SEARCH

SEARCH BY CITATION

Keywords:

  • desmosome;
  • hepsin;
  • ovarian cancer;
  • serine protease

Abstract

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Hepsin is a serine protease that is widely expressed in different tissues and cell types, most prominently in the normal liver and kidney. Overexpression of hepsin has been associated with prostate cancers, ovarian cancers and renal cell carcinomas. The physiological functions of hepsin in normal tissues and tumors are poorly understood. To gain insight into its function in ovarian cancer, we analyzed the expression and subcellular localization of hepsin protein in ovarian cancer cell lines and tumors. We showed that the membrane-associated hepsin protein is present at desmosomal junctions, where it colocalizes with its putative proteolytic substrate hepatocyte growth factor. Consistent with the growing evidence that desmosomal junctions and their constituents play a role in cancer progression, we demonstrated that overexpression of hepsin promotes ovarian tumor growth in a mouse model. The ability of ectopic hepsin to induce tumor growth in mice is abrogated by the mutation of 3 critical residues in the catalytic domain, thus implicating the enzymatic activity of hepsin in promoting tumor progression. © 2008 Wiley-Liss, Inc.

Hepsin is a type II transmembrane serine protease that was originally cloned from cDNA libraries of human liver and hepatoma cells.1 The human hepsin gene localizes to chromosome 19q11-13.2 and encodes a glycoprotein of 417 amino acids with a predicted molecular mass of 51 kDa.2, 3 Hepsin is likely to be synthesized as a single chain zymogen and cleaved by an unknown enzyme to generate the mature, disulfide-linked 2-chain form.4 In addition to the catalytic domain, which includes the active site triad residues of His, Asp and Ser, hepsin protein is characterized by a macrophage scavenger receptor-like domain of unknown function, a transmembrane domain and a short cytoplasmic domain.1–7 An alternatively-spliced, nontransmembrane isoform of human hepsin was recently identified.8

Hepsin is frequently overexpressed in prostate cancers,9–14 renal cell carcinomas and ovarian cancer.15–18 The overexpression of hepsin mRNA was found in 60% of low-grade ovarian tumors and 80% of ovarian carcinomas,17 whereas it was not expressed in normal ovarian tissues.15 The biological functions of hepsin in normal tissues and cancers are not well understood. In vitro data implicate hepsin in the maintenance of cell morphology and cell growth,19 blood coagulation through human factor VII activation20 and developmental processes.7 The evidence for these functions remains inconclusive since, aside from a profound hearing loss,21 hepsin knockout mice develop normally and do not show differences in various measures of blood coagulation compared to wild-type littermates.22, 23

In vitro assays using neutralizing antibodies demonstrated that, while hepsin does not play a role in the proliferation of prostate, ovarian and hepatoma cell lines in culture, it plays a role in the invasion of ovarian and prostate cells in transwell-based invasion assays.24 Recently, Klezovitch et al. provided in vivo evidence that overexpression of hepsin in a mouse model of nonmetastatic prostate cancer has no impact on cell proliferation, but it causes disorganization of the basement membrane and promotes primary prostate cancer progression and metastasis.25 These results are consistent with the notion that malignant cells depend on a group of proteolytic enzymes that are synthesized and secreted by tumor cells to disrupt basement membranes, invade neighboring tissues and metastasize.26

Material and methods

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Antibodies

Antibodies were obtained from the following sources: rabbit polyclonal anti-hepsin antibody raised against a synthetic peptide (aa 241–260) of human hepsin (Cayman Chemical); rabbit polyclonal anti-hepsin antibody raised against a synthetic peptide corresponding to C-terminus (aa 397–416) of rat hepsin (obtained from Dr. Yoko Aniya); monoclonal anti-desmoplakin and anti-α-tubulin (Sigma-Aldrich); monoclonal anti-connexin-43, anti-E-Cadherin, anti-β-Catenin and anti-γ-Catenin (BD Transduction Laboratories); monoclonal anti-occludin (Zymed Laboratories); rabbit polyclonal anti-HGF-α raised against the N-terminal domain of human HGF-α (American Research Products); rabbit polyclonal anti-HGF-α raised against amino acids 32–176 of human HGF-α and monoclonal anti-pan-cytokeratin (Santa Cruz Biotechnology).

Cell lines and culture

The mouse ovarian cancer cell line C11 was generated by infecting ovaries from K5-TVA/p53−/− mice with retroviral RCAS vectors carrying genes that encode mouse K-rasG12D and human c-myc. The human ovarian cancer cell lines OVCAR5 and OVCAR5-TR were obtained from Dr. Michael Seiden. The OVCAR5 cell line was exposed to incrementally increasing concentrations of paclitaxel for 3 months to generate the OVCAR5-TR subline that exhibits resistance to paclitaxel. Fortuitously, the OVCAR5-TR cells lost expression of the desmosomal protein desmoplakin. To render the human cell lines susceptible to avian RCAS virus infection, the avian retroviral receptor TVA was introduced into the OVCAR5 and OVCAR5-TR cells by stable transfection using the FuGENE 6 kit (Roche). SKOV3 cell line was obtained from ATCC. The mouse and human cell lines were maintained in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% glutamine and 1% penicillin/streptomycin (Mediatech).

