SEARCH

SEARCH BY CITATION

Keywords:

  • apoptosis;
  • chemoresistance;
  • xenograft;
  • antisense

Abstract

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

A hallmark of cancer cells is an ability to evade apoptosis. Overexpression and/or activating mutations of prosurvival molecules such as the X-linked inhibitor of apoptosis (XIAP) contribute to this inappropriate cell survival. Our objectives were to investigate the effects of downregulation of XIAP in ovarian cancer cells in vitro and in vivo using the clinical candidate antisense oligonucleotide against XIAP, AEG35156 (AS XIAP). Three ovarian cancer cell lines were transfected with AS XIAP in vitro, and the effects on cell survival were assessed. Downregulation of XIAP resulted in significant apoptosis. To investigate the in vivo efficacy of AS XIAP, CD-1 nude mice were xenografted intraperitoneally with A2780-cp cells, treated with intraperitoneal AS XIAP and evaluated for survival time and tumor histology. Mice treated with 10 mg/kg/day AS XIAP showed a significant improvement in survival time compared to animals treated with control oligonucleotides. Histological analysis of the tumors showed significantly fewer viable cells in the AS XIAP-treated tumors. Downregulation of XIAP expression in ovarian cancer cells resulted in apoptosis in vitro and a prolonged survival time of ovarian cancer-bearing mice, which indicate that XIAP may be a valuable therapeutic target in ovarian cancers, and supports the ongoing clinical investigation of AEG35156. © 2007 Wiley-Liss, Inc.

Ovarian cancer is the most lethal of the gynecologic malignancies and this is due in large part to the resistance of recurrent ovarian cancer cells to standard chemotherapeutic strategies. Resistance to apoptotic cell death is a fundamental characteristic of cancer cells, and a primary cause of treatment failure. A critical step in apoptosis is the activation of cysteine-dependent aspartate-specific proteases, the caspases. Once activated, the caspases are responsible for DNA fragmentation and cleavage of numerous critical proteins. Because of the pathological consequences of deregulated apoptosis, the activation of caspases is under direct and stringent regulation by the inhibitors of apoptosis [IAPs; reviewed in Ref.1].

X-chromosome-linked IAP (XIAP), the most potent member of the IAP family, binds directly to and blocks the activity of caspase-3, -7 and -9, as well as interferes with the BAX/cytochrome c cell death pathway.2, 3 It is overexpressed in a variety of cancers, including ovarian,4–6 and there is accumulating evidence that XIAP is a major contributor to chemoresistance in ovarian cancer cells. Specifically, downregulation of XIAP expression in ovarian cancer cells increased the sensitivity of the cells to cisplatin- and docetaxel-induced cell death.7–9 Studies on the efficacy of antisense oligonucleotides against XIAP (AS XIAP) in vivo show that AS XIAP treatment significantly impeded tumor growth or caused tumor regression in xenograft models representing several types of cancer (prostate, lung, colon and breast) when administered either as a single agent or in combination with clinically-relevant chemotherapy.10, 11 The therapeutic effect of antisense knockdown of XIAP in ovarian tumor models has not yet been evaluated.

Herein, we report that downregulation of XIAP expression using antisense oligonucleotide AEG35156 significantly increases cell death of ovarian cancer cells in vitro, in the absence or presence of wild-type p53. Furthermore, we extended these findings to the in vivo setting and demonstrate for the first time that AS XIAP treatment prolongs animal survival and reduces tumor viability in an ovarian cancer xenograft model.

