%)
Gene combinationSubtype of PTCp-Value
Tall cell (n = 22)Classical (n = 127)Follicular variant (n = 82)
DAPK/TIMP310 (45)49 (39)11 (13)0.0002
DAPK/RARβ24 (18)31 (24)2 (2)0.0001
DAPK/SLC5A810 (45)42 (33)8 (10)<0.0001
RARβ2/SLC5A84 (18)30 (24)4 (5)0.002
RARβ2/TIMP35 (23)34 (27)5 (6)0.0009
SLC5A8/TIMP39 (41)47 (37)13 (16)0.002
DAPK/RARβ2/SLC5A84 (18)29 (23)2 (2)0.0003
DAPK/TIMP3/SLC5A89 (41)40 (32)8 (10)0.0003
DAPK/RARβ2/TIMP33 (14)31 (24)2 (2)0.0001
RARβ2/TIMP3/SLC5A83 (14)30 (24)4 (5)0.001
DAPK/RARβ2/TIMP3/SLC5A83 (14)29 (23)2 (2)0.0003

Association of tumor suppressor gene methylation with BRAF mutation in PTC

Because several studies have shown an association of BRAF mutation with aggressiveness of PTC,11, 12, 13 we asked about and investigated the relationship of this mutation to tumor suppressor gene methylation. In the 195 cases of PTC available for BRAF mutation analysis, we observed a close association of this mutation with methylation of the TIMP3, SLC5A8 and DAPK genes (Table VII). The association of BRAF mutation with RARβ2 methylation was also remarkable, although it was marginally significant (p = 0.07). The association of BRAF mutation with SLC5A8 and RARβ2 methylation confirmed similar findings in previous studies on smaller thyroid tumor series.14, 25

Table VII. Association of BRAF Mutation with Methylation of Individual Tumor Suppressor Genes in 195 Papillary Thyroid Cancer.1 Number of Cases with BRAF Mutation/Total (%)
Tumor suppressor geneMethylation+Methylation−p-Value
  • 1

    Thirty-six cases from the total of 231 were missing from this analysis as data on BRAF mutation status was not available in these cases.

TIMP357/103 (55)33/92 (36)0.007
SLC5A838/63 (60)52/132 (39)0.006
DAPK41/64 (64)49/131 (37)0.0005
RARβ226/45 (58)64/150 (43)0.07

To further examine the relationship between tumor suppressor gene methylation and BRAF mutation, we analyzed the relationship of BRAF mutation to collective methylation of these genes in various combinations. Concurrent methylation of these tumor suppressor genes was closely associated with BRAF mutation in most of the gene combinations (Table VIII). Only the RARβ2/SLC5A8 (p = 0.15) and RARβ2/TIMP3/SLC5A8 combinations (p = 0.21) were not associated with BRAF mutation, probably due to inclusion of the RARβ2 gene, whose methylation was only marginally associated with BRAF mutation (Table VII). These results suggest that methylation, and hence presumably silencing, of tumor suppressor genes, particularly TIMP3, SLC5A8 and DAPK, may be an important step in BRAF mutation-promoted PTC tumorigenesis and aggressiveness.

Table VIII. Association of BRAF Mutation with Collective Methylation of Multiple Tumor Suppressor Genes in 195 Papillary Thyroid Cancer.1 Number of Cases with BRAF Mutation/Total (%)
Gene combinationMethylation+Methylation−p-Value
  • 1

    Thirty-six cases from the total of 231 were missing from this analysis as data on BRAF mutation status was not available in these cases.

DAPK/TIMP338/58 (66)52/137 (38)0.0004
DAPK/RARβ221/32 (66)69/163 (42)0.02
DAPK/SLC5A833/50 (66)57/145 (39)0.001
RARβ2/SLC5A819/33 (58)71/162 (44)0.15
RARβ2/TIMP323/39 (59)67/156 (43)0.07
SLC5A8/TIMP333/57 (58)57/138 (41)0.03
DAPK/RARβ2/SLC5A819/30 (63)71/165 (43)0.04
DAPK/TIMP3/SLC5A830/47 (64)60/148 (41)0.005
DAPK/RARβ2/TIMP320/31 (65)70/164 (43)0.03
RARβ2/TIMP3/SLC5A818/32 (56)72/163 (44)0.21
DAPK/RARβ2/TIMP3/SLC5A818/29 (62)72/166 (43)0.06

