SEARCH

SEARCH BY CITATION

Keywords:

  • LPL;
  • promoter methylation;
  • prostate cancer;
  • somatic deletion;
  • biallelic inactivation

Abstract

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Lipoprotein lipase (LPL) is in chromosome 8p22, site of one of the most common somatic deletions in prostate tumors. Additionally, a CpG island (CGI) was identified in the LPL promoter region. To test the hypothesis that LPL is a tumor suppressor gene, which is inactivated by somatic deletion and hypermethylation in prostate cancer, we evaluated somatic DNA deletion and methylation status at LPL in 56 pairs of DNA samples isolated from prostate cancer tissues and matching normal controls and 11 prostate cell lines. We found that the DNA in 21 of 56 primary cancers (38%) was methylated in the LPL promoter CGI, whereas no methylation was detected in any normal samples. In addition, we found a hemizygous deletion at LPL in 38 of the 56 tumors (68%). When the results of deletion and methylation were considered together, we found LPL promoter CGI methylation occurred in 45% of LPL deleted tumors and in 22% of LPL retained tumors. Within several clinical characteristics tested, the preoperative PSA levels were found to be significantly higher in subjects with LPL promoter CGI methylation compared with subjects without LPL promoter methylation (p = 0.0012). Additionally, demethylation of the LPL promoter CGI was accompanied by transcriptional reactivation of LPL in the prostate cancer cell lines DU145 and PC3. In summary, we report a novel finding that the LPL gene is commonly methylated in prostate tumors, and our results suggest that biallelic inactivation of LPL by chromosomal deletion and promoter hypermethylation may play a role in human prostate cancer. © 2008 Wiley-Liss, Inc.

Dysregulated changes of genomic DNA, either through permanent alterations in DNA sequences by point mutations and deletions/amplifications or through reversible epigenetic changes such as CpG island (CGI) hypermethylation and histone modification, can induce abnormal changes of gene expression. Altered expression of certain critical genes, e.g., tumor suppressor genes or oncogenes, could induce abnormal cell proliferation and survival and eventually lead to carcinogenesis. In 1971, Knudson formulated the famous “two-hit” hypothesis for inactivating tumor suppressor genes in the process of tumorigenesis.1 The two-hit hypothesis was introduced to describe inactivation of both RB gene alleles via germline and somatic mutations in retinoblastoma and was later extended to include the concept that both alleles of tumor-suppressor genes can be inactivated by both genetic and epigenetic events. The two-hit hypothesis is exemplified by a recent comprehensive study of VHL status among conventional renal cell carcinoma (cRCC) patients. Biallelic inactivation of VHL through somatic mutations, loss of heterozygosity (LOH) and promoter hypermethylation was found in 74.2% of patients with cRCC.2 Similar examples are found for DLC1 and LTF in nasopharyngeal carcinoma, BRCA1 in breast cancer and RIZ1 and VLDLR in gastric cancer.3–7 Therefore, simultaneous examination of genetic and epigenetic alterations would increase the likelihood of detecting genes that are important in prostate cancer development and progression.

Chromosomal region 8p23.1-8p21.1 is the most commonly deleted region in prostate cancer8 and may harbor one or more important prostate cancer-susceptibility loci based on linkage analyses in 159 hereditary prostate cancer families.9, 10LPL, a gene encoding the lipoprotein lipase, was reported as one of the most frequently deleted loci at chromosome 8p22 in prostate cancer. Bova et al. found LPL LOH in 47% of 32 prostate cancer specimens.9 Gallucci et al. reported deletion of LPL in 52 of 76 (68%) localized prostate cancers using FISH analysis.11LPL deletion was reported in many other types of human cancers as well, including gastric, colon and oral cancer.12–14 LPL is a key enzyme involved in lipid homeostasis and transport.15 In addition to catalyzing the hydrolysis of plasma triglycerides in chylomicrons and very low-density lipoprotein, LPL also mediates a bridging function between atherogenic remnant lipoprotein and the receptor.16 Defects in LPL are the cause of Type-I hyperlipoproteinemia (familial hyperchylomicronemia).17