Material and methods

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Cell culture

The following cell lines were used in this study: A2780-s (cisplatin-sensitive parental line) and A2780-cp (a cisplatin-resistant cell line established by stepwise exposure of A2780-s cells to increasing doses of cisplatin) from Dr. Molepo (Ottawa, ON, Canada) and ES-2 human ovarian carcinoma cells from Dr. J. Bell (Ottawa, ON, Canada). For maintenance, all 3 cell lines were cultured in DMEM plus 2.5% fetal calf serum, 7.5% donor bovine serum and 1% nonessential amino acids. Transfection of the cells with oligonucleotides was facilitated by Oligofectamine in Opti-MEM (Gibco BRL, Burlington, ON, Canada) according to manufacturer's instructions. Specifically, the antisense oligonucleotides against XIAP (AEG35156, AS XIAP; Aegera Therapeutics, Montreal, PQ, Canada) were mixed-backbone, fully phosphorothioated 19-mers with 4 2′O-methyl RNA residues at both the 5′ and 3′ ends and a central core of 11 DNA residues. The scrambled control (AEG35187) had the same base composition and thus the same molecular weight as the parent compound.

Western blot analyses

To confirm successful knockdown of XIAP expression and to analyze Caspase 3 and poly-ADP ribose polymerase (PARP) cleavage characteristic of apoptotic cell death, protein lysates were extracted in RIPA buffer according to the manufacturer's instructions (Upstate Cell Signalling Solutions, Waltham, MA). Denatured protein samples (50 μg) were separated on NuPAGE precast gels (Invitrogen Life Technologies, Burlington, ON, Canada) and transferred to nitrocellulose membranes. Membranes were blocked in 5% skim milk in TBS/T (180 mM NaCl, 10 mM Tris, 0.05% Tween 20) for 1 hr at room temperature prior to incubation with the primary antibody overnight at 4°C. Specifically, a mouse monoclonal antibody to GAPDH (Abcam, Cambridge, UK) was used at a dilution of 1:2,000, a rabbit polyclonal antibody to RIAP3 [Aegera Therapeutics12] was diluted 1:500 and mouse monoclonal antibodies to Caspase 3 or PARP (Cell Signaling Technology, Danvers, MA) were diluted 1:1,000. Membranes were blotted according to standard protocols, with the following horseradish peroxidase-conjugated IgG secondary antibodies: anti-mouse (KPL, Gaithersburg, MD; 1:5,000); and anti-rabbit (Cedarlane Laboratories, Hornby, ON, Canada; 1:5,000). Visualization of protein bands was performed using an enhanced chemiluminescence detection system (LumiGLO; KPL) and Kodak X-Omat Blue XB-1 film (Rochester, NY).

Cell counts

Equal numbers of cells were plated in 6 wells of a 12-well plate on Day 1 and allowed to adhere overnight. The first transfection was conducted on Day 2. In the morning of Day 3, all cells from each well were replated in wells of a 6-well plate and allowed to adhere for ∼6 hr. A second transfection was conducted in the afternoon of Day 3, based on a previous report of efficient knock-down with this strategy.10 On Day 4, adherent cell numbers were determined by Coulter counter.

DNA sequence analysis of p53

Following trypsinization, A2780-s and A2780-cp cells (∼1 × 106) were resuspended in DNA extraction buffer (250 μl; 10 mM Tris/0.1 M EDTA/0.5% SDS/20 μg/ml proteinase K) and incubated at 58°C overnight. DNA was precipitated by a standard protocol using saturated sodium chloride and isopropanol. The DNA pellet was washed once with 75% ethanol and resuspended to a final concentration of 100 ng/μl in Tris-EDTA (50 mM, pH 6.8).

PCR for p53 was performed as follows: the 50 μl PCR reaction contained 1 μl DNA (at 100 ng/μl), 20 pmol of each primer (p53U: 5′ CTCTTCCTGCAGTACTCCC-CTGC 3′; p53D: 5′ GCCCCAGCTGCTCACCATCGCTA 3′), 100 μM dNTPs, 1.5 mM MgCl2, 1× Advantage PCR Buffer and 5 U AdvanTaq DNA polymerase (BD Biosciences, Palo Alto, CA). The protocol had an initial 3 min denaturation at 94°C, followed by 35 cycles of 94°C for 30 s, 66°C for 45 s and 72°C for 90 s, and a final elongation at 72°C for 7 min. PCR products were separated by electrophoresis on a 1.0% agarose gel and stained with ethidium bromide for visualization. As only a single band was visualized following PCR amplification, the PCR products were sent directly for sequencing by the Ottawa Health Research Institute Ontario Genomics Innovation Centre (Ottawa, ON, Canada).