Retroviral vectors and green fluorescent protein fusion constructs

Wild-type human hepsin full-length cDNA was amplified from a commercial universal human cDNA library (Clontech) using the following PCR primers: ATGGCGCAGAAGGAGGGTGGCCG GACTGTG and TCAGAGCTGGGTCACCATGCCGCTGGCTT CG. The resulting cDNA was sequenced and verified to be identical to the known hepsin cDNA sequence (accession number M18930). The 3 active-site residues H203, D257 and S353 constituting the catalytic triad7 were sequentially mutated into Alanine by PCR-based mutagenesis to create the hepsinmp triple mutant bearing point mutations of H203A, D257A and S353A. Both the wt-hepsin and hepsinmp cDNA were originally carried in the pCEP4 vector (Invitrogen). To isolate the human hepsin and hepsinmp cDNAs, the pCEP4-based plasmids were digested with KpnI and NotI. Gateway technology (Invitrogen) was used to clone hepsin into a destination vector. Purified DNAs were ligated to the pENTR™1A entry cloning vector and transformed into TOP10 cells according to the manufacturer's instructions (Invitrogen). The BP cloning reactions were carried out using the RCAS-Y DV destination vector27 with specific sites (attL x attR). pEGFP-N1 and pEGFP-C3 (Clontech Laboratories) were used to generate N-terminal and C-terminal hepsin-GFP fusion proteins, respectively. Hind III and EcoR I were used to subclone hepsin from pENTR™1A into pEGFP-N1 vector. Hind III and Sac II were used to subclone hepsin from pENTR™1A into pEGFP-C3 vector.

Virus preparation and cell infection

SKOV3 cells were transduced with hepsin or hepsinmpvia retrovirus-mediated gene transfer and subsequent drug selection as previously described.28 To produce retroviruses carrying the RCAS-hepsin, RCAS-hepsinmp and RCAS-GFP plasmids, immortalized DF-1 chicken cells were transfected using the FuGENE 6 kit (Roche) and grown in DMEM supplemented with 10% FBS, 30 g/L Tryptose Phosphate Broth, 1% chicken serum, 1% glutamine and 1% penicillin/streptomycin (Mediatech). The viruses were concentrated as previously described.29, 30 TVA-expressing mouse and human ovarian cancer cell lines were infected daily using frozen concentrated virus or fresh viral supernatants. Infection efficiencies were determined by green fluorescent protein (GFP) expression in infected cells.

Mouse injections

Parental SKOV3 cells and SKOV3 cells that were transduced with hepsin or hepsinmp were injected subcutaneously at the left flank of female athymic nude mice (Crl: NU/NU-nuBR) that were irradiated with 400 rad of γ-rays prior to injection. Each transfectant was injected into a group of 5 mice. The mice were monitored weekly for tumor formation, and tumor size was measured using a caliper. Tumor weight was determined by excising the tumors from mice at the end of experiment. C11 cells that were infected with RCAS-GFP, RCAS-hepsin or RCAS-hepsinmp, were injected intraperitoneally into adult female FVB mice. The mice were sacrificed 6 weeks after cell injection and tumor dimensions, volume of ascites and metastatic pattern for each mouse were recorded.

Immunohistochemistry

Two tissue microarrays were constructed from paraffin-embedded blocks, which included 26 serous, 17 endometrioid, 17 clear cell, 6 mucinous and 4 transitional cell carcinomas. Tissue microarray slides were deparaffinized with xylene and alcohol and microwaved in citrate buffer (pH 6.0) to unmask the epitopes. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide and the slides were then incubated at room temperature for 20 min in 1.5% bovine serum albumin (BSA)/1× phosphate-buffered saline (PBS) to reduce nonspecific background staining. Primary polyclonal hepsin antibody (Cayman Chemical) was applied to the slides at a 1:400 dilution and incubated at room temperature for 30 min. Bound antibody was detected by anti-rabbit horseradish peroxidase-labeled secondary antibody (Vector Laboratories) for 60 min. The slides were stained for 5 min with 0.05% 3′, 3-diaminobenzidine tetrahydrochloride and then counterstained with hematoxylin, dehydrated and mounted. The percentage of positive cells, localization and intensity (1+, 2+, 3+) of staining were recorded.

Immunofluorescence microscopy

Cells grown in slide chambers (Nalgene) were fixed with methanol at −20°C for 20 min. Slides were then washed with PBS and permeabilized for 4 min with 0.1% Triton X-100 in PBS. Nonspecific staining was blocked with 3% goat serum at room temperature for 30 min. Cells were then incubated with specific primary antibodies in PBS/1.5% BSA overnight at 4°C. Secondary antibodies were labeled with fluorescein isothiocyanate (FITC) (Molecular Probes) or Cy3 (Sigma-Aldrich) at room temperature for 60 min. Slides were washed and embedded in mounting medium with 4′, 6′-diamidino-2-phenylindole (DAPI) (Vector Laboratories), and then analyzed with a Carl ZEISS fluorescence microscope and photographed using the MicroMAX (Princeton Instruments) digital system.

