Ror1, a cell surface receptor tyrosine kinase is expressed in chronic lymphocytic leukemia and may serve as a putative target for therapy

Abstract

Gene profiling studies of patients with chronic lymphocytic leukemia (CLL) has revealed increased expression of Ror1, a cell surface receptor tyrosine kinase. The aim of present study was to analyze gene and protein expression of Ror1 in CLL cells and normal blood leukocytes. Gene expression analysis reverse transcription-polymerase chain reaction of ROR1 revealed that all patients with CLL (n = 100) spontaneously expressed ROR1 mRNA whereas enriched blood B and T cells as well as granulocytes from healthy donors (n = 10) were negative. A strong nonphysiological activation signal (PMA/ionomycin) was required to induce expression in vitro in normal lymphocytes. Major genomic aberrations (mutations or truncation) of ROR1 were not observed. Protein expression was analyzed by Western blot using a panel of polyclonal anti-Ror antibodies as well as flow cytometry. Blood lymphocytes from 18/18 CLL patients, but none of the 10 healthy donors, expressed surface Ror1. The majority of CLL cells exhibited Ror1 surface expression (71% mean; range 36–92%) with a mean fluorescence intensity (MFI) of 20 (range 10–45). The corresponding MFI of CD19 on CLL cells was 26 (range 9–48). There was no difference in the Ror1 protein expression comparing IgVH mutated and unmutated cases as well as progressive and nonprogressive CLL patients. Two different variants of the Ror1 protein, 105 and 130 kDa, were identified. The Ror1 protein expression in patients with CLL but not in normal leukocytes merits further studies of its role in the pathobiology of CLL, which may provide a basis for development of Ror1 directed targeted therapy. © 2008 Wiley-Liss, Inc.

Chronic lymphocytic leukemia (CLL) originates from B lymphocytes, which differ in activation and maturation stage and are derived from antigen experienced B cells with different immunoglobulin heavy chain variable (IgVH) gene mutations.1 Patients with mutated IgVH genes have a better prognosis compared to patients with unmutated genes.2, 3 Global gene expression profiling studies have revealed partly distinguishing but in general overlapping expression profiles in mutated and unmutated leukemic B cells, suggesting a common phenotype.4, 5

Gene expression profiling studies showed a 43.8-fold increase of the orphan receptor tyrosine kinase (RTK) ROR1 in CLL cells.4 Ror1 is a member of the RTK family of orphan receptors related to muscle specific kinase and Trk neurotrophin receptors.6–8 Ror receptors are cell surface receptors participating in signal transduction, cell–cell interaction, regulation of cell proliferation, differentiation, cell metabolism and survival.7, 9 They are evolutionarily highly conserved between different species e.g., human, mouse, Drosophila and C. elegans, suggesting important biological functions.

The human ROR1 gene has a coding region of 2814 bp with a predicted 937 amino acids sequence and 105 kDa protein size including an Ig-like domain, cysteine-rich domain, kringle domain, tyrosine kinase domain and proline-rich domain (Fig. 1).9ROR1 is located on chromosomal region 1p31.3 (http://www.ensembl.org), a region where chromosomal aberrations are not frequently seen in hematological malignancies. The human ROR1 is expressed in heart, lung and kidney but less in placenta, pancreas and skeletal muscles.10ROR1 was originally cloned from a neuroblastoma cell line7 and subsequently a shorter form lacking the entire extracellular domain but containing the transmembrane domain was isolated from a fetal brain library. Truncated Ror1(t-Ror1) gene has been reported in fetal and adult human central nervous system, in human leukemias, lymphoma cell lines, and in a variety of human cancers derived from neuroectoderm.10 A shorter transcript from exons 1–7 including a short part of intron 7 has also been described with a predicted length of 393 amino acids and a molecular weight of 44 kDa (Ensembl ID; ENSG00000185483).

Figure 1. Schematic presentation of the ROR1 gene and the predicted Ror1 protein. Positions of antibody recognition sites of N-Ror1-46 and C-Ror1-904 (Y) as well as the protein domains including: Immunoglobulin like domain (Ig), cysteine rich domain (CRD), Kringle domain (Kr), transmembrane domain (TM), tyrosine kinase domain (TK), serine and threonine rich domain (S/T), and proline rich domain (P) are indicated. The location of primers used for cloning and sequencing in mutation analysis of the extracellular and kinase domains (P5 + P6 and P7 + P8) are indicated. In addition, the primers used for RT-PCR screening (P1 + P2) and the primers used for real-time quantitative PCR (P3 + P4; and P* TaqMan probe) are indicated with arrows.