Animal studies

All animal experiments were performed according to the Guidelines for the Care and Use of Animals established by the Canadian Council on Animal Care. Female CD-1 nu/nu mice (Charles River Laboratories; Wilmington, MA) aged 6–8 weeks were housed with free access to food and water. A2780-cp cells (1 × 107) were resuspended in 500 μl of phosphate-buffered saline and injected with a 25-gauge needle intraperitoneally (IP) into at least 8 mice per treatment group per experiment on Day 0. IP antisense oligonucleotide treatment (10 mg/kg or 25 mg/kg) began on Day 7 and continued for 6 weeks (5 days on, 2 days off, as previously described10). Disease progression was monitored based on overall health until a predetermined endpoint was reached. Survival time reflects the time required for the animals to reach any endpoint(s), including weight gain/loss exceeding 20%, anorexia and/or diarrhea.

Histological analysis of tumors

Tumor samples were fixed in 10% buffered formalin (VWR, Mississauga, ON, Canada) for 6–24 hr, paraffin-embedded and sectioned at 5 μm for hematoxylin and eosin (H&E) staining according to standard protocols. Slides were analyzed by microscopy (Zeiss Axioskop2; Northern Eclipse Imaging Software Version 6.0, Empix Imaging, Mississauga, ON, Canada) or scanned at 600 dpi, 3× magnification with an Epson Perfection 2450 Photo Scanner, and the resulting images were analyzed for the quantity of hematoxylin-positive pixels (indicative of live cells) relative to total number of pixels in the tumor using Adobe Photoshop Software as previously described.13

Statistical analyses

All cell count values are from at least 3 independent experiments in triplicate and are expressed as the mean ± standard error of the mean (SEM). The probabilities of significant differences upon comparison of the 2 groups (scrambled control vs. AS XIAP-treated) were determined by 2-tailed paired Student's t-tests. Kaplan-Meyer survival curves were plotted using GraphPad Prism software (version 4.0; GraphPad, San Diego, CA) and were compared using a log-rank test. In the analysis of the tumor sections for the proportion consisting of viable cells, one outlier determined by the Quartile/Fourth Spread method was removed from the control group. Significance for all comparisons was inferred at p < 0.05.

Results

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

AS XIAP transfection decreased XIAP protein expression in ovarian cancer cell lines

Three ovarian cancer cell lines were transfected with mixed-backbone, fully phosphorothioated 19-mer antisense oligonucleotides against XIAP, or a scrambled control of the same base composition, and analyzed by western blot for XIAP expression. Our results show that expression was substantially decreased following transfection with AS XIAP (Fig. 1).

thumbnail image

Figure 1. Transfection of ovarian cancer cells with antisense oligonucleotides against XIAP (AS XIAP) decreased XIAP expression. A2780-cp, A2780-s and ES-2 cells were transfected on 2 consecutive days with AS XIAP (+) or scrambled control oligonucleotides (−) using Oligofectamine. Twenty-four hours following the second transfection, cell lysates were collected and protein was analyzed by western blot for the expression of XIAP.

Download figure to PowerPoint

Downregulation of XIAP decreased ovarian cancer cell survival, independent of p53 status

To determine whether downregulation of XIAP expression would affect the survival of A2780-cp, A2780-s or ES-2 cells, equal numbers of cells were transfected with control or AS XIAP oligonucleotides on 2 consecutive days, and adherent cell number was determined by Coulter counter 24 hr following the second transfection. Cell number was significantly decreased by AS XIAP transfection. Specifically A2780-cp, A2780-s and ES-2 cell numbers were reduced relative to cells transfected with scrambled oligonucleotides by 43.3 ± 2.0%, 63.3 ± 7.6% and 21.4 ± 3.6%, respectively (p < 0.05; Fig. 2a). For all 3 cell lines, the number of cells originally plated far exceeded the number of adherent cells following AS XIAP transfection, which suggested that the reduction in cell number was attributable to apoptosis, as opposed to decreased cell cycle progression.14 This was confirmed by western blot analysis for Caspase 3 and PARP: 17 and 19 kDa Caspase 3 cleavage products became evident, and full-length PARP was noticeably reduced relative to GAPDH, in the AS XIAP- transfected population compared to the transfected control cells (Fig. 2b).