Western blotting

Cells were lysed in the CytoBuster™ protein extraction buffer (Novagen) and then centrifuged for 10 min at 4°C to clear the supernatant. The concentration of the extracted protein was determined using the Bio-Rad protein assay kit (Bio-Rad Laboratories). Ten micrograms/lane of the extracted protein were loaded onto 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and electrotransferred to the nitrocellulose membrane (Bio-Rad Laboratories). The membrane was blocked with 5% nonfat dry milk in TBS (10 mM Tris, pH 7.5, 150 mM NaCl) for 1 hr at room temperature, followed by overnight incubation with polyclonal hepsin antibody (Cayman Chemical) in the blocking buffer at 4°C. After washing with TBS-Tween/Triton buffer (20 mM Tris, pH 7.5, 500 mM NaCl, 0.05% Tween-20, 0.2% Triton X-100), the membrane was incubated with horseradish peroxidase-conjugated anti-rabbit IgG antibody (Abcam) at a 1:5,000 dilution in blocking buffer for 1 hr at room temperature. The proteins were visualized using an enhanced chemiluminescence (ECL) system (Pierce Biotechnology).

Results

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Hepsin expression and cellular localization in human ovarian carcinomas

Normal ovaries with epithelial inclusion cysts and the ovarian cancer tissue microarray, consisting of 70 ovarian carcinoma cores flanked with normal liver cores, were immunostained with a rabbit polyclonal antibody raised against a synthetic peptide (aa 241–260) that corresponds to the extracellular domain of human hepsin. Consistent with reports of high levels of hepsin expression in the normal liver,6, 31 hepsin protein was detected in the cytoplasm and membrane of hepatocytes (Fig. 1a). Weak expression of cytoplasmic hepsin was detected in the normal epithelium that lines the ovarian inclusion cyst (Fig. 1b).

thumbnail image

Figure 1. Immunohistochemical detection of hepsin in a normal ovary and in a tissue microarray consisting of normal liver and primary ovarian carcinoma samples. (a) Normal human liver. (b) Ovarian epithelium that lines the inclusion cyst in a normal ovary. (c) Ovarian carcinoma of the serous subtype. (d) Higher magnification shows the localization of hepsin at the sites of cell–cell contact in serous ovarian carcinoma.

Download figure to PowerPoint

To examine the expression and localization of hepsin protein in human ovarian tumors, the percentage of positive cells and the localization and intensity of staining were recorded for 26 serous, 17 endometrioid, 17 clear cell, 6 mucinous and 4 transitional cell carcinomas. Hepsin expression was mainly confined to the epithelial cells and not the adjacent stroma (Figs. 1c and 1d). The majority of tumors displayed cytoplasmic and/or membrane staining. The representative staining patterns in different ovarian carcinoma subtypes are shown in Supplementary Figure 1. All mucinous and transitional cell carcinomas showed cytoplasmic staining. Sixteen of 17 endometrioid carcinomas showed cytoplasmic staining and 1 showed membranous staining. Twelve of 15 clear cell carcinomas showed strong membranous staining. Fourteen serous carcinomas showed predominant membranous staining and 12 had predominant cytoplasmic staining. Overall, cytoplasmic localization of hepsin was prevalent in mucinous, endometrioid and transitional cell carcinomas, while the majority of serous and clear cell carcinomas displayed membranous localization.

Membrane-associated hepsin is present at desmosomal junctions

To gain insight into the function of hepsin in ovarian cancer, we studied its subcellular distribution. The localization of hepsin was determined by immunofluorescence in the methanol-fixed OVCAR5 human ovarian cancer cell line using a rabbit polyclonal antibody raised against a synthetic peptide (aa 241–260) of human hepsin. Immunodetection revealed a granular staining in the cytoplasm as well as punctate staining at the sites of cell–cell contacts (Fig. 2a). The specificity of the membrane staining was demonstrated by complete inhibition of the staining upon preincubation of the antibody with its blocking peptide (not shown). The cytoplasmic and membrane localization of hepsin was confirmed (not shown) with a rabbit polyclonal antibody raised against a synthetic peptide (aa 397–416) corresponding to the C-terminus of rat hepsin.32 Hepsin was present in the cytoplasm and along cell–cell contacts in several other ovarian and prostate cancer cell lines that we examined (not shown).

thumbnail image

Figure 2. Hepsin colocalizes with desmosomal proteins at the cell membrane. (a) Immunofluorescence detection of hepsin in OVCAR5 cells shows that hepsin protein is present in the cytoplasm and linear punctate structures along cell–cell contacts. Two-color immunofluorescence detection of hepsin and desmoplakin in OVCAR5 cells shows that these 2 proteins colocalize in desmosomal junctions. (b) Two-color immunofluorescence detection of hepsin and γ-catenin in OVCAR5 cells shows a partial overlap of these 2 proteins, which is particularly prominent at the membrane. (c) OVCAR5 cells immunolabeled with hepsin (in green) and pan-cytokeratin (in red). In the merged image, hepsin is present at the sites where keratin filaments contact desmosomal junctions (arrows).