In our study, we present data demonstrating that Ror1 is uniformly expressed at the gene and protein levels in the leukemic cells of all patients with CLL, but not in normal lymphocytes unless a strong activation signal was provided.

BMMC, bone marrow mononuclear cells; CLL, chronic lymphocytic leukemia; CRD, cysteine-rich domain; MFI, mean fluorescence intensity; MUSK, muscle specific kinase; RTK, receptor tyrosine kinase; PBMC, peripheral blood mononuclear cells.

Material and methods

Patients

The WHO Classification of Neoplasms of the Hematopoetic and Lymphoid Tissues was applied.11 The diagnosis of CLL (n = 100) was based on immunophenotyping (CD5+/CD19+/CD23+/IgM+) and the presence of >5.0 × 10⁹/l lymphocytes in peripheral blood.

Patients with CLL were considered to have progressive disease according to a modification of the criteria of the NCI committee, if there was a progression during the preceding 3 months in disease-related anaemia (hemoglobin <10.0 g/dl), thrombocytopenia (<100 × 10⁹/l) and/or an increase in spleen/liver/lymph-node size and/or more than a 2-fold increase in the blood lymphocyte count. When these criteria were not fulfilled, the patients were considered as having nonprogressive disease.

Heparinized or citrated peripheral blood or bone marrow was collected from patients with CLL and blood was also drawn from normal healthy donors (n = 10). All samples were collected with informed consent and approval by the local ethics committee.

Isolation of blood mononuclear cells, granulocytes, B and T lymphocytes

Peripheral blood mononuclear cells (PBMC) and bone marrow mononuclear cells (BMMC) were isolated using Ficoll-Hypaque (GE Healthcare, Uppsala, Sweden) density-gradient centrifugation as previously described.12

Granulocytes were recovered from the top of the erythrocyte layer after Ficoll-Hypaque density-gradient centrifugation. Erythrocytes were lysed by hypo-osmosis in cold water. More than 98% of the nucleated cells were granulocytes as evaluated by immunocytology (data not shown).

Tonsil tissue was cut and passed through a metal grid and suspension of tonsil mononuclear cells was prepared by Ficoll-Hypaque density-gradient centrifugation.12

T and B lymphocytes were purified from PBMC by negative selection using MACS beads (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) according to manufacturer's instruction. Leukemic B cells and tonsil mononuclear cells were also enriched using nylon wool purification.12 The purity of isolated mononuclear cells was analyzed by direct immunofluorescence using conjugated monoclonal antibodies (MAb) against CD3, CD19 and CD14 (BD Biosciences, San Jose, CA) and flow cytometry (FACSCalibur BD Biosciences).

RT-PCR and RT-QPCR amplification of ROR1

Reverse transcription-polymerase chain reaction (RT-PCR) amplification was done using ROR1 specific primers (Table I). The amplification profile included 5-min denaturation at 95°C followed by 35 cycles of 94, 60 and 72°C for 30 sec each, using AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, CA). Real-Time quantitative polymerase chain reaction (PCR) was performed as described earlier.13

