Silencing of hyaluronan synthase 2 suppresses the malignant phenotype of invasive breast cancer cells

Authors

  • Yuejuan Li,

    1. Ludwig Institute for Cancer Research, Uppsala University, Box 595, Biomedical Center, Uppsala, Sweden
    Search for more papers by this author
  • Lingli Li,

    1. Ludwig Institute for Cancer Research, Uppsala University, Box 595, Biomedical Center, Uppsala, Sweden
    Search for more papers by this author
  • Tracey J. Brown,

    1. Laboratory for Hyaluronan Research, Department of Biochemistry and Molecular Biology, Monash University, Clayton, Vic., Australia
    Search for more papers by this author
  • Paraskevi Heldin

    Corresponding author
    1. Ludwig Institute for Cancer Research, Uppsala University, Box 595, Biomedical Center, Uppsala, Sweden
    2. Department of Medical Biochemistry and Microbiology, Uppsala University, Box 595, Biomedical Center, Uppsala, Sweden
    • Ludwig Institute for Cancer Research, Box 595, Uppsala University Biomedical Center, S-751 24 Uppsala, Sweden
    Search for more papers by this author
    • Fax: +46-18-16-04-20.


Abstract

Accumulation of hyaluronan has been demonstrated in the peritumoral breast cancer stroma and nests of tumor cells. In this study, we have quantified the production of hyaluronan and the expression of mRNAs encoding hyaluronan synthesizing (HAS) and hyaluronan degrading (HYAL) enzymes in a panel of breast cancer cell lines. The analysis revealed that highly invasive breast cancer cells produce high amounts of hyaluronan and express preferentially HAS2 mRNA, whereas less invasive breast cancer cells produce low amount of hyaluronan and express HAS1 and HYAL1 mRNAs. We explored the importance of HAS2 expression for breast cancer tumorigenicity, by specifically silencing the HAS2 gene using RNA interference (RNAi)-mediated suppression in the invasive breast cancer cell line Hs578T. This led to a less aggressive phenotype of the breast tumor cells, as assessed by cell growth, both in anchorage-dependent and anchorage-independent cultures. siRNA-mediated knock down of HAS2 in Hs578T breast tumor cells led to an up-regulation of HAS1, HAS3 and HYAL1 mRNAs, resulting in only a 50% decrease in the net hyaluronan production; however, the synthesized hyaluronan was of lower size and more polydisparse compared to control siRNA-treated cells. Interestingly, Hs578T cells deprived of HAS2 migrated only half as efficiently as HAS2 expressing cells through cell-free areas in a culture wounding assay and through Transwell polycarbonate membrane as well as invaded a Matrigel layer. These results imply that alterations in HAS2 expression and endogenously synthesized hyaluronan affect the malignant phenotype of Hs578T breast cancer cells. © 2007 Wiley-Liss, Inc.

Breast cancer progression correlates with altered hyaluronan metabolism, including increased deposition of hyaluronan in the nests of carcinoma cells, and especially in the stromal tissue in the invading edges of breast carcinomas.1, 2 Stromal fibroblasts activated by the breast cancer cells most likely contribute to the enrichment of hyaluronan in the immediate peritumoral stroma.3In vitro studies revealed that the most aggressive breast carcinoma cell lines both synthesize high amounts of hyaluronan and express the cell surface hyaluronan receptors, CD44 and RHAMM, unlike the less aggressive cell lines.4, 5, 6

Hyaluronan is synthesized by hyaluronan synthases, which exist in 3 isoforms (HAS1, HAS2 and HAS3), and is degraded by hyaluronidases (HYAL1, HYAL2 and HYAL3, and PH-20).7, 8 Although each of the HAS isoforms is capable of hyaluronan synthesis, they synthesize hyaluronan of different lengths. The HAS2 isoform synthesizes hyaluronan molecules larger than 3.9 × 106, HAS3 synthesizes polydisperse hyaluronan (Mw of 0.12–1 × 106) and HAS1 synthesizes much smaller chains (Mw of 0.12 × 106). Moreover, the HAS isoforms exhibit different catalytic activities; HAS3 is catalytically more active than HAS2, which in turn is more active than HAS1.9 Disruption of the HAS2 gene causes embryonic lethality in mice, whereas deletion of HAS1 or HAS3 do not.10 Hyaluronan fragmentation is catalyzed by HYAL1 and HYAL2, which are widely distributed in tissues at low concentrations. Both hyaluronidases are active at an acidic pH, and HYAL1 exhibits high specific activity whereas HYAL2 is less active.11, 12, 13

Several studies have demonstrated a close correlation between abnormal production of hyaluronan and the promotion of the malignant phenotype of tumors. In a colon carcinoma model, we showed that expression of HAS2 enhances tumor growth whereas expression of HYAL1 delays tumor development, and the transplantable tumor cells gave rise to tumors of lower frequency.14 Recently, studies using antisense inhibition of HAS2 and/or HAS3 genes in aggressive prostate and breast carcinoma experimental models further highlight the importance of HAS2 and HAS3 in initiation and progression of the tumors.15, 16 Although these approaches using stable transfection of the cancer cell lines offered an initial promise, these studies achieved partial inhibition of the messenger RNA. To investigate further the importance of hyaluronan and hyaluronan synthesizing and/or degrading enzymes for breast cancer cell invasiveness, we determined the hyaluronan production and expression of HAS1, HAS2 and HAS3, as well as HYAL1 and 2 mRNA, in a panel of highly aggressive and less aggressive breast cancer cells. The analyses revealed that the invasive Hs578T cells both synthesized the largest amounts of hyaluronan and predominantly expressed the HAS2 gene. RNAi technology is currently providing new promise in the experimental and therapeutic silencing of genes.17, 18 We explored the applicability of this technique to the silencing of the HAS2 gene, with the aim of characterizing the importance of this enzyme in the maintenance of the invasive and malignant phenotype of the Hs578T breast cancer cell line.

Abbreviations:

FBS, fetal bovine serum; HAS, hyaluronan synthase; HYAL, hyaluronidase; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate-buffered saline without Ca2+ and Mg2+; PDGF β-receptor, platelet derived growth factor β-receptor; SDS, sodium dodecylsulfate; siRNA, small interfering RNA.