DNA methylation of promoter CGIs is one type of epigenetic modification that regulates gene expression. It is estimated that ∼60% of human genes harbor CGIs in their promoter regions.18 DNA methylation of CGI near the transcription start site often leads to strong transcriptional repression. Promoter CGI hypermethylation of tumor suppressor genes (APC, RASSF1A, etc.) has been reported in many different cancers.19, 20 Recent studies have reported associations between increased prostate cancer risk and methylation of a number of genes including those related to cell cycle control, apoptosis, tissue differentiation, cell growth regulation, DNA repair, detoxification, chromosomal stability, metastasis and invasion.21, 22

A CGI was identified in the LPL promoter region (http://genome.ucsc.edu/). This CGI spans 1163 base pairs and contains 119 CpG dinucleotides ranging from –108 to +1055 relative to the ATG start codon. There are no reports of hypermethylation of the LPL promoter CGI in human cancer. The presence of a CGI in the LPL promoter region combined with the high frequency of inactivation of this gene through deletion led us to hypothesize that aberrant hypermethylation of this CGI could also suppress LPL transcription in prostate cancer. Additionally, biallelic inactivation of LPL by chromosomal deletion and promoter methylation may contribute to prostate tumorigenesis. To test these hypotheses, we examined LPL deletion and promoter CGI methylation status in 56 primary prostate cancer samples.

Material and methods

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Study subjects

All subjects in this study were prostate cancer patients undergoing radical prostatectomy for treatment of clinically localized disease at the Johns Hopkins Hospital. A total of 56 subjects were selected from whom genomic DNA of sufficient amount and purity (>70% cancer cells for cancer specimens, no detectable cancer cells for normal samples) could be obtained by macrodissection of matched nonmalignant (hereafter referred to as normal) and cancer-containing areas of prostate tissue as determined by histological evaluation of H&E stained frozen sections of snap frozen radical prostatectomy specimens. Genomic DNA was isolated from trimmed frozen tissues as described previously.9

Bisulfite modification

The genomic DNA (250 ng) was modified using the EZ DNA methylation–Gold kit following the manufacturer's protocol (Zymo Research, Orange, CA). The manufacturer's recommended alternative reaction conditions were chosen for the modification reaction (98°C for 10 min, 53°C for 30 min, followed by 8 cycles at 53°C for 6 min and 37°C for 30 min).

Bisulfite sequencing analysis

Methylation status was analyzed by bisulfite sequencing. Bisulfite sequencing primers were designed by Methyl Primer Express software (Applied Biosystems, Foster City, CA) to amplify bisulfite modified DNA (Table I). One set of primers, which amplified 474 base pairs including 33 CpG dinucleotides was used for the first round of PCR. Also, the tag-modified bisulfite genomic sequencing method was used for samples that could not generate a clear sequencing chromatogram based on the first round PCR reaction.23 Hotstart PCR (Qiagen, Valencia, CA) was performed using the following cycling program: 95°C for 15 min; 94 °C for 30 sec, 54 °C for 30 sec; and 72°C for 60 sec for 40 cycles and a final step at 72°C for 10 min for the first round PCR reaction. The second round PCR conditions were 95°C for 15 min; 5 cycles of 94°C for 30 sec, 54°C for 30 sec, 72°C for 60 sec and 35 cycles of 94°C for 30 sec, 60°C for 30 sec, 72°C for 60 sec and a final step at 72°C for 10 min. Amplified PCR products were purified using an ExcelaPure ultrafiltration membrane (Edgebiosystems, Gaithersburg, MD), then directly sequenced using BigDye Terminator v1.1 Cycle Sequencing Kits (Applied Biosystems) with sequencing primer. The sequence data were compared with the UCSC genome Ref sequence in order to assess the methylation status of each CpG site.

Table I. Primer Sequences and PCR Conditions Used for the LPL Gene
ReactionForward primerReverse primerAnnealing (°C)
  1. All primers are 5′[RIGHTWARDS ARROW]3′ oriented.

1st round PCRGTTTTGGGGGTTGAGGTTACTACTCCCTACCAACTTTTTA54
2nd round PCRCCACTCACTCACCCACCCGTTTTGGGGGTTGGGGTGGGAGGTGGGAGGGACTACTCCCTACCAACTTT60
 SequencingCTTCAACTACTCTCTATACTACTAT  
Real-time PCR
 LPLCCGAGAGTGAGAACATCCCATTCACCTTTCTGCAAATGAGACACTTTCTC60
 GAPDHGAGTCAACGGATTTGGTCGTTTGATTTTGGAGGGATCTCG60

To verify the methylation status of each individual CpG site, PCR fragments were subcloned using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA). After transformation of Escherichia coli, we randomly selected 10–20 individual E. coli colonies for each sample assessed. Plasmid DNA was isolated after overnight culture of E. coli (GenElute plasmid miniprep kit; Sigma, St. Louis, MO) or directly amplified without bacterial culture (Templiphi amplification kit; GE healthcare, Piscataway, NJ). The plasmids (10–20) were then sequenced using M13 reverse primers.