thumbnail image

Figure 2. AS XIAP induced ovarian cancer cell apoptosis. (a) A2780-cp, A2780-s, and ES-2 cells were transfected on 2 consecutive days with AS XIAP or control oligonucleotides using Oligofectamine. Adherent cell numbers were determined by Coulter counter 24 hr following the second transfection. Values represent mean viable cell number ± SEM for at least 3 independent experiments in triplicate (*, p < 0.05). (b) In order to confirm that the cell loss observed was attributable to apoptosis, cell lysates were collected 24 hr following the second transfection and analyzed by western blot for Caspase 3 and PARP cleavage, with GAPDH serving as a loading control. AS XIAP transfection resulted in a significant reduction in cell number and an increase in PARP cleavage and Caspase 3 activation (appearance of the 17/19kDa band) relative to scrambled oligonucleotide controls.

Download figure to PowerPoint

On the basis of previous reports that impaired cell survival from XIAP downregulation relies upon wild-type p53,9, 15 we sought to confirm that the p53 mutation previously reported for the A2780-cp cells was present in the population of cells used in this study.16 A single base pair missense mutation (G to T) resulting in a valine to phenylalanine amino acid substitution was confirmed at codon 172 by PCR amplification and sequencing (data not shown).

AS XIAP treatment prolonged the survival of A2780-cp xenograft mouse models

CD-1 nude mice were injected IP with 1 × 107 A2780-cp cells on Day 0, and treatment with AS XIAP or scrambled control oligonucleotides commenced on Day 7, when animals had established tumors, as determined by necropsy of a subset of animals (data not shown). Animals were treated IP with 10 or 25 mg/kg of AS XIAP or 25 mg/kg control oligonucleotide, reconstituted in saline, on a 5 days on/2 days off schedule for up to 6 weeks, as described.10 Kaplan-Meyer survival curves generated from a compilation of 3 identical experiments demonstrate a significant improvement in median survival time in animals treated with 10 mg/kg AS XIAP, relative to controls (51 vs. 81 days; p = 0.036; Fig. 3). The same trend was observed for the mice treated with the 25 mg/kg dose (51 vs. 67; p = 0.069). The number of mice in each arm of the survival curve is Control, n = 20; 10 mg/kg AS XIAP, n = 10; 25 mg/kg AS XIAP, n = 28.

thumbnail image

Figure 3. Antisense XIAP treatment improved the survival time of A2780-cp xenografted mice. Female CD-1 nu/nu mice were injected intraperitoneally (IP) with 107 A2780-cp cells on Day 0. Treatment commenced on Day 7 (5 days on, 2 days off, for 6 weeks) with 10 (dotted line; n = 10) or 25 (dashed line; n = 28) mg/kg/day of AS XIAP or scrambled control oligonucleotides (25 mg/kg/day; solid line; n = 20). The Kaplan-Meyer survival curves show the percentage of animals alive at the indicated time point after cell injection, from 3 compiled experiments.

Download figure to PowerPoint

AS XIAP treatment increased intratumoral cell death

Our observation that AS XIAP was able to improve animal survival time was substantiated by histological evaluation of the tumors. To compare the proportion of the tumors consisting of viable cells, digital images of tumor sections from control (n = 12) and 25 mg/kg/day AS XIAP-treated mice (n = 14) were analyzed using hematoxylin and eosin staining. The hematoxylin-positive areas were deemed to represent regions containing viable cells, whereas the regions staining positive for eosin were considered to contain no or very few viable cells. The proportion of hematoxylin-positive (viable) pixels in the image relative to the total number of pixels stained by either stain (Figs. 4a and 4b) revealed that AS XIAP-treated tumors had significantly less area occupied by viable cells than the control tumors (54.99 ± 4.1 vs. 68.03 ± 3.8, p = 0.031; Fig. 4c).