Table I. Primers and Probes Used in Ror1 PCR Amplifications and Quantifications

Target	Primer (5′→3′)	Position	Amplicon size (bp)	Reference
S, sense; AS, antisense; Q, Blue-6-FAM; 9, TAMRA; P1-P8, primer number as in Figure 1; g.b, genebank.
t-Ror1 (truncated)	S: CCAAAGGACCTTCTGCAGTGGAA (P10)	687–709	450	10
	AS: TCTCATTCCAGCACTCTGTCATGAGG (P9)	1111–1136
ROR1 (RT-PCR)	S: CTGCTGCCCAAGAAACAGAG (P1)	455–474	545	g.b. M97675
	AS: CATAGTGAAGGCAGCTGTGATCT (P2)	977–999
β-actin (RT-PCR)	S: ATTAAGGAGAAGCTGTGCTACGTC	707–730	215	g.b. NM_001101
	AS: ATGATGGAGTTGAAGGTAGTTTCG	898–921
ROR1 (RT-QPCR)	S: AAAGAGCTACCTCTTTCTGCTGTACG (P3)	1771–1796	175	g.b. M97675
	AS: CTTCTTGTTGAAATTCCGTCCATTG (P4)	1921–1945
	Probe: QCATGCTCAGCTGGTTGCTATCAAGACC9	1869–1896
β-actin (RT-QPCR)	S: CGACAGGATGCAGAAGGAGA	929–948	161	g.b. NM_001101
	AS: CGTCATACTCCTGCTTGCTG	1070–1089
	Probe: QAAGATCAAGATCATTGCTCCTCCTGAG9	975–1001
ROR1 (RT-PCR)	S: ATGAATAACATCACCACGTCTCTGGGCC (P5)	565–592	1005	g.b. M97675
(Extracellular domain)	AS: CTCCTTGGAATCCTTTGAATCGCA (P6)	1546–1569
ROR1 (RT-PCR)	S: TTCTTCATTTGCGTCTGTCG (P7)	1642–1661	1116	g.b. M97675
(Kinase domain)	AS: CTGGCTCGGGAACATGTAAT (P8)	2738–2757

Sequencing of clonal immunoglobulin V(D)J rearrangements and ROR1

Amplification of the immunoglobulin V(D)J rearrangements was performed by PCR using cDNA from PBMC, consensus VH family primers as sense and constant μ chain primer as antisense. The method has been described in details previously.14, 15

Both extracellular and intracellular domains of ROR1 gene were separately amplified by RT-PCR using cDNA of CLL patients and cloned into pGEM-T easy vector (Promega, Madison, WI) and sequenced. The sequences were compared to the ROR1 gene (Ensembl ID; ENSG00000185483).

Activation of B and T lymphocytes of healthy donors and B-CLL cells

CLL cells, isolated normal T and B cells, as well as tonsil B cells were cultured in 6-well culture plates (4 × 10⁶ cells/well) in 2 ml of DMEM medium (Invitrogen, Carlsbad, CA) supplemented with 10% human AB serum, 100 U/ml penicillin, 100 μg/ml streptomycin and 2 mM L-Glutamine for 48 hr at 37°C in humidified air with 5% CO₂ and stimulated with 25 ng/ml PMA + 1 μg/ml ionomycin (Sigma, St. Louis, MO). After 48 hr of culture the cells were harvested, RNA isolated and cDNA prepared. The expression of ROR1 was analyzed by Real-Time quantitative PCR (RT-QPCR) using primers and conditions described above. β-actin expression was used as endogenous control to quantify the ROR1 expression.

Production of anti-Ror1 antibodies and specificity testing

Rabbit anti-human Ror1 polyclonal antibodies were produced against synthetic peptides from the N-terminal WNISSELNKDSYLTL aa 46–60 and NKSQKPYKIDSKQAS aa 904–918, respectively of human Ror1 (designated N-Ror1-46 and C-Ror1-904 antibodies) (Fig. 1). Immunograde peptides were purchased from Thermo Electron Corporation GmBH, Ulm, Germany. Keyhole limpet hemocyanin-conjugated peptides were used for generating the polyclonal antibodies. The polyclonal antibodies were purified by affinity purification. A recombinant protein representing an intracellular region of Ror1 with a molecular weight of around 70 kD (Carna Biosciences, Chuo-ku, Kobe, Japan) was used for specificity control of the C-Ror1-904 polyclonal antibody (Fig. 2, lower panel). The specificity of the N-Ror1-46 antibody, was checked against a recombinant protein of the extracellular domain of Ror1 spanning aa 33 to 458 expressed in bacteria given an expected molecular weight of around 40 kD. Briefly, the region was PCR amplified using a human full-length cDNA clone EN1031_D08 Ror1 gene (Origene Technologies, Rockville, MD) as template. The PCR products were cloned into pGEM-T easy vector and subcloned into pcDNA3.1+ vector (Invitrogen) and transformed into E.coli strain Origami (Invitrogen). The integrity of the insert was verified by DNA sequencing. After selecting an in-frame clone, the supernatant of 24 hr cultured bacteria was collected and concentrated 30 times using Amicon Ultra-15 Centrifugal Filter Units (separation of polypeptides >10 kDa) (Millipore Corporation, Bedford, MA). The concentrated recombinant was subjected to Western blot and probed with N-Ror1-46 and a commercially available anti-Ror1 antibody [goat anti-Ror1 polyclonal antibody (N-Ror1_com) (R&D systems, Minneapolis, MN)] to determine the specific reactivity (Fig. 2).