Download figure to PowerPoint

To determine the precise localization of hepsin at the cell membrane, we performed 2-color immunofluorescence detection with polyclonal antibodies against hepsin and monoclonal antibodies against proteins specific for cellular junction complexes: connexin-43 for gap junctions, occludin for tight junctions, E-cadherin and β-catenin for adherens junctions and desmoplakin and γ-catenin for desmosomes. Hepsin did not precisely colocalize with connexin-43, occludin, E-cadherin or β-catenin. However, antibodies against desmoplakin and γ-catenin showed overlapping membrane staining to that of antibodies against hepsin, resulting in a punctate yellow line in merged photographs (Figs. 2a and 2b).

These results indicate that hepsin most likely colocalizes with desmosomes. Desmosomes (maculae adherents) are specialized junctions between adjacent epithelial cells that provide mechanical integrity and participate in dynamic processes such as cell adhesion and motility, tissue morphogenesis and differentiation and cell signaling.33 Desmosomes also anchor intermediate filaments through desmoplakin.34, 35 To determine the spatial relationship between hepsin and intermediate filaments, we immunostained subconfluent OVCAR5 cells with hepsin and pan-cytokeratin antibodies (Fig. 2c). The pan-cytokeratin antibody revealed an extensive filamentous network that radiated into the sites of desmosomal cell junctions. Hepsin was localized at the ends of cytokeratin filaments at the sites of cell–cell contacts (Fig. 2c).

To determine whether intact desmosomal structure is necessary for the membrane localization of hepsin, we performed 2-color immunofluorescence for hepsin and desmoplakin in OVCAR5-TR cells. OVCAR5-TR cells display relatively normal adherens junction proteins E-cadherin and β-catenin (not shown), but lack the desmosomal junction protein desmoplakin (Fig. 3a). Hepsin was not present at the cell membrane of OVCAR5-TR cells (Fig. 3a), indicating that intact desmosomes are required for the membrane localization of hepsin.

thumbnail image

Figure 3. Hepsin and HGF-α are present in desmosomes. (a) Immunofluorescence detection of hepsin in OVCAR5 cells and desmoplakin-deficient OVCAR5-TR cells. (b) Immunofluorescence detection of GFP-tagged exogenous hepsin OVCAR5 transfected cells. (c) Two-color immunofluorescence detection of GFP and desmoplakin shows that GFP-tagged hepsin colocalizes with endogenous desmoplakin at the sites of desmosomal junctions. (d) Immunofluorescence detection of HGF-α in OVCAR5 cells. (e) Two-color immunofluorescence detection of HGF-α and desmoplakin shows that these 2 proteins are present at the cell membrane in desmosomes.

Download figure to PowerPoint

Finally, exogenously expressed, GFP-tagged full-length hepsin was detected in the cell cytoplasm as well as in the punctate pattern along the cell membrane of OVCAR5 cells (Fig. 3b). Exogenous GFP-hepsin in these punctate structures colocalized with endogenous desmoplakin (Fig. 3c). Thus, GFP-tagged hepsin displays cytoplasmic and membrane localization, which is very similar to the endogenous hepsin detected by polyclonal antihepsin antibodies. At present, the functional importance of hepsin localization in the desmosomes is unclear.

Hepsin proteolytically processes pro-hepatocyte growth factor (pro-HGF) into a biologically active α/β-heterodimeric HGF that is capable of activating the hepatocyte growth factor receptor c-Met.36, 37 Using immunofluorescence detection, we demonstrated that HGF-α is present at the cell membrane in structures that resemble desmosomal junctions (Fig. 3d). Similar to hepsin, HGF-α colocalizes with desmoplakin (Fig. 3e), which is consistent with the notion that desmosomes are the primary sites for the catalytic activity of membrane-associated hepsin.

Ectopic expression of hepsin promotes ovarian cancer progression in a mouse model

To elucidate the function of overexpressed hepsin in ovarian cancer, we utilized the human ovarian cancer cell line SKOV3 and the mouse ovarian cancer cell line C11. Neither of these cell lines has detectable levels of endogenous hepsin as determined by Western blotting (Fig. 4a). The SKOV3 cells were transfected with wild type hepsin or hepsin with 3 mutated residues in the catalytic domain (hepsinmp). The expression of hepsin protein was confirmed by Western blotting (Fig. 4a). Parental SKOV3 cells and SKOV3 cells that were transduced with hepsin (SKOV3-hepsin) or hepsinmp (SKOV3-hepsinmp) were injected subcutaneously into nude mice and tumor volume was measured over a period of 2 months. The results of 3 independent injection experiments indicate that wild-type hepsin induces slight, but reproducible, tumor growth advantage in nude mice (Fig. 4b). This growth advantage was not observed with the catalytically mutant form of hepsin (Fig. 4b). Mice were also sacrificed for tumor weight determination. The results were consistent with the tumor size measurements with the SKOV3-hepsin cells producing the heaviest tumor mass (859±163 mg) vs. SKOV3-hepsinmp (141 ± 25 mg) and SKOV3 (121 ± 25 mg).