thumbnail image

Figure 4. Histological analysis showed significantly fewer viable cells in the AS XIAP-treated tumors. Immediately following necropsy, tumors were fixed for up to 24 hr in 10% buffered formalin, and paraffin-embedded. Sections (5 μm) were stained with H&E. Scanned images were analyzed for the number of hematoxylin-positive pixels (indicative of live cells; colored black in the right-hand panel of a and b) relative to total number of pixels in the tumor using Adobe Photoshop Version 8.0 computer software as previously described.13 Two examples are shown (a, scrambled oligonucleotide control; b, AS XIAP). (c) Following the removal of one outlier from the control group, as determined by the Quartile/Fourth Spread method, comparison of the mean number of pixels occupied by viable cells ± SEM in oligonucleotide control (n = 12) and 25 mg/kg/day AS XIAP-treated tumors (n = 14) revealed that AS XIAP treatment significantly decreased the portion of the tumor containing viable cells (*, p = 0.031).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

This study has found that downregulation of XIAP expression using antisense oligonucleotides significantly increased cell death of ovarian cancer cells in vitro. Furthermore, we extended this finding to the in vivo setting and demonstrated for the first time in an ovarian cancer xenograft model that AS XIAP treatment prolonged animal survival and reduced tumor viability. This is the first indication that decreasing XIAP expression can impair ovarian cancer cell survival, in the absence or presence of wild-type p53.

XIAP is a major player in counteracting normal apoptosis in many chemoresistant malignancies and based on this, we hypothesized that downregulation of its expression would negatively impact the survival of A2780-cp, A2780-s and ES-2 ovarian cancer cells. We have demonstrated that downregulation of XIAP is sufficient to induce apoptosis in ovarian cancer cells, which is consistent with reports in lung, prostate and colon cancer cells.10, 17 AEG35156 is not thought to cross-react with and consequently decrease expression of other IAP family members, since HIAP2/cIAP1 transcript levels are unaffected by treatment,10 but perhaps only comprehensive gene expression array data18 would allow us to conclude definitively that the cell death we have observed is attributable to XIAP downregulation alone. Manipulation of other proapoptotic proteins that indirectly decrease the cellular XIAP content, such as Smac19 and XAF1,6 has also been shown to induce apoptosis without additional insult, which supports our findings. However, in contrast to what we have observed, it has been reported that a decrease in XIAP expression alone does not cause cell death in some cancer cell types, but does increase their susceptibility to chemotherapy-induced death.7–9, 20 We propose that the delicate balance of pro- and anti-apoptotic molecules may differ with cell type and/or the environment to which the cells are exposed. Comparable decreases in XIAP content may be refractory in one cell type, but tip the balance beyond the apoptotic threshold in another. In addition, different transfection conditions may impart variable degrees of stress to cells that affect their susceptibility to apoptosis resulting from downregulated XIAP.

It has previously been reported that, in ovarian cancer cells, impaired cell survival arising from XIAP downregulation occurs in p53 wild-type cells, but not in p53 mutated cells.9 However, we observed a significant decrease in cell survival following AS XIAP transfection not only in the A2780-s cell line containing wild-type p53, but in A2780-cp cells, which have been reported to contain a p53 mutation.21 As previously discussed, the balance of pro- and antiapoptotic signals is delicate and may vary between cells. One main difference between the studies that may explain the dissimilar outcome is the method used to decrease XIAP. Both the adenoviral strategy employed by Sasaki et al. (2000) and antisense oligonucleotides have the potential to have nonsequence specific effects,18, 22 and although this was controlled for (i.e., control oligonucleotides with the same base composition as the AS XIAP compound), studies of this kind need to be interpreted cautiously as there is a possibility that the delivery method may be imparting an effect. Also, the degree of knockdown achieved in the mutant-p53 cell lines relative to wild-type cells in the Sasaki et al. study may have been less, and insufficient to induce apoptosis.