Material and methods

Cell culture and quantification of hyaluronan synthesis

Human breast cancer cell lines (4.5 × 104 cells/well in 12-well plates) expressing high levels of progesterone and estrogen receptors (ZR-75-1, MCF-719, 20) or low receptor levels (MDA-MB-231, Hs578T21, 22, 23), as well as high progesterone but low estrogen receptor levels (HTB-12224), were cultured in Dulbecco's modified Eagles medium (DMEM, Veterinary Institute, Uppsala, Sweden) containing 10% fetal bovine serum (FBS), 4 mM glutamine, 100 IU/ml penicillin and 100 μg/ml streptomycin (complete medium); the cell lines were generously provided by Professor J. Bergh (Karolinska institute, Stockholm, Sweden). Twenty four hours after plating, the conditioned media were collected, and the hyaluronan content quantified using a microtiter-based assay taking advantage of the formation of a complex between hyaluronan and the hyaluronan binding protein (HABP) domain of aggrecan, essentially as described previously.14 Briefly, MaxiSorp 96-well Nunc-Immuno Plates (Nunc 439454) were precoated overnight with 1 μg HABP/ml. Then, samples of conditioned media at appropriate dilutions or hyaluronan standards (0–100 ng/ml) were applied onto the plates. After 1 hr of incubation at 37°C, plates were washed, 100 μl of biotin labeled HABP (b-HABP; 1 μg/ml) was added and the plates were incubated for an additional 1 hr. After washing, the b-HABP specifically bound to the immobilized hyaluronan was detected with streptavidin biotinylated horseradish peroxidase (Amersham) followed by the addition of 100 μl 3,3′,5,5′ tetramethylbenzindine substrate solution (Sigma T4444) for 15 min. Following addition of 50 μl of 2 M H2SO4, the absorbance was measured at a wavelength of 450 nm, and the sample hyaluronan content was calculated from a standard curve.

siRNA-mediated silencing of HAS2 expression and HAS2 overexpression in Hs578T breast cancer cells

Four siRNA duplexes designed with symetric 3′TT overhangs to target different nucleotide sequences (no 1, 1043–1061; no 2, 1402–1420; no 3, 1617–1637; no 4, 1671–1691) of the human HAS2 gene (Genbank accession number U54804) were obtained from Qiagen, UK. Subconfluent Hs578T cells (about 50–60% confluent) grown in complete medium were transfected separately with each 1 of the 4 siRNA duplexes or with a control (non-silencing) siRNA (sense, r(UUC UCC GAA CGU GUC ACG U)dTdT; antisense: r(ACG UGA CAC GUU CGG AGA A)dTdT) at different concentrations (50, 100 and 200 nM) using LipofectAMINE 2000 (Invitrogen) according to the manufacturer's instructions. The suppression efficiency of each 1 of the 4 siRNA duplexes was examined both by measuring the hyaluronan content in the conditioned culture media after 24, 48, 72 and 96 hr of transfection, and the HAS2 mRNA expression levels using real-time PCR, 48 hr after transfection. The HAS2 siRNA [sense: r(GCG AUU AUC ACU GGA UUC U)dTdT; antisense: r(AGA AUC CAG UGA UAA UCG C)dTdT] corresponding to nucleotide sequences 1671–1691 of the HAS2 cDNA (AAGCGATTATCACTGGATTCT) (no 4) was used for all experiments; in some of the experiments the effects of HAS2 siRNA duplex [sence: r(CACGUAACGCAAUUGGUCU)dTdT; antisense: r(AGACCAAUUGCGUUACGUG)dTdT] corresponding to target region 1043–1061 (AACACGTAACGCAATTGGTCT) (no 2) were also studied. Furthermore, hyaluronan at different concentrations (molecular mass 2.5 × 106) was included into the culture media in some of the transfection experiments, 6 hr after the start.

Subconfluent cultures of Hs578T were transfected with 2 μg/ml of pCIneo vector containing the open reading frame for HAS225 using LipofectAMINE 2000, according to the manufacturer's instructions. Then, cultures were screened for hyaluronan content in the conditioned media, as described above.

Quantification of mRNA expression levels for hyaluronan synthesizing and degrading enzymes

Real time RT-PCR was used to quantify the relative mRNA levels of HAS1, HAS2 and HAS3, as well as HYAL1 and 2 in wild-type breast cancer cell lines, and in control siRNA- and HAS2 siRNA-transfected Hs578T cells. Total RNA was purified using a RNAqueous™-4PCR kit for isolation of DNA-free RNA (Ambion), according to the manufacturer's instruction. Purified total RNAs (3 μg for each sample) were reverse transcribed (SuperScript™ II RNase H Reverse Transcriptase Kit, Invitrogen) according to the manufacturer's instruction. Then, 3 μl of each reverse transcribed cDNA was subjected to real-time PCR (qPCR™ Core kit for SYBR™ Green. Eurogenetic) using the ABI Prism 7700 Detection system (version 1.6 software; Applied Biosystem, Weiterstadt, Germany) according to the manufacturer's protocol. The specific primers were designed based on cDNA sequences deposited in the GenBank data base (accession numbers: HAS1, U59269; HAS2, U54804; HAS3, AF232772; HYAL1, U03056; HYAL2, AJ000099 and GAPDH, NM_002046) using a Primer Express™ software (Version 1.5, Applied Biosystems) (Table I). The conditions for real-time PCR were as follows: One cycle at 95°C for 10 min, 40 cycles at 95°C for 15 sec, 60°C for 1 min and one cycle at 25°C for 2 min. Confirmation of all primer pairs specificity was documented by performing melting curve analysis (data not shown). Standard curves for each transcript were generated by serial dilutions of input total RNAs from 0–100 ng; the slope values of each standard curve were approximately equal, indicating a similar amplification efficiency for each target (within 10% from the theoretical value which should be −3.3).26 Hence, quantification of each target gene relative to an endogenous reference gene, GAPDH, was determined by using the formula, target gene/GAPDH = 2−DCT; DCT values corresponds to difference between the threshold cycle (CT) values of each target gene and GAPDH (i.e. number of cycles to see amplification of the target gene). The expression level for each target gene relative to control siRNA (arbitrarily set to 1) was quantified using the relative standard curve method (Applied Biosystems, User Bulletin 2).