Discussion

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

We have investigated the role of tumor suppressor gene methylation in the aggressiveness of PTC and in its relationship to BRAF mutation in this cancer. Tumor suppressor functions of the TIMP3, SLC5A8, DAPK and RARβ2 genes have been recently indicated in many human tissues. Aberrant methylation of these genes, as a mechanism for their silencing, has been frequently observed in human cancers, consistent with a role of these genes in suppressing human tumorigenesis. The recently reported aberrant methylation of these tumor suppressor genes in thyroid cancer14, 25 shed light on its role also in the pathogenesis of thyroid cancer. The present study provided strong evidence to support this idea by demonstrating methylation-induced silencing of these genes in thyroid cancer cell lines and, more importantly, by showing a strong association of methylation of these genes, particularly TIMP3, SLC5A8 and DAPK, with several aggressive pathological features of PTC and BRAF mutation in this cancer. These pathological features included extrathyroidal invasion, lymph node metastasis, multifocality and advanced tumor stages (Tables III–V), which are well-known high-risk histopathological factors predicting increased progression and aggressiveness of PTC.3, 4, 5, 6 Further support for a role of methylation of these tumor suppressor genes in the aggressiveness of PTC is its higher prevalence, either individually (Fig. 2) or collectively in various combinations of the genes (Table VI), in classical and tall-cell PTC than follicular-variant PTC, with the former 2 subtypes being classically known to be more aggressive than the latter.

Among the 4 tumor suppressor genes studied, the TIMP3 gene was most frequently methylated and associated with high-risk pathological characteristics of PTC (Table III). Its association with both extrathyroidal invasion and lymph node metastasis of PTC is particularly interesting, as this is consistent with a loss of TIMP3 function to inhibit extracellular matrix metalloproteinase-317 and to suppress angiogenesis by blocking the binding of vascular endothelial growth factor to its receptor.18 Methylation of the TIMP3 gene is associated with invasion and metastasis in several other human cancers. For instance, TIMP3 is frequently methylated and silenced in uveal melanoma that has a high propensity to metastasize,19 and methylation and reduced expression of the TIMP-3 gene are associated with increased tumor invasiveness and reduced survival time in patients with esophageal adenocarcinoma.22 SLC5A8 is a newly discovered tumor suppressor gene, the silencing of which through aberrant methylation plays an important role in tumorigenesis of several human cancers, including colon,26 gastric27 and brain28 cancers. The recent report of aberrant methylation and associated silencing of the SLC5A8 gene in BRAF mutation-harboring PTC25 suggests that loss of SLC5A8 may play a role in the tumorigenesis of BRAF mutation-induced PTC. Our finding of the association of SLC5A8 gene methylation with extrathyroidal invasion, multifocality and advanced tumor stages (III/IV) of PTC (Table IV) provides strong evidence to support a role of SLC5A8 as a tumor suppressor gene in thyroid tissues. The tumor suppressor function of DAPK gene has been well characterized and its methylation-mediated silencing has been demonstrated in many human cancers.30 Our finding of methylation of this gene in PTC and its association with PTC multifocality (Table V) support its involvement in PTC tumorigenesis. Indeed, except for the RARβ2 gene, methylation of these tumor suppressor genes was all associated with multifocality of PTC (Tables III–V), suggesting that epigenetic silencing of these genes may increase the propensity for the development of PTC. The RARβ2 gene was not associated with the conventional clinicopathological characteristics of PTC, suggesting that silencing of this gene, unlike the other 3 tumor suppressor genes, may contribute to tumorigenesis of PTC through a different pathway. The lack of association of methylation of these tumor suppressor genes with PTC recurrence suggests that silencing of any of these genes alone constitutes only a part of the pathway driving the progression and recurrence of PTC. This is different than BRAF mutation, which is independently associated with PTC recurrence,13 presumably because it plays a primary and dominant role in driving PTC tumorigenesis. However, the fact that the patients were treated for their thyroid cancer at different medical institutions and the lack of central pathology review may potentially bias the conclusion on the clinicopathological behaviors of the tumors from the 4 medical institutions.