The decrease in cell survival that we observed in vitro motivated an in vivo evaluation of AS XIAP in xenograft mouse models. It has previously been reported in lung cancer mouse models that decreasing XIAP content induces apoptosis and enhances sensitivity to chemotherapy,23, 24 but the therapeutic efficacy in invivo ovarian cancer models has not yet been evaluated. We chose to test this strategy in a xenograft model using A2780-cp cells, chosen for their chemoresistance and mutant-p53 status, which may have hindered their ability to apoptose in response to XIAP downregulation, but represents a disease that is more difficult to treat and that more reasonably reflects the patient population in whom this new therapeutic approach will be tested. Cells were injected IP in an effort to accurately represent the human disease.25 Intraperitoneal AS XIAP treatment (10 mg/kg/day) of mice xenografted IP with A2780-cp cells prolonged the survival time of the animals, which is consistent with the effects of AEG35156 in p53-mutant models of breast and lung cancer.11 Interestingly, the lower 10 mg/kg/day dose reached statistical significance in lengthening survival time compared to control oligonucleotide treated mice; however, the 25 mg/kg/day dose, which showed a trend for efficacy, did not reach statistical significance. As the survival curves of the 2 doses are not statistically different from each other, one interpretation could be that there was simply no additional benefit from the higher dose. Alternatively, this could be taken as evidence that the higher dose was less effective, suggesting that there is either a greater amount of nonspecific toxicity associated with the higher dose that may have compromised the efficacy, or that cells are triggered to compensate when the knockdown of XIAP expression is sufficiently large.

Our in vivo findings that AEG35156 improves the survival of A2780-cp xenografted mice were substantiated by histological evaluation of the tumors. Our primary objective was to evaluate the effect of decreased XIAP expression on animal survival, and since the majority of mice survived beyond the final treatment, it was not possible for us to evaluate the tumors for apoptotic cells by more conventional strategies, such as TUNEL, as they would have long been eliminated. However, analysis of H&E sections of tumors revealed significantly less “cellularity” in the cross-sectional area of tumors in AS XIAP-treated mice, which indicates an increase in intratumoral cell death.

Although XIAP is ubiquitously expressed in all tissues, the downregulation of XIAP should not, in principle, impact normal cells and tissues unless they are subjected to insults that trigger caspase activation and the initiation of the apoptotic process. Based on body weight and gross pathology at the time of necropsy, we did not observe any toxicity in mice that received up to 25 mg/kg/day of AS XIAP for up to 100 days (data not shown). Moreover, formal GLP preclinical toxicology studies conducted in rat and monkey show that AEG35156 can be administered via the intravenous route with an acceptable safety profile for clinical evaluation.11 That XIAP-deficient mice are viable26 further suggests that normal cells can accommodate this change to their “apoptotic balance,” which is thought to be more tenuous in cancer cells. Phase I clinical trials of AEG35156 AS XIAP therapy will further assess the safety of this therapeutic approach.

Improvement of ovarian cancer survival statistics will rely in part upon the development of novel therapeutics targeting molecules that are responsible for or contribute to tumor formation and chemoresistance. Not only are there a myriad of potential molecular targets in need of validation, there are numerous strategies for altering their expression and/or activity. Modulation of gene expression by antisense oligonucleotides is a valuable therapeutic approach since it is both specific and applicable to any gene.27, 28 Future research will clarify the most successful means for XIAP downregulation, be it antisense oligonucleotides,11, 23 adenovirus,9 RNA interference20 or small molecule inhibitors,29 but this study has validated XIAP as a promising molecular target for ovarian cancer therapy. AEG35156 is currently being evaluated in humans in several Phase I clinical trials in the UK, Canada, and the US as a single agent and in combination with other anticancer agents.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The authors thank Ms. Gabriele Cherton-Horvat, Dr. Herman Cheung, Dr. Katherine Clark-Knowles, Ms. Olga Collins, Ms. Colleen Crane and Ms. Elizabeth Macdonald for their excellent assistance with the experiments. This research was supported by Aegera Therapeutics Inc., the National Cancer Institute of Canada with funds from the Terry Fox Foundation (BCV), and the Betty Irene West Doctoral Research Scholarship from the Canadian Institutes of Health Research (TJS). EL and JD are both employees of Aegera Therapeutics Inc., which is developing the compound AEG35156 for therapeutic application.