Table I. Primer Sequences Used for the Quantification of Gene Expression in Breast Cancer Cell Line
GenePrimersGenebank accession number
HAS1For 5′ GGAATAACCTCTTGCAGCAGTTTC 3′ Rev 5′ GCCGGTCATCCCCAAAAG 3′U59269
HAS2For 5′ TCGCAACACGTAACGCAAT 3′ Rev 5′ ACTTCTCTTTTTCCACCCCATTT 3′U54804
HAS3For 5′ AACAAGTACGACTCATGGATTTCCT 3′ Rev 5′ GCCCGCTCCACGTTGA 3′AF232772
HYAL1For 5′ GATGTCAGTGTCTTCGATGTGGTA 3′ Rev 5′ GGGAGCTATAGAAAATTGTCATGTCA 3′U03056
HYAL2For 5′ CTAATGAGGGTTTTGTGAACCAGAATAT 3′ Rev 5′ GCAGAATCGAAGCGTGGATAC 3′AJ000099
GAPDHFor 5′ CCCATGTTCGTATGGGTGT 3′ Rev 5′ TGGTCATGATCCTTCCACGATA 3′NM_002046

Determination of the molecular mass and cell-localization of hyaluronan synthesized by control siRNA- and HAS2 siRNA-transfected Hs578T cells

The molecular mass of de novo synthesized hyaluronan by Hs578T cells (2 × 105 cells/well in a 6-well plate), transiently transfected for 48 hr with control siRNA or HAS2 siRNA, was determined after incubation for an additional 24 hr in 1 ml complete medium containing 10 μCi D-[6-3H]glucosamine hydrochloride, a precursor of both hyaluronan and sulfated glycosaminoglycans. Conditioned media were collected and dialyzed (MW cut-off of 3500; Spectrum Laboratories, USA) for 48 hr against 0.1 M sodium acetate buffer, pH 5.5, supplemented with 5 mM EDTA. The dialysate was then divided into 2 equal aliquots. One aliquot was treated overnight with 10 U/ml Streptomyces hyaluronidase at 37°C (hyaluronidase-sensitive radioactivity was considered to represent 3H-hyaluronan), whereas the other aliquot was treated in a similar way but in the absence of the hyaluronidase, as a control. Then, the enzyme was heat-inactivated and each sample was subjected to gel chromatography using a Sephacryl-HR column (100 × 1 cm), composed of 3 layers of Sephacryl-HR with different porosities27 and equilibrated with 0.25 M NaCl. Fractions of 0.82 ml were collected and the radioactivity was measured in a Pharmacia LKB Wallac scintillation counter.

Hs578T cells (1 × 105 cells/well in 4-well chamber slides; Lab/Tek, Falcon) transfected with 100 nM of control siRNA or HAS2 siRNA were cultured for 48 hr. Then, untreated or Streptomyces hyaluronidase-treated cells (2 U/ml for 10 min to remove pericellular hyaluronan, Seikagaku, Japan) were fixed in 4% paraformaldehyde in PBS for 20 min at room temperature, washed, permeabilized in 0.15% Triton X-100 in PBS for 10 min, and washed again in PBS-D. To detect hyaluronan in situ, cultures were incubated with b-HABP (5 μg/ml in PBS-1% BSA) for 1 hr. After washing, cells were incubated with Alexa Fluor 488 conjugated streptavidin (1 μg/ml; Molecular Probes) for 1 hr at 37°C. The specificity of hyaluronan staining was tested by preincubating the cells with 10 U/ml Streptomyces hyaluronidase for 2 hr at room temperature.

Immunoblotting and hyaluronan binding assay

Cells (1 × 106 cells in 6-well plates) were transfected with control or HAS2 siRNAs and incubated in the absence or presence of exogenously added hyaluronan (100 μg/ml) for 48 hr, whereafter they were solubilized with ice-cold RIPA buffer (10 mM Tris-HCl, pH 7.4, 0.15 M NaCl, 1% Triton X-100, 0.1% SDS, 0.65 mM MgSO4, 1 mM CaCl2, 0.5% deoxycholate) containing proteinase inhibitors (10 turbidity units/ml aprotinin, 1 μg/ml leupeptin, 0.1 mM pefabloc, 1 μM pepstatin) for 2 hr at 4°C, on a rocking platform. Lysates were centrifuged at 13,000 rpm for 15 min at 4°C, and the protein content in the supernatants was determined by BCA kit (Pierce). Then, samples (20 μg of protein) were subjected to SDS-PAGE using 10% polyacrylamide gels and the protein was electrophoretically transferred to nitrocellulose membranes (Amersham Biosciences, Uppsala, Sweden) using semi-dry transfer system (Bio-Rad). Membranes were blocked over-night at 4°C with 5% defatted milk in Tris-buffered saline (TBS; 20 mM Tris-HCl, 137 mM NaCl, pH 7.6), supplemented with 0.1% Tween-20, and probed with primary antibodies for 3 hr at room temperature (2 μg/ml of poly-Ab against p16 or 2 μg/ml mAb against p21, cyclin A, cyclin B or cdc2 p34, Santa Cruz, UK, or 5 μg/ml Hermes-1 a mAb against CD44; an ammonium sulphate precipitate from serum free supernatant, generously provided by Professor S. Jalkanen, Turku, Finland, was used). After 3 washes in TBS-T, the membranes were incubated with appropriate secondary antibodies for 1 hr, and immunocomplexes were detected by enhanced chemiluminescence (Amersham Bioscience, Uppsala, Sweden) according to the manufacturer's instructions. The blots were quantified using a scanner and associated software (Aida Image Analyzer).

The hyaluronan binding capacity of HAS2 siRNA- and control siRNA-treated Hs578T cells was investigated essentially as described previously.14, 28 Briefly, Hs578T cells expressing or deprived of HAS2 mRNA were incubated in starvation medium overnight and then treated with testicular hyaluronidase (100 U/ml, for 1 hr at 37°C) to ensure that the cell surface receptors for hyaluronan were not occupied by endogenously produced hyaluronan. Following extensive washing, 0.25 μg [3H]hyaluronan/ml (prepared from conditioned equine synovial cells, as described by Fraser et al.29) was added, and the cells were incubated for 1 hr at room temperature in the absence or presence of exogenously added nonlabeled hyaluronan (100 μg/ml, Mw 1.2 × 106, Q-Med, Uppsala, Sweden). Some of the cell monolayers were preincubated for 30 min at 4°C with Hermes-1 antibody which specifically inhibits the binding of [3H]hyaluronan to cell surface CD44.30, 31 After washing, cell layers were solubilized in 0.3 M NaOH, 1% SDS (w/v) for 30 min, followed by neutralization with 2 M HCl and scintillation counting.

Soft agar growth assay

The soft agar assay was conducted essentially as described previously.32 Control siRNA- or HAS2 siRNA-transfected Hs578T cells (0.5 × 105 cells/well in 6-well plate) were suspended in 3 ml DMEM containing 10% FBS (pre-warmed to 37°C), and 300 μl of 3% agarose in PBS (prewarmed to 60°C) was added. Agar-suspended cells (1 ml/well in 6-well plates) were plated out in dishes coated with 1 ml of agar-coated dishes (0.6% agarose in DMEM). After solidification at room temperature for 20 min, 3 ml complete medium was added to each well and cells were incubated at 37°C in a humidified atmosphere of 5% CO2 (v/v) in air for 3 weeks. After this period, 20 fields were randomly selected, and the number of colonies comprising greater than 6 arbitrary units were counted under a Nikon microscope. The area of the colonies was measured using an NIH image program.