thumbnail image

Figure 4. Overexpression of hepsin in mouse ovarian cancer cells promotes tumor growth. (a) Western blot analysis of hepsin protein expression in the human ovarian cancer cell line SKOV3 and the mouse ovarian cancer cell line C11. (b) Tumor growth in mice injected with parental SKOV3 cells and SKOV3 cells transduced with hepsin (SKOV3-hepsin) or hepsinmp with 3 mutated residues in the catalytic domain (SKOV3-hepsinmp). Equal numbers of cells were injected subcutaneously into nude mice. Each cell line was injected into a group of 5 mice. The mice were monitored weekly for tumor formation and tumor size was measured using a caliper. An asterisk (*) indicates the number of mice that developed tumors out of the 5 injected mice. Only the mice with tumors were included in the analysis. The graph is representative of 3 independent experiments. T-test was used to compare differential tumor size in each cell line: SKOV3-hepsin vs. SKOV3-hepsinmp, p value = 0.022; SKOV3-hepsin vs. SKOV3, p value = 0.027; SKOV3-hepsinmpvs. SKOV3, p value = 0.78. (c) Immunofluorescence detection of ectopic wild type hepsin or mutant hepsin in C11 mouse ovarian cell lines. (d) Examination of FVB mice 6 weeks after intraperitoneal injection with C11 cells that were infected with an RCAS retrovirus carrying GFP (C11-GFP), wild type hepsin (C11-hepsin) or mutant catalytically deficient hepsin (C11-hepsinmp). Twenty-nine mice were injected in each group.

Download figure to PowerPoint

As a second model system we used the mouse ovarian cancer cell line C11, which was generated by infecting ovarian surface epithelial cells from K5-TVA/p53−/− mice with RCAS-c-myc and RCAS-K-ras. These cells proliferate rapidly in culture and form tumors 4–6 weeks upon subcutaneous or intraperitoneal injection into nude mice. C11 cells were infected with RCAS vectors expressing wild-type hepsin (C11-hepsin) or catalytically mutant hepsin (C11-hepsinmp). C11 cells infected with an RCAS vector expressing GFP (C11-GFP) were used as a negative control. The expression of hepsin constructs was confirmed by Western blotting(Fig. 4a) and immunofluorescence with antibodies against hepsin (Fig. 4c). Immunofluorescent detection of ectopically expressed hepsin in C11-hepsin cells revealed cytoplasmic as well as patchy membrane localization (Fig. 4c). However, in C11-hepsinmp cells only the cytoplasmic localization of hepsinmp was observed, indicating that the proteolytic function of hepsin may be required for its localization at the membrane.

The C11 cells were derived from mice on a mixed FVB/C57BL/6J background which are not capable of forming tumors in immunocompetent FVB mice. However, tumor formation can be induced in FVB mice if a potent oncogene, such as polyoma middle T, is introduced into the C11 cells (not shown). To determine whether overexpression of hepsin can also modify the growth properties of C11 cells in FVB mice, the mice were injected intraperitoneally with C11-GFP, C11-hepsin and C11-hepsinmp cells. Six weeks after cell injection, hemorrhagic ascites (Fig. 4c, upper panel) and intraperitoneal tumors (Fig. 4c, lower panel) developed in 14 out of 29 mice that were injected with C11-hepsin cells. Tumor metastatic pattern for each mouse is shown in Supplementary Table I. No tumors were observed in the 29 mice injected with C11-GFP cells or in the 29 mice injected with C11-hepsinmp cells, indicating that enzymatic activity of hepsin may be required for its function in tumor progression.

Discussion

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Many of the membrane-anchored serine proteases have restricted distribution in normal cells, while their expression is frequently dysregulated during cancer progression.17, 38–40 Recent in vitro data support the role for hepsin in prostate and ovarian tumor cell progression.24 Additionally, hepsin overexpression is associated with disorganization of the basement membrane and promotion of metastasis in a mouse model of prostate cancer.25 However, the mechanism by which hepsin contributes to tumorigenesis is unclear. Studies of the functional importance of hepsin overexpression in cell culture systems have resulted in conflicting results. While antihepsin antibodies or antisense oligonucleotides targeting hepsin significantly blocked hepatoma cell growth19 and inhibited invasive characteristics of ovarian and prostate cancer cell lines,24 stable transfection of hepsin cDNA in prostate and ovarian cancer cell lines promoted apoptosis and inhibited growth in soft agar and in nude mice.41, 42

To gain insight into its function, we studied subcellular localization and expression of endogenous hepsin in human ovarian tumors. We showed that the majority of ovarian tumors display cytoplasmic and/or membrane staining and that the membrane staining was predominantly associated with clear cell and serous carcinomas, which may be related to the more intrinsic aggressive nature of these tumor types. Additionally, in patients with serous ovarian carcinomas, membranous expression of hepsin was associated with decreased survival (HR = 7.7, p = 0.003) and shorter mean time to recurrence (1.0 years vs. 2.8 years; p = 0.008) (Elisa Lopez-Varela and Esther Oliva, unpublished), supporting the hypothesis that hepsin is involved in ovarian cancer progression through its interaction with the cell membrane.

The functional role of hepsin overexpression in ovarian cancer progression was evaluated in a mouse model of ovarian cancer. We demonstrated by using human and mouse ovarian cancer cell lines that overexpression of hepsin can promote cancer progression in vivo and that proteolytic activity of hepsin is necessary for this function. The mechanism by which the proteolytic activity of hepsin promotes cancer progression is currently unknown. The catalytic domain of hepsin has a high degree of similarity to the catalytic domain of the Drosophila type II serine protease, stubble-stubbloid, which is known to be involved in signal transduction, cytoskeletal reorganization and changes in cell shape during morphogenesis.43 As a transmembrane protein, hepsin is ideally suited for interaction with cell membrane proteins and proteins on adjacent cells. Additionally, the presence of a short cytoplasmic N-terminal domain suggests a role in intracellular signal transduction. However, evidence that these domains support interactions with extracellular, membrane, or intracellular proteins is still lacking.