References

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • 1
    Philchenkov A. Caspases: potential targets for regulating cell death. J Cell Mol Med 2004; 8: 43244.
  • 2
    Deveraux QL,Takahashi R,Salvesen GS,Reed JC. X-linked IAP is a direct inhibitor of cell-death proteases. Nature 1997; 388: 3004.
  • 3
    Holcik M,Gibson H,Korneluk RG. XIAP: apoptotic brake and promising therapeutic target. Apoptosis 2001; 6: 25361.
  • 4
    Lacasse EC,Baird S,Korneluk RG,MacKenzie AE. The inhibitors of apoptosis (IAPs) and their emerging role in cancer. Oncogene 1998; 17: 324759.
  • 5
    Tamm I,Kornblau SM,Segall H,Krajewski S,Welsh K,Kitada S,Scudiero DA,Tudor G,Qui YH,Monks A,Andreeff M,Reed JC. Expression and prognostic significance of IAP-family genes in humancancers and myeloid leukemias. Clin Cancer Res 2000; 6: 1796803.
  • 6
    Yang L,Cao ZH,Yan H,Wood WC. Coexistence of high levels of apoptotic signaling and inhibitor of apoptosis proteins in human tumor cells: implication for cancer specific therapy. Cancer Res 2003; 63: 681524.
  • 7
    Mansouri A,Zhang QX,Ridgway LD,Tian L,Claret FX. Cisplatin resistance in an ovarian carcinoma is associated with a defect in programmed cell death control through XIAP regulation. Oncol Res 2003; 13: 399404.
  • 8
    Sapi E,Alvero AB,Chen W,O'Malley D,Hao XY,Dwipoyono B,Garg M,Kamsteeg M,Rutherford T,Mor G. Resistance of ovarian carcinoma cells to docetaxel is XIAP dependent and reversible by phenoxodiol. Oncol Res 2004; 14: 56778.
  • 9
    Sasaki H,Sheng YL,Kotsuji F,Tsang BK. Down-regulation of X-linked inhibitor of apoptosis protein induces apoptosis in chemoresistant human ovarian cancer cells. Cancer Res 2000; 60: 565966.
  • 10
    LaCasse EC,Cherton-Horvat GG,Hewitt KE,Jerome LJ,Morris SJ,Kandimalla ER,Yu D,Wang H,Wang W,Zhang R,Agrawal S,Gillard JW et al. Preclinical characterization of AEG35156/GEM 640, a second-generation antisense oligonucleotide targeting X-linked inhibitor of apoptosis. Clin Cancer Res 2006; 12: 523141.
  • 11
    Lacasse EC,Kandimalla ER,Winocour P,Sullivan T,Agrawal S,Gillard JW,Durkin J. Application of XIAP antisense to cancer and other proliferative disorders: development of AEG35156/ GEM640. Ann NY Acad Sci 2005; 1058: 21534.
  • 12
    Holcik M,Lefebvre CA,Hicks K,Korneluk RG. Cloning and characterization of the rat homologues of the inhibitor of apoptosis protein 1, 2, and 3 genes. BMC Genomics 2002; 3: 5.
  • 13
    Lehr Ha,van der Loos CM,Teeling P,Gown AM. Complete chromogen separation and analysis in double immunohistochemical stains using photoshop-based image analysis. J Histochem Cytochem 1999; 47: 11925.
  • 14
    Levkau B,Garton KJ,Ferri N,Kloke K,Nofer JR,Baba HA,Raines EW,Breithardt G. xIAP induces cell-cycle arrest and activates nuclear factor-κB: new survival pathways disabled by caspase-mediated cleavage during apoptosis of human endothelial cells. Circ Res 2001; 88: 28290.
  • 15