Figure 2. Specificity control of the polyclonal antibodies. Upper panel: Western blot analyses using a commercially available anti-Ror1 polyclonal antibody (N-Ror1_com) and own produced rabbit polyclonal antibody (N-Ror1-46). Both antibodies reacted with the same 37 kDa band. The recombinant extracellular part of the Ror1 protein was expressed in E.coli and supernatant concentrated 30X. (The N-Ror1-46 antibody did not react with the recombinant cytoplasmic Ror1 protein (data not shown)). Lower panel: Western blot using a serially diluted commercially available recombinant Ror1 protein representing a cytoplasmic region and probed with our rabbit polyclonal antibody C-Ror1-904. [The C-Ror1-904 antibody did not react with the recombinant extracellular part of the Ror1 protein (data not shown)].

Western blot

The goat anti-Ror1 polyclonal antibody (N-Ror1_com) (R&D systems) as well as the antibodies produced in our lab (N-Ror1-46 and C-Ror1-904) were used in Western blot. Cells were lysed in a buffer containing 1% Triton X-100, 50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM EDTA and 1% protease inhibitor cocktail (Sigma). Protein concentration was measured by Thermo Scientific BCA Protein Assay Kit (Thermo Scientific, Rockford, IL) according to the manufacturer's instructions. Fifty micrograms of cell lysates were run on a 10% Bis-Tris SDS-PAGE gel (Invitrogen) at 120 V for 3 hr under reducing conditions. After electrophoresis, resolved proteins were transferred onto Immobilon-PVDF membranes (Millipore Corporation) in a mini Transblot cell (Invitrogen). The membranes were blocked for 1.5 hr at room temperature with 5% nonfat milk in PBS plus 0.05% Tween 20 (PBS-T). All immunostainings were performed in PBS-T supplemented with 5% nonfat milk. Filters were incubated with appropriate dilutions of the anti-Ror1 antibodies over night at +4°C. After extensive washing with PBS-T, the filters were incubated with peroxidase-conjugated goat anti-rabbit immunoglobulins (DakoCytomation, Glostrup, Denmark) for 1.5 hr at room temperature followed by washing and developing with ECL chemiluminescence detection system (GE Healthcare).

Surface staining and flow cytometry

Cells were analyzed by flow cytometry (FACSCalibur BD Biosciences) using N-Ror1_com (primary antibody), PE conjugated anti-CD3 (BD Biosciences, San Jose, CA), PE-Cy5-conjugated anti-CD19 (e-Bioscience, San Diego, CA), FITC-conjugated anti-CD19 (BioLegend, San Diego, CA), FITC-conjugated swine anti-goat IgG antibody (secondary antibody) (Southern biotech, Birmingham, AL) and mouse serum (blocking serum) (DakoCytomation).

Surface staining of CLL cells and normal PBMC was performed as described.16 Briefly, 2 × 10⁶ cells were washed in PBS and pre-incubated with serum-free RPMI (Invitrogen), at 37°C for 1 hr followed by 3 washings with RPMI. One microgram of the anti-Ror1 antibody (N-Ror1_com) (R&D systems) was added and incubated at +4°C for 30 min. The cells were washed twice with FACS buffer (PBS, 0.1% sodium azide and 0.5% FBS). FITC swine anti-goat IgG (1:100) (Southern biotech) was added and incubated at +4°C for further 30 min. Blocking was performed by adding 10 μl of 10% mouse serum followed by incubation at +4°C for 20 min. Both CD3 and CD19 antibodies were then added to the cells and incubated at +4°C for 30 min. The cells were finally washed twice with FACS buffer and fixed by adding 1% paraformaldehyde in PBS. The CellQuest software program (BD) was used to determine the percentage of Ror1⁺ cells of the CD19 population.