Proliferation assay

Cells (3 × 104 cells/well in 24-well plates) were transfected either with control siRNA or each one of the HAS2 siRNAs (no 2 or no 4), as described above. Differences in the proliferative capacity between HAS2 siRNA- and control siRNA-transfected cells were examined in the absence or presence of exogenous hyaluronan (Mw 2.5 × 106, Q-Med, Uppsala, Sweden), by counting cell numbers up to 8 days after transfection. At the indicated time points, cells were detached using trypsin-EDTA and the cell numbers were determined using a Particle Coulter counter (Beckman Instruments AB).

Cell cycle analysis

Hs578T cells (2 × 105 cells/well in 12-well plates) transfected with HAS2 siRNA or control siRNA were cultured in complete medium, for various periods of time after transfection. Cells were then washed in PBS, trypsinized and pelleted by centrifugation. For DNA analysis, the cell pellets were resuspended in 450 μl prechilled 70% ethanol and stored at −70°C for at least 5 min. After fixation, the cells were pelleted by centrifugation, washed in PBS and resuspended in 300 μl PBS containing 0.1% Triton X-100 and 180 U/ml RNase A (USB, USA). The cell suspensions were then incubated at 37°C for 20 min followed by addition of 250 μl propidium iodide (to a final concentration of 50 μg/ml, Sigma) and 10 min incubation at 4°C. The DNA content of cell samples and cell cycle kinetics were detected by using a CellQuest software in a Becton Dickinson FACStar plus flow cytometer.

Cell migration

Wild type Hs578T cells (4 × 105 cells/well in 6-well plates) and cells transfected with HAS2 siRNA or control siRNA were grown for 48 hr until confluency. Two horizontal and one longitudinal cell-free areas were made across the dish with a 200 μl pipette tip. Detached cells were removed and fresh complete medium was added. In some cases, to investigate the effect of exogenously added hyaluronan or CD44 on cell migration, cells were cultured in complete media supplemented with hyaluronan at different concentrations (1–50 μg/ml) or with blocking CD44 antibodies (Hermes-1; 50 μg/ml). The cell-free areas were photographed immediately after wounding; the closure of the wounds by migrating cells were determined after 14 hr and 28 hr using an Olympus CK2 inverted phase contrast microscope with a Nikon camera and quantified by NIH Image Software. The data was analyzed by student t test.

Matrigel invasion assay

The invasive behavior of Hs578T cells lacking HAS2 expression compared to HAS2 expressing cells was performed essentially as described before.33 Polycarbonate membrane inserts (6.5 mm, 8 μm pores) in Transwell 24 permeable supports (Costar, Corning) were layered with Matrigel matrix (basement membrane extract growth factor reduced, 7–11 μg protein/mm2; R&D Systems). The Matrigel-layered inserts were allowed to solidify for 30 min at at 37°C, in humidified 95% air and 5% CO2. Growth medium (0.6 ml/well) was added to the transwell unit, and the 48 hr transfected-cells with 100 nM of control siRNA or HAS2 siRNA were trypsinized, counted and plated on the unlayered or Matrigel-layered membrane inserts (1 × 105 cells per 100 μl growth medium); cell transfection, migration or invasion was performed in the absence or presence of 100 μg/ml hyaluronan (Mw 2.5 × 106). After 24 hr of incubation in a tissue culture incubator, media were removed and the polycarbonate filters with the migrating and invaded cells were washed once with PBS followed by fixation with 2.5% EM grade glutaraldehyde (Fluka) in PBS for 15 min at room temperature. Matrigel matrix and noninvading cells at the upper surface of the membrane were removed by wiping with a cotton swap. The migrating and invading cells on the underside of the membrane were stained with Giemsa solution for 30 min, rinsed in water and the membranes were removed from the insert by a scalpel blade. After dehydration through graded alcohols, the membranes were mounted onto glass slides. The invading cells were counted in 3 randomly selected fields of triplicate membranes, under the microscope at 200× magnification. The data is expressed as the percent invasion through the Matrigel-layered membrane relative to the migration through the unlayered one.

Results

Quantification of hyaluronan synthesizing capacity, and expression of mRNA for HAS and HYAL isoforms in a panel of breast cancer cell lines

We first assessed the levels of hyaluronan in 24 hr conditioned media derived from the highly invasive cell lines Hs578T, MDA-MB-231 and HTB-122, and the less invasive cell lines MCF-7 and ZR-75-1.34 As shown in Figure 1a, breast cancer cells exhibiting an invasive phenotype produce higher amounts of hyaluronan compared to less aggressive cell lines. To elucidate the contribution of the HAS and HYAL enzymes to the hyaluronan levels in the conditioned media, the gene expression profiles of HAS1, HAS2 and HAS3, as well as HYAL1 and HYAL2, were investigated using real-time PCR. The relative expression levels of HAS and HYAL mRNAs, in comparison to the reference gene GAPDH, are depicted in Figure 1b. ZR-75-1, HTB-122 and MCF-7 cells expressed about 24-fold, 38-fold and 3-fold higher levels of HAS1 mRNA, respectively, compared to HAS1 mRNA transcript levels in Hs578T and MDA-MB-231 cells (mRNA expression level relative to GAPDH = 0.006 × 10−3). Notably, HAS2 mRNA was abundantly expressed in Hs578T, MDA-MB-231, as well as in the HTB-122 cells, at levels about 80-, 8- and 20-fold, respectively, over the levels in MCF-7 cells (mRNA expression level relative to GAPDH = 0.05 × 10−3). The relatively high transcriptional activities of HAS3 (mRNA expression level relative to GAPDH = from 0.6 × 10−3 to 1.7 × 10−3) and HYAL2 (mRNA expression level relative to GAPDH = from 3.2 × 10−3 to 11.4 × 10−3) genes differed only slightly among the breast cancer cells examined, except for the more elevated signals in ZR-75-1 cell cultures. The expression of HYAL1 mRNA, although almost undetectable in Hs578T, MDA-MB-231, HTB-122 and MCF-7, was high in ZR-75-1 cells (mRNA expression level relative to GAPDH = 5.0 × 10−3). Thus, the high hyaluronan content in the conditioned media of Hs578T cells is likely to be dependent primarily by the balanced expression of HAS2, HAS3 and HYAL2.

Figure 1.