BRAF mutation is the most common oncogenic genetic alteration and, through aberrant activation of the Ras [RIGHTWARDS ARROW] Raf [RIGHTWARDS ARROW] MEK [RIGHTWARDS ARROW] MAP kinase pathway, plays a key role in driving tumorigenesis in nearly one-half of PTC cases.7 Given the frequent methylation of the several tumor suppressor genes investigated in the present study, particularly TIMP3, SLC5A8 and DAPK, and its close associations with several high-risk pathological characteristics of PTC, methylation of these genes may be an important step in BRAF mutation-promoted PTC tumorigenesis and progression. Indeed, we observed a close correlation of BRAF mutation with methylation of all 4 tumor suppressor genes (Table VII). Moreover, as seen with BRAF mutation, which most often occurs in classical and tall-cell PTC,7 methylation of these tumor suppressor genes also most often occurs in these relatively aggressive PTC subtypes (in comparison with follicular-variant PTC) (Fig. 2 and Table VI). The correlation of tumor suppressor gene methylation with BRAF mutation was also seen when collective methylation of multiple tumor suppressor genes in various combinations was examined (Table VIII). The collective methylation of these tumor suppressor genes did not represent global gene methylation, as several other tumor suppressor genes, such as TIG1, P16 and PGP9.5, were very rarely methylated in our study (data not shown). Therefore, methylation of the 4 major tumor suppressor genes in the present study appeared to be a specific event in PTC. Its association with BRAF mutation suggests that methylation of certain tumor suppressor genes may play a role in the aggressiveness of PTC conferred by BRAF mutation.

In summary, we have for the first time explored the role of methylation of several recently identified major tumor suppressor genes in PTC tumorigenesis by investigating its relationship to gene silencing in thyroid cancer cell lines and to tumor aggressiveness and BRAF mutation in a large series of PTC. We found a close association of aberrant methylation of these genes with aggressive tumor characteristics and BRAF mutation in PTC. Our data suggest that aberrant methylation and consequent silencing of these tumor suppressor genes may be an important step in BRAF mutation-promoted tumorigenesis and aggressiveness of PTC. Detailed molecular events and mechanisms in this process remain to be elucidated.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

This study was supported in part by a thyroid research award from the Thyroid, Head and Neck Cancer (THANC) Foundation and a Research Scholar Grant from the American Cancer Society (to MX). The authors thank the many former and current research associates and assistants of the authors at the involved institutions for their assistance in preparing the human specimens used in this study.