We demonstrated that hepsin is localized in the cytoplasm and at desmosomal junctions in ovarian cancer cell lines. Desmosomes represent intracellular adhesive junctions that are involved in cell adhesion, differentiation and signal transduction.33 They also anchor intermediate filaments, thus providing structural integrity. There is cumulative evidence that functional desmosomes are involved in preventing cancer invasion and metastasis.44 The functional significance of hepsins localization at the desmosomal plaque is currently unclear. The only known proteolytic substrate for hepsin is pro-HGF. Hepsin can cleave pro-HGF to generate active HGF, the ligand for the c-Met receptor.36, 37 It has been shown that c-Met overexpression is a prognostic factor in ovarian cancer and that targeting c-Met inhibits ovarian cancer peritoneal dissemination and invasion in a mouse model.45 c-Met is also known to form a complex with the desmosomal protein desmoglein 1.46 In turn, desmosome dissociation is known to be one of the first steps during HGF-induced epithelial-mesenchymal transition.47, 48 Taken together, we propose that, in addition to the demonstrated role of hepsin in extracellular matrix degradation, hepsin and its substrate HGF may play a role in ovarian cancer progression through their interaction with desmosomes. The mechanism and functional significance of this interaction warrants further investigation.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

We acknowledge Dr. Elisa Lopez-Varela for patient data analysis; Dr. Yoko Aniya for the hepsin antibody; Dr. Deyin Xing for generating the C11 mouse ovarian cancer cell lines; Dr. Michael Seiden for providing the human ovarian cancer cell lines; Mr. Kevin Parks for generating the ovarian tissue microarray; Mr. Jianping Zhang for statistical analysis; and Ms. Kristy Daniels for assistance in the preparation of the manuscript.