Quantification of hyaluronan production and relative expression levels of HAS and HYAL transcripts. (a) The amount of hyaluronan in 24 hr conditioned media (4.5 × 104 cells/well in 12-well plates) was measured using a microtiter-based assay, as described in Material and methods section. Columns depict the average of duplicates ± variation. (b) Using real time RT-PCR, as described in Material and methods section, the expression levels of HAS and HYAL mRNAs relative to GAPDH mRNA were determined in different breast cancer cell lines. Columns depict means of triplicate determinations ± SD. The data shown is a representative 1 of 2 separate experiments with similar results.

Silencing of the HAS2 gene in Hs578T cells induces HAS1 and HAS3 and HYAL1 transcripts

Several studies have implicated HAS2 expression in the promotion of tumor cell growth, both in vitro and in vivo.14, 32, 35, 36 On the basis of our finding that the aggressive Hs578T cells, which synthesize the highest amounts of hyaluronan among the 5 studied human breast cancer cell lines, predominantly expressed HAS2 mRNA (Fig. 1b), we investigated the consequences of suppression of HAS2 gene by designing specific HAS2 siRNA duplexes; transfection of cells by 100 nM of siRNA duplexes targeted to different sites of HAS2 cDNA caused about 50% reduction of hyaluronan amount released into the 48 hr conditioned media compared to control siRNA (Fig. 2a). Notably, 100 nM of the HAS2 siRNA led to HAS2 transcript suppression of about 85% (Fig. 2b), and to an about 50% reduction of hyaluronan content (Fig. 2c) compared to control siRNA. Similar results were obtained even after extended incubation, up to 96 hr after transfection (data not shown). The HAS2 siRNA-mediated strong reduction of HAS2 mRNA and its ability as well as the ability of 3 other HAS2 siRNAs (each one targeted to different sequences of HAS2 mRNA sequence) to suppress in a similar manner the production of hyaluronan, confirm the specific nature of the siRNA silencing used.

Figure 2.

Effects of siRNA-mediated knock-down of HAS2 on hyaluronan synthesis, and the expression levels of HAS1 and HAS3, and HYAL1 and HYAL2 transcripts. Panel (a) shows the hyaluronan content in 48 hr conditioned media (3.5 × 105 cells/well in 6-well plates) from HAS2 expressing and HAS2 lacking Hs578T cells. Control siRNA (100 nM) or HAS2 siRNA (100 nM) molecules targeting sequences from 4 different parts of the HAS2 cDNA sequence were used for transfection (no 1, 1402–1420; no 2, 1043–1061; no 3, 1617–1637; no 4, 1671–1691). In both (b) and (c) Hs578T cells were transfected with 50, 100, or 200 nM of HAS2 siRNA (no 4) or control siRNA, and cultured for 48 hr in complete medium, as described in Material and methods section. Panel (b) shows the fold-change difference of HAS2 mRNA and (c) the amount of hyaluronan in conditioned media, in cells treated with HAS2 siRNA relative to control siRNA-treated cells (arbitrarily set to 1). Data shown are means of triplicates ± SD (b), and the average of duplicates ± variation (c), from 2 experiments with similar results. (d) Total RNAs were extracted from Hs578T cells transfected with 100 nM of HAS2 siRNA (no 4) or control siRNA, and the expression levels of mRNAs for HAS and HYAL isoforms were quantified by real-time RT-PCR, as described in Material and methods section. The relative expression levels of HAS and HYAL genes in control siRNA treated cells was set as 1. The data shown is the mean of triplicates ± SD of a representative experiment out of 3 performed with similar results. White columns, HAS2 siRNA-treated cells; black columns, control siRNA-treated cells.

Notably, using real-time PCR we found that down-regulation of HAS2 mRNA levels led to a robust increase of HAS1 mRNA (about 15-fold). Furthermore, two-fold increases in both HAS3 and HYAL1 transcript levels were detected (Fig. 2c). However, the amount of HYAL2 mRNA did not change. These observations suggest that the invasive breast cancer cell line Hs578T, upon deprivation of HAS2 mRNA, evoked mechanisms to maintain hyaluronan production.

Silencing of HAS2 in Hs575T cells results in hyaluronan synthesis of lower molecular mass

Given the intriguing observation that silencing of the HAS2 mRNA promoted the up-regulation of mRNAs for HAS1 and HAS3, as well as HYAL1, we determined the size of hyaluronan synthesized by HAS2 siRNA-transfected Hs578T breast cancer cells by Sephacryl HR size exclusion chromatography. As shown in Figure 3a, the Hs578T cells transfected with control siRNA synthesized preferentially high molecular weight hyaluronan of an average of 2.9 × 106, whereas silencing of HAS2 in tumor cells resulted in the reduction of both the amount and size of hyaluronan chains released into the conditioned media (about 1 × 106; first peak, Streptomyces hyaluronidase sensitive material). A second peak of a molecular weight lower than 0.46 × 106 was insensitive to Streptomyces hyaluronidase, and thus considered to represent other glycosaminoglycans. The relative proportion of the glycosaminoglycans was only slightly affected by inhibition of the HAS2 mRNA. Thus, silencing of the HAS2 gene lead to reduced synthesis of hyaluronan molecules of apparently smaller size, either because the hyaluronan was synthesized by HAS1 and HAS3, which are known to synthesize hyaluronan of lower molecular weight than HAS2,9 and/or because the amount of hyaluronidase activity was increased.

Figure 3.

HAS2 gene silencing leads to production of hyaluronan molecules of reduced length but does not affect its localization in Hs578T breast cancer cells. (a) Control siRNA- or HAS2 siRNA-transfected (100 nM,) Hs578T cells were labeled with [3H] glucosamine for 24 hr, and the synthesized hyaluronan and other glycosaminoglycans in the conditioned media were subjected to size exclusion chromatography on a Sephacryl-HR column (100 × 1 cm), as described in Material and methods section. Circles, untreated material; triangles, Streptomyces hyaluronidase treated material. Closed symbols, control siRNA-transfected cells; open symbols, HAS2 siRNA-transfected cells. The arrows show the elution positions of different hyaluronan molecular weight markers. (b) Hs578T cells were stained for hyaluronan following 48 hr transfection with 100 nM of HAS2 siRNA or control siRNA; untreated or Streptomyces hyaluronidase-treated (2 U/ml for 10 min) paraformaldehyde-fixed cells were permeabilized or not with 0.15% Triton X-100, and incubated at 37°C for 1 hr with 5 μg/ml biotin-HABP followed by Alexa Fluor 488 conjugated streptavidin, as described in Material and methods section. The slides were visualized under a Zeiss fluorescence microscope (×40 magnification).