References

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • 1
    Hundahl SA, Fleming ID, Fremgen AM, Menck HR. A National Cancer Data Base report on 53,856 cases of thyroid carcinoma treated in the U.S., 1985–1995. Cancer 1998; 83: 263848.
  • 2
    Paterson IC, Greenlee R, Adams Jones D. Thyroid cancer in Wales 1985–1996: a cancer registry-based study. Clin Oncol 1999; 11: 24551.
  • 3
    Hay ID, Bergstralh EJ, Goellner JR, Ebersold JR, Grant CS. Predicting outcome in papillary thyroid carcinoma: development of a reliable prognostic scoring system in a cohort of 1779 patients surgically treated at one institution during 1940 through 1989. Surgery 1993; 114: 10507.
  • 4
    Mazzaferri EL, Jhiang SM. Long-term impact of initial surgical and medical therapy on papillary and follicular thyroid cancer. Am J Med 1994; 97: 41828.
  • 5
    Gilliland FD, Hunt WC, Morris DM, Key CR. Prognostic factors for thyroid carcinoma. A population-based study of 15,698 cases from the Surveillance, Epidemiology and End Results (SEER) program 1973–1991. Cancer 1997; 79: 56473.
  • 6
    Sherman SI, Brierley JD, Sperling M, Ain KB, Bigos ST, Cooper DS, Haugen BR, Ho M, Klein I, Ladenson PW, Robbins J, Ross DS, et al. Prospective multicenter study of thyroid carcinoma treatment: initial analysis of staging and outcome.National Thyroid Cancer Treatment Cooperative Study Registry Group. Cancer 1998; 83: 101221.
  • 7
    Xing M. BRAF mutation in thyroid cancer. Endocr Relat Cancer 2005; 12: 24562.
  • 8
    Nikiforov YE. RET/PTC rearrangement in thyroid tumors. Endocr Pathol 2002; 13: 3,4.
  • 9
    Vasko V, Ferrand M, Di Cristofaro J, Carayon P, Henry JF, de Micco C. Specific pattern of RAS oncogene mutations in follicular thyroid tumors. J Clin Endocrinol Metab 2003; 88: 274552.
  • 10
    Kroll TG, Sarraf P, Pecciarini L, Chen CJ, Mueller E, Spiegelman BM, Fletcher JA. PAX8-PPARγ fusion oncogene in human thyroid carcinoma. Science 2000; 289: 135760.
  • 11
    Nikiforova MN, Kimura ET, Gandhi M, Biddinger PW, Knauf JA, Basolo F, Zhu Z, Giannini R, Salvatore G, Fusco A, Santoro M, Fagin JA, et al. BRAF mutations in thyroid tumors are restricted to papillary carcinomas and anaplastic or poorly differentiated carcinomas arising from papillary carcinomas. J Clin Endocrinol Metab 2003; 88: 5399404.
  • 12
    Namba H, Nakashima M, Hayashi T, Hayashida N, Maeda S, Rogounovitch TI, Ohtsuru A, Saenko VA, Kanematsu T, Yamashita S. Clinical implication of hot spot BRAF mutation, V599E, in papillary thyroid cancers. J Clin Endocrinol Metab 2003; 88: 43937.
  • 13
    Xing M, Westra WH, Tufano RP, Cohen Y, Rosenbaum E, Rhoden KJ, Carson KA, Vasko V, Larin A, Tallini G, Tolaney S, Holt EH et al. BRAF mutation predicts a poorer clinical prognosis for papillary thyroid cancer. J Clin Endocrinol Metab 2005; 90: 63739.
  • 14
    Hoque MO, Rosenbaum E, Westra WH, Xing M, Ladenson P, Zeiger MA, Sidransky D, Umbricht CB. Quantitative assessment of promoter methylation profiles in thyroid neoplasms. J Clin Endocrinol Metab 2005; 90: 401118.
  • 15
    Herman JG, Baylin SB. Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med 2003; 349: 204254.
  • 16
    Feinberg AP, Tycko B. The history of cancer epigenetics. Nat Rev Cancer 2004; 4: 14353.
  • 17
    Anand-Apte B, Bao L, Smith R, Iwata K, Olsen BR, Zetter B, Apte SS. A review of tissue inhibitor of metalloproteinases-3 (TIMP-3) and experimental analysis of its effect on primary tumor growth. Biochem Cell Biol 1996; 74: 85362.
  • 18
    Qi JH, Ebrahem Q, Moore N, Murphy G, Claesson-Welsh L, Bond M, Baker A, Anand-Apte B. A novel function for tissue inhibitor of metalloproteinases-3 (TIMP3): inhibition of angiogenesis by blockage of VEGF binding to VEGF receptor-2. Nat Med 2003; 9: 40715.
  • 19
    van der Velden PA, Zuidervaart W, Hurks MH, Pavey S, Ksander BR, Krijgsman E, Frants RR, Tensen CP, Willemze R, Jager MJ, Gruis NA. Expression profiling reveals that methylation of TIMP3 is involved in uveal melanoma development. Int J Cancer 2003; 106: 4729.
  • 20
    Feng H, Cheung AN, Xue WC, Wang Y, Wang X, Fu S, Wang Q, Ngan HY, Tsao SW. Down-regulation and promoter methylation of tissue inhibitor of metalloproteinase 3 in choriocarcinoma. Gynecol Oncol 2004; 94: 37582.