References

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information
  • 1
    Leytus SP,Loeb KR,Hagen FS,Kurachi K,Davie EW. A novel trypsin-like serine protease (hepsin) with a putative transmembrane domain expressed by human liver and hepatoma cells. Biochemistry 1988; 27: 106774.
  • 2
    Tsuji A,Torres-Rosado A,Arai T,Chou SH,Kurachi K. Characterization of hepsin, a membrane bound protease. Biomed Biochim Acta 1991; 50: 7913.
  • 3
    Tsuji A,Torres-Rosado A,Arai T,Le Beau MM,Lemons RS,Chou SH,Kurachi K. Hepsin, a cell membrane-associated protease. Characterization, tissue distribution, and gene localization. J Biol Chem 1991; 266: 1694853.
  • 4
    Somoza JR,Ho JD,Luong C,Ghate M,Sprengeler PA,Mortara K,Shrader WD,Sperandio D,Chan H,McGrath ME,Katz BA. The structure of the extracellular region of human hepsin reveals a serine protease domain and a novel scavenger receptor cysteine-rich (SRCR) domain. Structure (Camb) 2003; 11: 112331.
  • 5
    Farley D,Reymond F,Nick H. Cloning and sequence analysis of rat hepsin, a cell surface serine proteinase. Biochim Biophys Acta 1993; 1173: 3502.
  • 6
    Kawamura S,Kurachi S,Deyashiki Y,Kurachi K. Complete nucleotide sequence, origin of isoform and functional characterization of the mouse hepsin gene. Eur J Biochem 1999; 262: 75564.
  • 7
    Vu TK,Liu RW,Haaksma CJ,Tomasek JJ,Howard EW. Identification and cloning of the membrane-associated serine protease, hepsin, from mouse preimplantation embryos. J Biol Chem 1997; 272: 3131520.
  • 8
    Li Y,Yu Z,Zhao X,Shen SH. Identification and characterization of hepsin/-TM, a non-transmembrane hepsin isoform. Biochim Biophys Acta 2005; 1681: 15765.
  • 9
    Dhanasekaran SM,Barrette TR,Ghosh D,Shah R,Varambally S,Kurachi K,Pienta KJ,Rubin MA,Chinnaiyan AM. Delineation of prognostic biomarkers in prostate cancer. Nature 2001; 412: 8226.
  • 10
    Ernst T,Hergenhahn M,Kenzelmann M,Cohen CD,Bonrouhi M,Weninger A,Klaren R,Grone EF,Wiesel M,Gudemann C,Kuster J,Schott W, et al. Decrease and gain of gene expression are equally discriminatory markers for prostate carcinoma: a gene expression analysis on total and microdissected prostate tissue. Am J Pathol 2002; 160: 216980.
  • 11
    Luo J,Duggan DJ,Chen Y,Sauvageot J,Ewing CM,Bittner ML,Trent JM,Isaacs WB. Human prostate cancer and benign prostatic hyperplasia: molecular dissection by gene expression profiling. Cancer Res 2001; 61: 46838.
  • 12
    Magee JA,Araki T,Patil S,Ehrig T,True L,Humphrey PA,Catalona WJ,Watson MA,Milbrandt J. Expression profiling reveals hepsin overexpression in prostate cancer. Cancer Res 2001; 61: 56926.
  • 13
    Stamey TA,Warrington JA,Caldwell MC,Chen Z,Fan Z,Mahadevappa M,McNeal JE,Nolley R,Zhang Z. Molecular genetic profiling of Gleason grade 4/5 prostate cancers compared to benign prostatic hyperplasia. J Urol 2001; 166: 21717.
  • 14
    Welsh JB,Sapinoso LM,Su AI,Kern SG,Wang-Rodriguez J,Moskaluk CA,Frierson HF,Jr,Hampton GM. Analysis of gene expression identifies candidate markers and pharmacological targets in prostate cancer. Cancer Res 2001; 61: 59748.
  • 15
    Adib TR,Henderson S,Perrett C,Hewitt D,Bourmpoulia D,Ledermann J,Boshoff C. Predicting biomarkers for ovarian cancer using gene-expression microarrays. Br J Cancer 2004; 90: 68692.
  • 16
    Betsunoh H,Mukai S,Akiyama Y,Fukushima T,Minamiguchi N,Hasui Y,Osada Y,Kataoka H. Clinical relevance of hepsin and hepatocyte growth factor activator inhibitor type 2 expression in renal cell carcinoma. Cancer Sci 2007;98:4918.
  • 17
    Tanimoto H,Yan Y,Clarke J,Korourian S,Shigemasa K,Parmley TH,Parham GP,O'Brien TJ. Hepsin, a cell surface serine protease identified in hepatoma cells, is overexpressed in ovarian cancer. Cancer Res 1997; 57: 28847.
  • 18
    Zacharski LR,Ornstein DL,Memoli VA,Rousseau SM,Kisiel W. Expression of the factor VII activating protease, hepsin, in situ in renal cell carcinoma. Thromb Haemost 1998; 79: 8767.
  • 19
    Torres-Rosado A,O'Shea KS,Tsuji A,Chou SH,Kurachi K. Hepsin, a putative cell-surface serine protease, is required for mammalian cell growth. Proc Natl Acad Sci USA 1993; 90: 71815.
  • 20
    Kazama Y,Hamamoto T,Foster DC,Kisiel W. Hepsin, a putative membrane-associated serine protease, activates human factor VII and initiates a pathway of blood coagulation on the cell surface leading to thrombin formation. J Biol Chem 1995; 270: 6672.
  • 21
    Guipponi M,Tan J,Cannon PZ,Donley L,Crewther P,Clarke M,Wu Q,Shepherd RK,Scott HS. Mice deficient for the type II transmembrane serine protease, TMPRSS1/hepsin, exhibit profound hearing loss. Am J Pathol 2007;171:60816.
  • 22
    Wu Q,Yu D,Post J,Halks-Miller M,Sadler JE,Morser J. Generation and characterization of mice deficient in hepsin, a hepatic transmembrane serine protease. J Clin Invest 1998; 101: 3216.
  • 23
    Yu IS,Chen HJ,Lee YS,Huang PH,Lin SR,Tsai TW,Lin SW. Mice deficient in hepsin, a serine protease, exhibit normal embryogenesis and unchanged hepatocyte regeneration ability. Thromb Haemost 2000; 84: 86570.
  • 24
    Xuan JA,Schneider D,Toy P,Lin R,Newton A,Zhu Y,Finster S,Vogel D,Mintzer B,Dinter H,Light D,Parry R, et al. Antibodies neutralizing hepsin protease activity do not impact cell growth but inhibit invasion of prostate and ovarian tumor cells in culture. Cancer Res 2006; 66: 361119.