Cell culture and drug treatment

DU145 prostate cancer cells were cultured in RPMI-1640, supplemented with 5% fetal bovine serum (Invitorogen). PC3 prostate cancer cells were cultured in advanced DMEM, supplemented with 1% Glutamax (Invitrogen) and 1% fetal bovine serum. 5-Aza-2′-deoxycytidine (Sigma) was dissolved in DMSO and added to the culture at a final concentration of 2 μM. The same volume of DMSO was added as a control. Cells were allowed to grow for 96 hr, with changing of chemical-containing medium every 24 hr. Three independent experiments were performed.

Isolation of genomic DNA and mRNA from treated cells

Trizol reagent (1 ml, Invitrogen) was added to a PBS-washed cell culture dish. Following the manufacturer's protocol, RNA was isolated from the aqueous phase of a trizol–chloroform mixture. Isolated RNA was treated with DNase I to remove any contaminated genomic DNA. DNase-treated RNA was repurified using a Micro-to-Midi total RNA purification system (Invitrogen).

Genomic DNA of cultured cells was isolated from the interorganic phase of a trizol–chloroform mixture. We added 0.5 ml of back extraction buffer (4 M guanidine thiocyanate, 50 mM sodium citrate and 1 M Tris pH 8.0) to the interorganic phase of this trizol–chloroform mixture. After vigorous mixing by inversion, phase separation was performed by centrifugation at 12,000 × g for 30 min. DNA was precipitated from the upper aqueous phase by adding isopropanol. Isolated DNA was further purified using Gentra Puregene reagent (Qiagen) with proteinase K treatment. Details of our method were drawn from the manufacturer's protocol.

Real-time reverse-transcription PCR

mRNA (0.6 μg) was reverse transcribed into cDNA with random hexamers using the ThermoScript RT-PCR system (Invitrogen) according to the manufacturer's protocol. Primer for LPL was used as described, and GAPDH was chosen as an endogenous reference housekeeping gene (RealTimePrimers.com, Elkins Park, PA).24 Quantitative real-time PCR was performed using the Applied Biosystems7500 Real-Time PCR System with Power SYBR Green PCR master mix (Applied Biosystems). Each reaction was performed in duplicate, and negative controls were included in each experiment. The gene expression was quantified as the yield of the LPL relative to that of GAPDH. Control sample (DMSO) was employed as a calibrator, and the ΔΔCT formula was used as described.25

Statistical analysis

Differences in the frequencies of DNA methylation at LPL promoter CGI between grades or deletion were tested using Fisher's exact test. The association between LPL promoter CGI methylation and log2 transformed preoperative PSA was tested using students t-test. The preoperative PSA levels were log2 transformed to meet the assumption of normality and equal variances in LPL promoter CGI methylated and unmethylated groups for t-test.

Results

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Methylation status of the LPL promoter CGI in 56 pairs of DNA samples isolated from fresh-frozen prostate cancer tissues and matching normal controls were analyzed using a conventional bisulfite sequencing method and a tag-modified bisulfite genomic sequencing method. Tumor samples showing evidence of hypermethylation of the LPL promoter CGI in bisulfite sequencing analyses were verified by a subcloning method using a pCR4-TOPO vector. Bisulfite sequencing provided the precise methylation status for 33 CpG sites in the LPL promoter CGI (from 98 CpG to 119 CpG and an extra 11 CpGs from outside the CGI). Overall, 21 of the 56 primary prostate cancer samples (38%) showed evidence of DNA methylation of the LPL promoter CGI (Table II). Additionally, methylation of the LPL promoter CGI was not detected in any matching normal prostate controls.

Table II. LPL Methylation and Deletion Status in 56 Prostate Cancer Samples
Gleason scoreLPL (8p) deletionLPLp1
Methylated (%)Unmethylated
  • 1

    p value of two-tailed.

  • 2

    One sample from each group did not have Gleason score information.