Sequencing of the ROR1 gene

PBMC of CLL patients were isolated, total RNA prepared and cDNA synthesized as described above. ROR1 specific primers were designed to amplify truncated t-Ror1 (primers P9 and P10), the extracellular domains including Ig, CRD, and kringle domains (primers P5 and P6), as well as the kinase domain (primers P7 and P8) (Fig. 1). The PCR products were cloned into pGEM-T easy vector (Promega) and subjected to sequencing using T7, Sp6 and gene specific primers (Table I).

Dual color fluorescence in situ hybridization

Fluorescence in situ hybridization (FISH) was carried out on nuclei isolated from blood or bone marrow cells of patients with CLL using 3 BAC clones spanning the ROR1 locus in 1p31.3. BAC DNA was isolated with QIAGEN Plasmid Mini Kit (QIAGEN GmbH, Hilden, Germany) and labeled by nick translation (Roche Diagnostics GmbH, Mannheim, Germany) according to the recommendations of the manufacturers. RP11-265C4 was labeled with fluorescein-12-dUTP and cohybridized with either RP11-30A5 or RP11-91B5 labeled with tetramethylrhodamine-5-dUPT (Roche) using standard methods. For each case 200 nuclei were scored in a Zeiss Axioskop epifluorescence microscope (Carl Zeiss Jena GmbH, Jena, Germany). Fusion, touching or close location within 1–3 probe sizes of the 2 probes were scored as positive for colocalisation.

Results

ROR1 gene expression in CLL patients and healthy donors

PBMC of all CLL patients (n = 100) as well as BMMC (n = 2) expressed ROR1 at the mRNA level. ROR1 was weakly expressed also on normal tonsil B cells (2/2) but not in healthy donor PBMC (0/10), isolated normal B cells (0/6) and T cells (0/3) or enriched blood granulocytes (0/10) (Table II). Representative RT-PCR experiments of healthy donors and CLL patients are shown in Figure 3.

Figure 3. ROR1 gene expression (RT-PCR) in leukemic cells of CLL patients and a healthy control donor. Positive control represents the PCR product cloned into pGEM-T easy vector. Negative control is the reaction mixture without template. Marker is a 100 bp DNA ladder. The beta-actin gene was used to verify the integrity of synthesized cDNA.

Table II. Ror1 Gene Expression (RT-PCR) in CLL Patients and Healthy Control Donors

Cell source	Positive cases/total analyzed
PBMC, peripheral blood mononuclear cells; BMMC, bone marrow mononuclear cells. 1 Purity > 90%. 2 Purity > 98%.
CLL
PMBC	100/100
BMMC	2/2
Healthy donors
PBMC	0/10
T cells1	0/3
B cells1	0/6
Tonsil B cells1	2/2
Granulocytes2	0/10

Mutation analysis of cloned extracellular and cytoplasmic kinase domains of the ROR1 gene was analyzed in 10 CLL patients and showed no major genomic aberrations. Only few point mutations (silent mutations) were found (data not shown). PCR amplification to detect a truncated ROR1 (t-Ror1) using primers P9 and P10 did not give rise to any amplicon (data not shown).

Expression of ROR1 in activated cells

Next, we analyzed whether ROR1 might be induced after in vitro activation. CLL cells, normal B- and T-lymphocytes and tonsil B cells were cultured with PMA/ionomycin for 48 hr to provide a strong activation signal. CLL cells and normal tonsil B cells, which constitutively expressed Ror1 mRNA, could not be further activated. In contrast, a 15 to 25-fold increase in the ROR1 mRNA expression was observed in in vitro activated normal B and T cells. A representative experiment is shown in Figure 4. The activated normal B cells also expressed Ror1 at the protein level (Western blot) (data not shown).

Figure 4. A representative example of ROR1 expression in activated (PMA/ionomycin) normal B- and T-lymphocytes, tonsil B-cells, and leukemic CLL cells after 48 hr of culture. The expression was determined by quantitative real-time PCR. Fold increase was related to the level observed at time zero. CLL cells and tonsil B cells which constitutively expressed Ror1 mRNA could not be further activated, while the strong activation signal induced gene expression of ROR1 in normal B and T cells.