    Tong QS,Zheng LD,Wang L,Zeng FQ,Chen FM,Dong JH,Lu GC. Down-regulation of XIAP expression induces apoptosis and enhances chemotherapeutic sensitivity in human gastric cancer cells. Cancer Gene Ther 2005; 12: 50914.
  • 16
    Skilling JS,Squatrito RC,Connor JP,Niemann T,Buller RE. p53 gene mutation analysis and antisense-mediated growth inhibition of human ovarian carcinoma cell lines. Gynecol Oncol 1996; 60: 7280.
  • 17
    Amantana A,London CA,Iversen PL,Devi GR. X-linked inhibitor of apoptosis protein inhibition induces apoptosis and enhances chemotherapy sensitivity in human prostate cancer cells. Mol Cancer Res 2004; 3: 699707.
  • 18
    Fisher AA,Ye D,Sergueev DS,Fisher MH,Shaw BR,Juliano RL. Evaluating the specificity of antisense oligonucleotide conjugates. A DNA array analysis. J Biol Chem 2002; 277: 229804.
  • 19
    McNeish IA,Lopes R,Bell SJ,McKay TR,Fernandez M,Lockley M,Wheatley SP,Lemoine NR. Survivin interacts with Smac/DIABLO in ovarian carcinoma cells but is redundant in Smac-mediated apoptosis. Exp Cell Res 2005; 302: 6982.
  • 20
    McManus DC,Lefebvre CA,Cherton-Horvat G,St-Jean M,Kandimalla ER,Agrawal S,Morris SJ,Durkin JP,LaCasse EC. Loss of XIAP protein expression by RNAi and antisense approaches sensitizes cancer cells to functionally diverse chemotherapeutics. Oncogene 2004; 23: 810517.
  • 21
    Siddik ZH,Mims B,Lozano G,Thai G. Independent pathways of p53 induction by cisplatin and X-rays in a cisplatin-resistant ovarian tumor cell line. Cancer Res 1998; 58: 698703.
  • 22
    Ben-Israel H,Kleinberger T. Adenovirus and cell cycle control. Front Biosci 2002; 7: d1369d1395.
  • 23
    Hu YP,Cherton-Horvat G,Dragowska V,Baird S,Korneluk RG,Durkin JP,Mayer LD,LaCasse EC. Antisense oligonucleotides targeting XIAP induce apoptosis and enhance chemotherapeutic activity against human lung cancer cells in vitro and in vivo. Clin Cancer Res 2003; 9: 282636.
  • 24
    Cao C,Mu Y,Hallahan DE,Lu B. XIAP and survivin as therapeutic targets for radiation sensitization in preclinical models of lung cancer. Oncogene 2004; 23: 704752 [erratum in Oncogene 2004;23:9448].
  • 25
    Shaw TJ,Senterman MK,Dawson K,Crane CA,Vanderhyden BC. Characterization of intraperitoneal, orthotopic, and metastatic xenograft models of human ovarian cancer. Mol Ther 2004; 10: 103242.
  • 26
    Harlin H,Reffey SB,Duckett CS,Lindsten T,Thompson CB. Characterization of XIAP-deficient mice. Mol Cell BIol 2001; 21: 36048.
  • 27
    Ho PT,Parkinson DR. Antisense oligonucleotides as therapeutics for malignant diseases. Semin Oncol 1997; 24: 187202.
  • 28
    Stein Ca,Cheng YC. Antisense Oligonucleotides as therapeutic agents—is the bullet really magical. Science 1993; 261: 100412.
  • 29
    Carter BZ,Gronda M,Wang Z,Welsh K,Pinilla C,Andreeff M,Schober WD,Nefzi A,Pond GR,Mawji IA,Houghten RA,Ostresh J et al. Small-molecule XIAP inhibitors derepress downstream effector caspases and induce apoptosis of acute myeloid leukemia cells. Blood 2005; 105: 404350.