Furthermore, we investigated whether HAS2 silencing affects the amount and localization of cell-associated hyaluronan. The intensity of hyaluronan staining was stronger in permeabilized Hs578T cells transfected with nonsilencing HAS2, than the nonpermeabilized ones (Fig. 3b). Notably, removal of the cell surface-associated hyaluronan with Streptomyces hyaluronidase prior to permeabilization did not completely abolish the staining for cell-associated hyaluronan, indicating that a part of hyaluronan resides within the tumor cells. As expected, the staining of hyaluronan in permeabilized HAS2 siRNA-transfectants was much less compared to the cells transfected with nonsilencing siRNA; also in these cells, a portion of hyaluronan was detected inside the cells, as ascertained by the weak staining remaining after Streptomyces hyaluronidase treatment. The data suggest that the Hs578T breast cancer cells have both a pericellular and an intracellular pool of hyaluronan, and that the endogenously produced hyaluronan is accumulated predominantly in the cytoplasm with or without HAS2 gene suppression.

We next investigated the consequence of HAS2 gene suppression on the total CD44 expression levels and cell surface CD44 hyaluronan binding capacity (Fig. 4). Western blot analysis revealed a slight decrease of the total CD44 molecules in Hs578T cells deprived of HAS2 mRNA compared to that of tumor cells expressing HAS2 mRNA. The predominant CD44 isoforms expressed had molecular masses of 80–95 kDa (Fig. 4a). Since hyaluronan mediates its signaling effects through binding to cell surface receptors, we next determined the binding capacity of [3H]hyaluronan on cells expressing high versus low HAS2 mRNA levels (Fig. 4b). The control siRNA transfectants exhibited a slightly higher capacity to bind [3H]hyaluronan than the HAS2 siRNA transfectants. To investigate whether cell surface CD44 molecules mediate [3H]hyaluronan binding, Hermes-1 antibodies, which block the binding of hyaluronan to CD44, were used. About 80% inhibition of the specific binding of [3H]hyaluronan was detected in the presence of blocking Hermes-1 antibodies, suggesting that the CD44 molecules on the cell surface are the major hyaluronan binding sites on Hs578T cells.

Figure 4.

CD44 expression and hyaluronan binding capacity of Hs578T wild-type and transfected cells. (a) Cell lysates (20 μg protein per well) from wild-type Hs578T cells, as well as HAS2 siRNA- and control siRNA-transfectants, were subjected to SDS-PAGE using 10% polyacrylamide gels, followed by immunoblotting with monoclonal Hermes-1 antibodies (5 μg/ml). (b) Specific cell surface hyaluronan receptors on HAS2 siRNA- and control siRNA-transfected HS578T cells were determined by incubating the cells with 0.25 μg/ml [3H] hyaluronan in the absence or presence of blocking antibodies, Hermes-1 (100 μl/ml, serum-free supernatant), as described in Material and methods section. Specific binding was determined by subtraction of the radioactivity retained when high molecular weight nonlabeled hyaluronan was added into each sample in excess (100 μg/ml). The data shown are the mean of duplicate ± variation from a representative of 3 separate experiments with similar results.

HAS2 mRNA silencing reduces cellular growth

To investigate further the importance of HAS2 gene silencing, and the subsequent suppression of hyaluronan synthesis, for the tumorigenicity of the Hs578T breast cancer cell line, we studied the growth rates of the nonsilencing siRNA- and HAS2 siRNA-transfectants. We used a soft agar assay to determine the anchorage-independent growth of the cells, which reflects the malignant phenotype of cells in vitro.37 We observed that the Hs578T cells treated with HAS2 siRNA formed about 40% smaller colonies compared to cells transfected with control siRNA, and parental Hs578T cells (Fig. 5a). However, no obvious differences in the number of clones were detected (data not shown). To further assess the role of HAS2 silencing for the proliferative capacity of Hs578T breast cancer cells, we analyzed their cell cycle profile using flow cytometry (Fig. 5b). At 48 hr after silencing of the HAS2 gene, a significantly higher proportion of cells were in G1 phase (52.0% ± 2.3%) compared to the mock-transfected cells (42.6% ± 2%). In contrast, HAS2 siRNA-transfectants had a significantly lower proportion of cells both in S phase (21.4% ± 1.6%) and G2/M phase (26.6% ± 2%) compared to non-silencing siRNA-transfectants (25.3% ± 2.9% in S and 31.0% ± 3% in G2/M phase). These data are consistent with a slower proliferation rate of Hs578T cells expressing low amounts of HAS2 mRNA.

Figure 5.

Effects of HAS2 gene suppression on soft agar colony formation, distribution of cells in various stages of the cell cycle and cell growth. (a) Untransfected, HAS2 siRNA- and control siRNA-transfected cells were grown in soft agar, as described in Material and methods section. The diameter of colonies larger than 0.6 arbitrary units was calculated in 20 randomly selected fields per well using the NIH image program. The data shown are means ± SEM from one representative of 3 separate experiments with similar results. (b) Synchronized Hs578T cells transfected with control siRNA (black columns) or HAS2 siRNA (white columns) were analyzed for their cell cycle profiles, as described in Material and methods section. HAS2 siRNA-transfectants had a lower portion in S-phase and G2/M phase (*, p < 0.05) and a higher portion in G1-phase compared with control siRNA-transfectants (**, p < 0.01). Data shown is the mean of triplicates ± SD of a representative experiment from 3 separate experiments. Panels (c) and (d) show cell growth at different time points after transfection. In panel (c), the cell numbers of HAS2 siRNA-transfected cells (solid line, open circles) alone or in the presence of 100 μg/ml hyaluronan (dotted line, open triangle), as well as control siRNA-treated cells (solid line, closed circles) alone or in the presence of 100 μg/ml hyaluronan (dotted line, closed triangle) were measured at 2, 4, 6 and 8 days after transfection. In panel (d), the cell number was measured 6 days after transfection with 100 nM of control siRNA or of each 1 of 2 different HAS2 siRNAs (no 2 or no 4), in the absence or presence of various concentrations of exogenously added hyaluronan (1–50 μg/ml). Data represent the mean of triplicates at each time point ± SD from one representative experiment out of 3 separate experiments. *, significantly different (p < 0.05) from control siRNA-treated cells.