Ror1 protein expression

We then analyzed the Ror1 protein expression in CLL (n = 18). Western blot analyses of cell lysates demonstrated in all CLL samples, the presence of 2 Ror1 specific bands, of 105 and an estimated of 130 kDa in size, respectively (Fig. 5). The commercially available antibody (N-Ror1_com) seemed not to detect the estimated 130 kDa Ror1 variant. Surface expression of Ror1 in progressive and nonprogressive CLL patients are shown in Figure 6 and Table III. The frequency of CD19⁺ CLL cells expressing Ror1 varied (71 ± 5%) (mean ± SEM) (range: 36–92%). There was no difference between progressive and nonprogressive patients or between IgVH mutated and unmutated cases (Table III). The mean fluorescence intensity (MFI) varied between 10 and 45 with a mean MFI value of 20. There was no statistical difference between progressive and nonprogressive patients. The corresponding mean MFI of CD19 was 26 (range 9–48). Normal B cells (CD19⁺) of healthy donors (n = 10) were negative for Ror1 (<0.1%).

Figure 5. Western blot. All 3 antibodies showed a 105 kDa band. C-Ror1-904 also detected an estimated 130 kDa variant of Ror1. The blots were stripped and stained with a beta-actin antibody to show the integrity of the loaded samples.

Figure 6. Cell surface staining for Ror1 (N-Ror1_com) and CD19 of leukemic cells from 2 progressive and nonprogressive CLL patients as well as PBMC of a healthy control donor.

Table III. Protein Expression of Ror1 in CLL Patients (n = 18) in Relation to IgVH Mutational Status and Clinical Phase

Patients	Disease phase	IgVH mutation status	Western blot			Freq. (%) of Ror1^+ CLL cells (CD19^+)	Ror1 MFI
			N-Ror1com (kDa)	N-Ror1-46 (kDa)	C-Ror1-904 (kDa)
M, mutated; UM, unmutated; MFI, mean fluorescence intensity.
CLL-1	Nonprogressive	M	105	105	105, 130	80	13
CLL-2	Nonprogressive	UM	105	105	105, 130	91	25
CLL-3	Nonprogressive	UM	105	105	105, 130	36	10
CLL-4	Nonprogressive	M	105	105	105, 130	86	20
CLL-5	Nonprogressive	UM	105	105	105, 130	80	26
CLL-6	Nonprogressive	M	105	105	105, 130	91	35
CLL-7	Nonprogressive	UM	105	105	105, 130	37	14
CLL-8	Nonprogressive	M	105	105	105, 130	50	20
CLL-9	Nonprogressive	M	105	105	105, 130	69	20
CLL-10	Progressive	M	105	105	105, 130	63	10
CLL-11	Progressive	M	105	105	105, 130	65	11
CLL-12	Progressive	UM	105	105	105, 130	81	15
CLL-13	Progressive	M	105	105	105, 130	84	14
CLL-14	Progressive	UM	105	105	105, 130	92	45
CLL-15	Progressive	M	105	105	105, 130	61	19
CLL-16	Progressive	M	105	105	105, 130	36	18
CLL-17	Progressive	M	105	105	105, 130	79	20
CLL-18	Progressive	UM	105	105	105, 130	93	33
Mean ± SEM						71±5	20 ± 2
Healthy controls doners (n = 10)			<0.1	<0.1	<0.1	<0.1

Dual colour fluorescence in situ hybridization

FISH analysis of PBMC from 3 CLL patients showed no rearrangement in the 1 p region. Analysis on bone marrow cells from 4 additional CLL patients showed no abnormality at the ROR1 locus (Fig. 7).

Figure 7. FISH analysis of the BAC clone RP11-265C4 containing the ROR1 gene (red) cohybridized with either RP11-30A5 (green) or RP11-91B5 (green), closely flanking ROR1 on the telomeric and centromeric side, respectively. The representative CLL nuclei show 2 colocalized red and green signals indicating normal findings with 2 copies of ROR1 and no indication of ROR1 gene rearrangement.