  • 21
    Brueckl WM, Grombach J, Wein A, Ruckert S, Porzner M, Dietmaier W, Rummele P, Croner RS, Boxberger F, Kirchner T, Hohenberger W, Hahn EG. Alterations in the tissue inhibitor of metalloproteinase-3 (TIMP-3) are found frequently in human colorectal tumours displaying either microsatellite stability (MSS) or instability (MSI). Cancer Lett 2005; 223: 13742.
  • 22
    Darnton SJ, Hardie LJ, Muc RS, Wild CP, Casson AG. Tissue inhibitor of metalloproteinase-3 (TIMP-3) gene is methylated in the development of esophageal adenocarcinoma: loss of expression correlates with poor prognosis. Int J Cancer 2005; 115: 3518.
  • 23
    Rodriguez AM, Perron B, Lacroix L, Caillou B, Leblanc G, Schlumberger M, Bidart JM, Pourcher T. Identification and characterization of a putative human iodide transporter located at the apical membrane of thyrocytes. J Clin Endocrinol Metab 2002; 87: 35003.
  • 24
    Lacroix L, Pourcher T, Magnon C, Bellon N, Talbot M, Intaraphairot T, Caillou B, Schlumberger M, Bidart JM. Expression of the apical iodide transporter in human thyroid tissues: a comparison study with other iodide transporters. J Clin Endocrinol Metab 2004; 89: 14238.
  • 25
    Porra V, Ferraro-Peyret C, Durand C, Selmi-Ruby S, Giroud H, Berger-Dutrieux N, Decaussin M, Peix JL, Bournaud C, Orgiazzi J, Borson-Chazot F, Dante R et al. Silencing of the tumor suppressor gene SLC5A8 is associated with BRAF mutations in classical papillary thyroid carcinomas. J Clin Endocrinol Metab 2005; 90: 302835.
  • 26
    Li H, Myeroff L, Smiraglia D, Romero MF, Pretlow TP, Kasturi L, Lutterbaugh J, Rerko RM, Casey G, Issa JP, Willis J, Willson JK, et al. SLC5A8, a sodium transporter, is a tumor suppressor gene silenced by methylation in human colon aberrant crypt foci and cancers. Proc Natl Acad Sci USA 2003; 100: 841217.
  • 27
    Ueno M, Toyota M, Akino K, Suzuki H, Kusano M, Satoh A, Mita H, Sasaki Y, Nojima M, Yanagihara K, Hinoda Y, Tokino T, et al. Aberrant methylation and histone deacetylation associated with silencing of SLC5A8 in gastric cancer. Tumour Biol 2004; 25: 13440.
  • 28
    Hong C, Maunakea A, Jun P, Bollen AW, Hodgson JG, Goldenberg DD, Weiss WA, Costello JF. Shared epigenetic mechanisms in human and mouse gliomas inactivate expression of the growth suppressor SLC5A8. Cancer Res 2005; 65: 361723.
  • 29
    Ganapathy V, Gopal E, Miyauchi S, Prasad PD. Biological functions of SLC5A8, a candidate tumour suppressor. Biochem Soc Trans 2005; 33: 23740.
  • 30
    Schneider-Stock R, Roessner A, Ullrich O. DAP-kinase––protector or enemy in apoptotic cell death. Int J Biochem Cell Biol 2005; 37: 17637.
  • 31
    Kim H, Kwon YM, Kim JS, Lee H, Park JH, Shim YM, Han J, Park J, Kim DH. Tumor-specific methylation in bronchial lavage for the early detection of non-small-cell lung cancer. J Clin Oncol 2004; 22: 236370.
  • 32
    Youssef EM, Lotan D, Issa JP, Wakasa K, Fan YH, Mao L, Hassan K, Feng L, Lee JJ, Lippman SM, Hong WK, Lotan R. Hypermethylation of the retinoic acid receptor-β2 gene in head and neck carcinogenesis. Clin Cancer Res 2004; 10: 173342.
  • 33
    Xing M, Usadel H, Cohen Y, Tokumaru Y, Guo Z, Westra WB, Tong BC, Tallini G, Udelsman R, Califano JA, Ladenson PW, Sidransky D. Methylation of the thyroid-stimulating hormone receptor gene in epithelial thyroid tumors: a marker of malignancy and a cause of gene silencing. Cancer Res 2003; 63: 231621.
  • 34
    Harden SV, Tokumaru Y, Westra WH, Goodman S, Ahrendt SA, Yang SC, Sidransky D. Gene promoter hypermethylation in tumors and lymph nodes of stage I lung cancer patients. Clin Cancer Res 2003; 9: 13705.
  • 35
    Toyooka S, Toyooka KO, Miyajima K, Reddy JL, Toyota M, Sathyanarayana UG, Padar A, Tockman MS, Lam S, Shivapurkar N, Gazdar AF. Epigenetic down-regulation of death-associated protein kinase in lung cancers. Clin Cancer Res 2003; 9: 303441.
  • 36
    Zambrano P, Segura-Pacheco B, Perez-Cardenas E, Cetina L, Revilla-Vazquez A, Taja-Chayeb L, Chavez-Blanco A, Angeles E, Cabrera G, Sandoval K, Trejo-Becerril C, Chanona-Vilchis J et al. A phase I study of hydralazine to demethylate and reactivate the expression of tumor suppressor genes. BMC Cancer 2005; 5: 4456.