  • 25
    Klezovitch O,Chevillet J,Mirosevich J,Roberts RL,Matusik RJ,Vasioukhin V. Hepsin promotes prostate cancer progression and metastasis. Cancer Cell 2004; 6: 18595.
  • 26
    Gupta GP,Massague J. Cancer metastasis: building a framework. Cell 2006; 127: 67995.
  • 27
    Loftus SK,Larson DM,Watkins-Chow D,Church DM,Pavan WJ. Generation of RCAS vectors useful for functional genomic analyses. DNA Res 2001; 8: 2216.
  • 28
    Mu D,Chen L,Zhang X,See LH,Koch CM,Yen C,Tong JJ,Spiegel L,Nguyen KC,Servoss A,Peng Y,Pei L, et al. Genomic amplification and oncogenic properties of the KCNK9 potassium channel gene. Cancer Cell 2003; 3: 297302.
  • 29
    Orsulic S,Li Y,Soslow RA,Vitale-Cross LA,Gutkind JS,Varmus HE. Induction of ovarian cancer by defined multiple genetic changes in a mouse model system. Cancer Cell 2002; 1: 5362.
  • 30
    Xing D,Orsulic S. A mouse model for the molecular characterization of brca1-associated ovarian carcinoma. Cancer Res 2006; 66: 894953.
  • 31
    Zhukov A,Hellman U,Ingelman-Sundberg M. Purification and characterization of hepsin from rat liver microsomes. Biochim Biophys Acta 1997; 1337: 8595.
  • 32
    Kunii D,Shimoji M,Nakama S,Ikebe M,Hachiman T,Sato I,Tamaki A,Yamazaki K,Aniya Y. Purification of liver serine protease which activates microsomal glutathione S-transferase: possible involvement of hepsin. Biol Pharm Bull 2006; 29: 86874.
  • 33
    Green KJ,Gaudry CA. Are desmosomes more than tethers for intermediate filaments? Nat Rev 2000; 1: 20816.
  • 34
    Chang L,Goldman RD. Intermediate filaments mediate cytoskeletal crosstalk. Nat Rev 2004; 5: 60113.
  • 35
    Jefferson JJ,Leung CL,Liem RK. Plakins: goliaths that link cell junctions and the cytoskeleton. Nat Rev 2004; 5: 54253.
  • 36
    Herter S,Piper DE,Aaron W,Gabriele T,Cutler G,Cao P,Bhatt AS,Choe Y,Craik CS,Walker N,Meininger D,Hoey T, et al. Hepatocyte growth factor is a preferred in vitro substrate for human hepsin, a membrane-anchored serine protease implicated in prostate and ovarian cancers. Biochem J 2005; 390: 12536.
  • 37
    Kirchhofer D,Peek M,Lipari MT,Billeci K,Fan B,Moran P. Hepsin activates pro-hepatocyte growth factor and is inhibited by hepatocyte growth factor activator inhibitor-1B (HAI-1B) and HAI-2. FEBS Lett 2005; 579: 194550.
  • 38
    Cane S,Bignotti E,Bellone S,Palmieri M,De las Casas L,Roman JJ,Pecorelli S,Cannon MJ,O'Brien T,Santin AD. The novel serine protease tumor-associated differentially expressed gene-14 (KLK8/Neuropsin/Ovasin) is highly overexpressed in cervical cancer. Am J Obstet Gynecol 2004; 190: 606.
  • 39
    Underwood LJ,Tanimoto H,Wang Y,Shigemasa K,Parmley TH,O'Brien TJ. Cloning of tumor-associated differentially expressed gene-14, a novel serine protease overexpressed by ovarian carcinoma. Cancer Res 1999; 59: 44359.
  • 40
    Wallrapp C,Hahnel S,Muller-Pillasch F,Burghardt B,Iwamura T,Ruthenburger M,Lerch MM,Adler G,Gress TM. A novel transmembrane serine protease (TMPRSS3) overexpressed in pancreatic cancer. Cancer Res 2000; 60: 26026.
  • 41
    Nakamura K,Nasu Y,Hongo A,Matsuo T,Kodama J,Ebara S,Nagai A,Abrzua F,Kumon H,Hiramatsu Y. Hepsin shows inhibitory effects through apoptotic pathway on ovarian cancer cell lines. Int J Oncol 2006; 28: 3938.
  • 42
    Srikantan V,Valladares M,Rhim JS,Moul JW,Srivastava S. HEPSIN inhibits cell growth/invasion in prostate cancer cells. Cancer Res 2002; 62: 681216.
  • 43
    Appel LF,Prout M,Abu-Shumays R,Hammonds A,Garbe JC,Fristrom D,Fristrom J. The Drosophila Stubble-stubbloid gene encodes an apparent transmembrane serine protease required for epithelial morphogenesis. Proc Natl Acad Sci USA 1993; 90: 493741.
  • 44
    Garrod DR. Desmosomes and cancer. Cancer Surv 1995; 24: 97111.
  • 45
    Sawada K,Radjabi AR,Shinomiya N,Kistner E,Kenny H,Becker AR,Turkyilmaz MA,Salgia R,Yamada SD,Vande Woude GF,Tretiakova MS,Lengyel E. c-Met overexpression is a prognostic factor in ovarian cancer and an effective target for inhibition of peritoneal dissemination and invasion. Cancer Res 2007; 67: 16709.
  • 46
    Li G,Schaider H,Satyamoorthy K,Hanakawa Y,Hashimoto K,Herlyn M. Downregulation of E-cadherin and Desmoglein 1 by autocrine hepatocyte growth factor during melanoma development. Oncogene 2001; 20: 812535.
  • 47
    Savagner P,Yamada KM,Thiery JP. The zinc-finger protein slug causes desmosome dissociation, an initial and necessary step for growth factor-induced epithelial-mesenchymal transition. J Cell Biol 1997; 137: 140319.
  • 48
    Watabe M,Matsumoto K,Nakamura T,Takeichi M. Effect of hepatocyte growth factor on cadherin-mediated cell-cell adhesion. Cell Struct Funct 1993; 18: 11724.

Supporting Information

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
IJC_23726_sm_suppinfofigure1.tif3184KSupporting information Figure 1.
IJC_23726_sm_suppinfotable.doc36KSupplementary Table 1. Analysis of FVB mice that were injected with C11 mouse ovarian cancer cell line transduced with GFP (C11-GFP), mutant catalytically inactive hepsin (C11-hepsinmp), and wild type hepsin (C11-hepsin). Abbreviations: IP, intraperitoneal; N/A, not applicable; nd, not determined; D, Diaphragm; I, Injection site; In, Intestine; L, Liver; M, Mesentery; O, Ovary; P, Pancreas; Pe, Peritoneum; S, Spleen; St, Stomach.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.