Discussion

In our study, we demonstrate that the RTK Ror1 is spontaneously expressed at the gene and protein levels of the leukemic cells in CLL patients but not in normal peripheral blood leukocytes. Tonsil B cells weakly expressed Ror1, which is in accordance with that tonsil B cells are activated cells, showing similarities at the gene level to activated blood B and T cells using a strong (nonphysiological) signal.17, 18 Earlier reports have shown gene expression of ROR1 in neuroectodermal human cell lines as well as in acute leukemia and lymphoma derived cell lines.10 Our results are supported by recent preliminary reports, also showing expression of Ror1 in CLL.19, 20 The level of surface expression of Ror1 in our study and the absence in normal (nonactivated) blood leukocytes indicates that Ror1 might be a candidate structure for further evaluation for targeted therapy. This assumption is also supported by the uniform high expression in both IgVH mutated and unmutated CLL cases, as well as in the nonprogressive and progressive phase of the disease.

Our own produced and affinity purified antibodies, tested for specificity in enzyme-linked immunosorbent assay (data not shown) and Western blot, and compared to a commercially available polyclonal antibody indicate that our antibodies specifically recognized Ror1. As these antibodies may bind to different Ror1 epitopes, they should be further compared regarding fine specificity in extended studies.

Western blot analyses using polyclonal antibodies directed against the N-terminal part of Ror1 revealed the expression of a single band of 105 kDa in CLL patients. The 105 kDa band may correspond to translation of the full-length transcript of ROR1.6–8 In contrast to the N-terminal antibodies, the C-terminal antibody of C-Ror1-904 revealed 2 bands of 105 and 130 kDa. The difference in size between the 105 and 130 kDa proteins might be due to alterations (e.g. deletion, insertion) of the ROR1 transcripts. However, the ROR1 transcript corresponding to the extracellular and intracellular domains were sequenced and no major alterations were identified. A possible explanation might be altered glycosylation, as our polyclonal antibodies were raised against peptides containing potential N-glycosylation sites, which was not the case for the commercial antibody. It might be possible that the estimated 130 kDa band represents a glycosylated variant of Ror1, which is in accordance with a report on the Ror1 glycosylation pattern of the extracellular part.21 Further studies are warranted to study the structure including glycosylation and phosphorylation status of the Ror1 molecule in CLL.

Normal B cells did not express Ror1, while a strong nonphysiological signal (PMA/ionomycin) induced Ror1 expression. However, a physiological stimulation (CD40L) did not seem to induce Ror1 expression in normal B cells nor did it alter the expression of Ror1 in CLL cells.22 The expression of Ror1 in CLL cells and the preliminary observation that Ror1 in CLL is constitutively phosphorylated (data to be published) indicate that this RTK might be involved in the pathobiology of CLL.

Gene expression profiling of CLL cells has revealed down- and up-regulations of hundreds of genes with various chromosomal localizations. The mechanism for such changes might be epigenetically through transcriptional silencing/expressing events associated with DNA hyper-/hypo-methylation of the promoter region of genes rather than specific genomic alterations. Recent findings in mouse leukemia revealed nonrandom DNA methylation in a highly ordered manner and assumed to play a central role for the malignant phenotype.23 Further studies are needed to characterize over-expressed genes in vicinity of the ROR1 locus similar to what has been observed for the fibromodulin locus,13 which may lead to the identification of other over-expressed genes on chromosome 1 in CLL. This is in accordance with our findings using FISH, which did not reveal any rearrangements in the ROR1 locus indicating that the expression of Ror1 is not related to genomic aberrations but may be due to epigenetic regulation. However, the results do not rule out other cytogenetic abnormalities.

Interestingly, in a preliminary report activation of NF-κB in CLL cells was shown to give rise to a functionally active Ror1 protein via Wnt5a through a nonclassical Wnt-signaling pathway, supporting a role for Ror1 in the pathogenesis of CLL.24 These data along with the results obtained in our study, and other recent preliminary reports19, 20 warrants further studies to be carried out to establish the potential role of the Ror1 protein in CLL.

In summary, our results and those of the 2 other preliminary reports19, 20 suggest that Ror1 is over-expressed in CLL, and as such a potential candidate structure for therapeutic intervention, e.g. MAb. It should however be noted that Ror1 is not CLL specific, but may be expressed also in other tumors (10, own unpublished observations). Further studies are warranted to characterize the full expression profile of Ror1 in hematological malignancies and solid tumors and its potential role in the pathobiology of CLL and other diseases as well as the usefulness as a potential therapeutic target structure.

Acknowledgements

For the excellent secretarial work we thank Ms. Leila Relander and Ms. Monica Liss.