To further evaluate the importance of HAS2 silencing in cell proliferation, the number of cells expressing or lacking HAS2 was investigated at different time points after the start of the transfection (Fig. 5c). No obvious differences between control cells and HAS2 siRNA-treated cells in the growth rate of subconfluent cultures (up to about 50% of confluency, reached at day 2), was observed. However, in confluent Hs758T cultures (at day 4 and after) the suppression of HAS2 gene caused about a 2-fold lower proliferation rate compared to control siRNA-transfectants. Addition of 100 μg/ml of exogenous hyaluronan had no effect on their proliferative capacities (Fig. 5c). The importance of exogenous hyaluronan, in a concentration-dependent manner, to rescue the growth kinetics of tumor cells lacking HAS2, was further investigated using cultures at 6 days after transfection with siRNAs targeted to different sites in HAS2 mRNA (no 2 and no 4) or control siRNA (Fig. 5d). Again, the proliferative capacity of each one of the two HAS2 siRNA-transfectants were similarly lowered in comparison to control cells, and the inclusion into the culture media of low or high amounts of hyaluronan (1–50 μg/ml) had no effect. Notably, the hyaluronan content in 48 hr conditioned media from the 2 different HAS2 siRNA-transfectants was half as much as from control siRNA-transfectants (data not shown). These observations indicate that HAS2 mRNA suppression decreases the malignant phenotype of Hs578T cells and that inclusion of exogenous hyaluronan into the culture medium did not restore their growth kinetics.

The effect of silencing of HAS2 on cell growth prompted us to investigate, by immunoblotting, the relation between HAS2 gene silencing and the expression levels of proteins in the cytoplasm that control cell cycle progression. The analysis revealed that the expressions of cyclin A and B, and cdc2 p34, which are important for cells to complete the cell cycle, were considerably decreased in HAS2 siRNA-transfectants compared to wild-type or nonsilencing siRNA-transfected Hs578T cells (Fig. 6a). No significant changes in the expression levels of negative regulators of the cell cycle (p16 and p21) were observed. These results suggest that the low proliferation rate of HAS2-silenced cells involves suppression of mitotic cyclins A and B, and cdc2 p34 kinase. Then, we investigated whether addition of exogenous hyaluronan could counteract the suppression of the cell cycle regulators caused by silencing the HAS2 gene. As shown in Figure 6a, exogenously added hyaluronan partially restored the expression of the cdc2 p34. Notably, overexpression of HAS2 by transfection led to significant increase in the expression levels of cyclins A and cyclin B (Fig. 6b), suggesting that hyaluronan synthesized by the tumor cells stimulates traverse through the cell cycle. Thus, HAS2-mediated hyaluronan synthesis stimulates the growth of breast tumor cells.

Figure 6.

HAS2 gene silencing suppresses whereas HAS2 overexpression as well as addition of intact or fragmented hyaluronan induces the expression of positive regulatory cell cycle proteins. (a) HAS2 siRNA-treated cultures in the absence or presence of various amounts of hyaluronan or control siRNA treated cells, and wild type Hs578T cells were cultured in complete medium, lysed and subjected to SDS-PAGE followed by transfer to a nitrocellulose membrane as described in Material and methods section. Regulatory cell cycle proteins were determined by immunoblotting with 2 μg/ml of monoclonal antibodies against cyclin A, cyclin B, Cdc2 p34, p21 and a polyclonal antibody against p16. Expression of α-actin was used as the invariant control. (b) as in (a), but HAS2 overexpressing HS578T cells or mock-transfectants were examined. (c) as in (a), but wild type cells were cultured in medium containing 0.1% FBS in the absence of presence of intact or fragmented hyaluronan. The data shown are representative of 2 experiments with similar results.

The constitutive expression of cyclins A and B, and cdc2 p34 was high even in wild-type Hs578T cells cultured under starvation condition (0.1% FBS; Fig. 6c). Notably, addition of exogenous hyaluronan or hyaluronan oligosaccharides (a mixture of 12–20 monosaccharide units; Fig. 6c) into the medium of starved wild-type cells strongly increased the expression levels of cyclin B; in addition, hyaluronan fragments promoted the expression of cyclin A, a result not observed after the addition of high molecular weight hyaluronan. Furthermore, neither high nor low molecular weight hyaluronan exerted any effect on the expression of the negative regulators of the cell cycle. The effects of the exogenously added high molecular weight or fragmented hyaluronan were not apparent when cells were cultured in complete medium (data not shown).

Suppression of HAS2 slows down both the migratory and invasive capacities of Hs578T cells

We also compared the motility of Hs578T cells treated with HAS2 siRNA or control siRNA, using a cell culture wounding assay (Fig. 7) and a Transwell permeable support assay (Table II). As shown in Figure 7a, HAS2 siRNA-transfectants exhibited about 50% lower migration capacity than control siRNA-transfectants. To investigate whether CD44 was implicated in the migration, Hermes-1 antibodies that specifically block the binding of hyaluronan to CD44 were added. Hermes-1 suppressed the migratory capacity of control siRNA-transfectants during the wound closure over a 28 hr period by about 27% compared to control siRNA treated cells (Fig. 7b). Thus, hyaluronan-CD44 interactions are partially involved in the regulation of breast cancer cell migration, but most likely also other hyaluronan receptors and other mechanisms are involved in mediating Hs578T cell migration. We then investigated if exogenously added high molecular weight hyaluronan could restore the migratory ability of HAS2-deprived cells. Cells separately transfected with two HAS2 siRNAs, no 2 and no 4, migrated about half as much slower than these tumor cells expressing HAS2, but the inclusion of exogenous hyaluronan at various concentrations into the culture media did not restore cell migration (Fig. 7c). In agreement with the results of this wounding assay, HAS2 expressing Hs578T cells migrated through the unlayered polycarbonate membrane inserts at least 2-fold faster than the HAS2 deprived cells, independently of the presence of exogenously added hyaluronan (Table II).

Figure 7.

HAS2 suppression reduces cell migration. Following 48 hr of incubation with control siRNA or HAS2 siRNA, Hs578T cells (4 × 105 cells/well in 6-well plates) were subjected to an in vitro wounding assay. After scratches were made in cultures and washings, the cells were incubated in complete medium in the absence (a) or presence (b) of 50 μg/ml Hermes-1, as well as in the absence or presence of 1, 5 or 50 μg/ml hyaluronan (2.5 × 106 Da) (c). Then, at different time points, the wound closure was quantified by NIH Image 1.63 software, at 4 wound gap positions along the wound, and statistically analyzed by student t test; in panel (c), the effects of HAS2 silencing on cell migration by 2 different HAS2 siRNA molecules, 28 hr after the scratch, is shown. Each value depicts means of 4 measurements ± SD. *, significantly different from HAS2 siRNA-transfectants cultured in the absence of exogenous added hyaluronan (p < 0.05); **, significantly different from control siRNA- or HAS2 siRNA- transfectants (p < 0.01). Black columns, control siRNA-treated cells; white columns, HAS2 siRNA-treated cells.

Table II. Effect of HAS2 Gene Silencing on the Invasive Potential of Hs578T Cells
HyaluronanCell number
HAS2 siRNAControl siRNA
++
  • Unlayered and Matrigel-layered polycarbonate membranes (8 μm pore size) in Transwell 24 units were used for the invasion assay as described in Material and methods section. Values represent the average of triplicates of a representative experiment out of two ± SD.

  • 1

    equation image

Matrigel-layered inserts (invading cells)25 ± 322 ± 3144 ± 14107 ± 15
Unlayered inserts (migratiung cells)156 ± 9136 ± 6323 ± 23313 ± 16
% Invasion116.216.235.334.3

To investigate whether HAS2 is important for the invasive property of Hs578T cells, we subjected cells treated with control siRNA or HAS2 siRNA to an in vitro invasion assay in which cells invade through a Matrigel matrix layered on top of the 8 μm porous membrane inserts. We found that the HAS2-deprived tumor cells invaded the Matrigel matrix less than half as efficiently as HAS2 expressing cells (Table II). Hyaluronan inclusion into the media had no effect on breast cancer cell invasion. These results indicate that HAS2 is a critical component of Hs578T cells migratory and invasive behavior.

Discussion

In this study, we show that upon silencing of the HAS2 gene, the invasive and malignant phenotype of the Hs578T breast cancer cell line is significantly decreased. The reduction of the aggressive characteristics of this cell line was manifested by a lower growth rate under both anchorage-dependent and anchorage-independent conditions, and suppression of the migratory and invasive phenotype. Interestingly, tumor Hs578T cells expressing low copy numbers of HAS2 mRNA showed increased expressions of HAS1 and HAS3, and HYAL1 genes, i.e. compensatory mechanisms, which led to a net reduction in hyaluronan production of only about 50%, but the hyaluronan chains produced were considerably smaller than those synthesized by HAS2 mRNA expressing cells. Notably, siRNA-mediated knock-down of HAS2 had no effect on HYAL2 mRNA expression (Fig. 2c), and only slightly decreased the CD44 protein levels, as well as its specific hyaluronan binding capacity (Fig. 4). In contrast, antisense HAS2 inhibition in the highly metastatic MDA-MB-231 cell line led to a significant suppression of CD44 and HYAL2 genes, but had no effect on the other HAS genes.16 Our findings, together with previous reports, suggest that HAS2 gene expression is important for maintenance of the malignant phenotype of breast cancer cells. Moreover, there appears to be a coordinated expression of genes encoding HAS and degrading enzymes, as well as CD44 hyaluronan receptors.

Quantification of HAS and HYAL mRNA in a panel of breast cancer cell lines demonstrated a correlation between HAS2 expression and aggressive breast tumor cell phenotype, whereas HAS1 and HYAL1 expression occurred in tumor cells of low invasive potential (Fig. 1b). Although HAS3 and HYAL2 mRNAs were expressed by all breast cancer cells investigated, independently of their degree of aggressiveness, they were most profoundly expressed by the noninvasive ZR-75-1 cell line. However, the relatively higher expression levels of HAS2 and HYAL2 mRNA, compared to other genes involved in hyaluronan turnover, are consistent with a dominant role of these 2 genes in the advancement of human breast carcinomas. Also Udabage et al.,38 observed that HAS2 and HYAL2 genes are implicated in breast tumor cell proliferation and invasiveness. In the present study, we clearly demonstrated a central role of HAS2 gene expression for the survival and proliferation of Hs578T tumor cells, since its silencing suppressed cellular proliferation, anchorage-independent growth and expression levels of positive regulator proteins of the cell cycle. In contrast, HAS2 overexpression promoted the expression of cell cycle regulators (Fig. 6b). Studies by us and other laboratories revealed that HAS2 is the most highly differentially regulated HAS isoform in response to growth factors.39, 40 A large number of studies have shown that hyaluronan promotes the growth of both normal and malignant cells. In particular, endogenous hyaluronan has been shown to regulate ErbB2 signaling and consequently it can promote embryonic morphogenesis or the malignant properties of tumor cells.10, 41, 42

siRNA-mediated knock-down of HAS2 caused lower hyaluronan production and suppression of cell growth and migration whereas addition of exogenous hyaluronan only partially restored cyclin B expression, and did not restore growth and migration of the Hs578T cells. We consider it unlikely that this lack of rescue is due to off-target effects of the siRNA used, since we obtained the same results using 2 different siRNA molecules targeting sequences from different parts of the HAS2 mRNA sequence. It is likely that exogenous addition of hyaluronan is not equivalent to endogenously produced hyaluronan, which possibly show a different cellular localization because of its interactions with the HAS molecule itself,43 and the intracellular hyaluronan binding proteins cdc3744 and RHAMM,45 interactions that might not be mimicked by exogenously added hyaluronan. Our results are consistent with those of other studies in which exogenously added hyaluronan did not rescue the growth of prostate cancer cells deprived of hyaluronan synthesis.15 Moreover, whereas endogenous hyaluronan has been found to promote the activation of several tyrosine kinase receptors including the PDGF β-receptor,46 we recently found that exogenous hyaluronan inhibits the PDGF β-receptor.47

Ample evidence support that there is an interplay between a tumor and its environment, which is important in tumor progression and aggressiveness. Our finding that HAS2 silencing in Hs578T breast cancer cells suppresses their motility and invasive potential to about half of that of HAS2 expressing cells (Fig. 7a, Table II) indicate that hyaluronan appears to be an integral component of breast carcinoma motility and invesiveness,48 which could be linked to lymph node and hematogenous distant metastases. However, it is possible that hyaluronan in the extracellular matrix function as a linker between CD44 expressing tumor cells and CD44 expressing vessel endothelial cells or lymphatic endothelial cells, which express the hyaluronan receptors CD44 and LYVE1, respectively,49, 50 but it could also function in a cell-surface independent manner by creating a malleable matrix that promote migration. Notably, the noninvasive behavior of ZR-75-1 and MCF-7 breast cancer cell lines tightly correlated with low CD44 expression and low hyaluronan production.5, 38 It should also be noted that siRNA-mediated knock-down of HAS2 caused about a 50% reduction of migration, so there are most likely also nonhyaluronan-mediated mechanisms involved.

Our findings in this study and those of Udabage et al.16, 38 predict that HAS2 has an important role in breast cancer progression, and that HAS2 cooperates with HYAL2 and the hyaluronan receptor CD44, suggesting that these molecules are critical for the aggressive character of breast cancer cells. Further studies are warranted on the molecular mechanisms that regulate the expression of HAS and HYAL isoforms, as well as hyaluronan receptors in breast carcinomas, to explore their usefulness as potential targets for tumor therapy.

Acknowledgements

The authors thank professor C.-H. Heldin for constructive criticism of this work.

Ancillary