6Yes1 (16.7)51.00
No1(33.3)2
7Yes11(61.1)70.10
No2 (22.2)7
8–10Yes4 (33.3)80.61
No1 (16.7)5
TotalYes172 (44.7)2120.14
No4 (22.2)14

The details for determination of LPL promoter CGI methylation status for the 21 samples with evidence of methylation are presented in Supp. Info. Figure 1. Several CpG sites are methylated in multiple samples. For example, the 16th CpG site has the highest degree of methylation (81.3%) among all CpG sites we screened. It was methylated in 19 out of 21 samples, with a majority of the samples showing 100% methylation. On the other hand, the 33rd CpG site has the lowest degree of methylation (9.0%) among all CpG sites we screened. It was methylated in 4 out of 21 samples, with only 1 sample showing 100% methylation. However, we did not observe “consensus” methylated CpG sites or patterns.

Chromosomal deletion of LPL was reanalyzed from previous data.26, 27 Among the 56 prostate cancer samples, 38 (68%) showed hemizygous deletion of the LPL locus. No homozygous deletions of the LPL locus were detected.

We also tested whether LPL promoter CGI methylation was associated with Gleason score. Methylation of the LPL promoter CGI occurred more frequently in low-grade (Gleason score ≤7) tumors compared with high-grade tumors (Gleason score ≥8) (42% vs. 28%; Table III). However, the difference was not statistically significant (p = 0.38, two-tailed). When the association between preoperative PSA levels and LPL promoter CGI methylation was tested, we found that preoperative PSA levels were statistically significantly higher in subjects with LPL promoter hypermethylation (geometric mean = 14.1, 95%CI = 10.8–18.5) than subjects without LPL promoter hypermethylation (geometric mean = 8.0, 95%CI = 6.5–9.7) (p = 0.0012, two-tailed t-test).

Table III. Clinical Characteristics of Prostate Cancer Samples with LPL Methylation and Deletion
 LPL methylated (%) (n=2l)LPL unmethylated (%) (n=35)LPL deletion (%) (n=38)LPL retention (%) (n=18)
  • 1

    One sample from each group did not have Gleason score information.

Gleason scoren = 201n = 341n = 36n = 18
 62 (22.2)7 (77.8)6 (66.7)3 (33.3)
 713 (48.1)14 (51.9)18 (66.7)9 (33.3)
 804 (100)3 (75.0)1 (25.0)
 95 (41.7)7 (58.3)9 (75.0)3 (25.0)
 1002 (100)02 (100)
 ≤715 (41.7)21 (58.3)24 (66.7)12 (33.3)
 ≥85 (27.8)13 (72.2)12 (66.7)6 (33.3)
LPL deletionn = 21n = 35  
 Yes17 (44.7)21 (55.3)  
 No4 (22.2)14 (77.8)  

We tested whether biallelic inactivation occurred for LPL. There was a trend toward more frequent methylation of the LPL promoter CGI when the other LPL allele was deleted. Specifically, the LPL promoter CGI methylation was observed in 45% of LPL deleted tumors, compared with 22% of LPL retained tumors. However, the difference was not statistically significant (p = 0.14, two-tailed), possibly due to small sample size.

Methylation status of the LPL promoter CGI was analyzed by bisulfite sequencing of multiple subclones in prostate cell lines. Human normal prostatic epithelial cells PrEC showed no evidence of methylation in the LPL promoter, whereas the benign prostate hyperplasia cell line BPH1 showed low frequency of methylation (1 of the 12 clones). In contrast, 4 out of 9 prostate cancer cell lines including PC3, CWR22Rv1, E006AA and DU145 showed dense methylation of the LPL promoter CGI (Figs. 1a and 1b). LNCaP showed more heterogeneity in the LPL promoter CGI methylation status, with low frequency of methylation in each CpG site.

thumbnail image

Figure 1. Reduction of LPL hypermethylation and reactivation of LPL expression in prostate cancer cells in vitro by treatment with a demethylating agent. (a) Methylation status of LPL in 11 prostate cell lines (1 for normal epithelia, 1 for benign prostate hyperplasia and 9 for prostate cancer) were analyzed by bisulfite sequencing. (b) Bisulfite sequencing of LPL CGI in 3 prostate cancer cell lines CWR22R1, PC82 and LNCaP. Each row represents one bacterial clone with one circle symbolizing one CpG site. Methylated and unmethylated CpG sites were indicated by black and white circles, respectively. (c) Bisulfite sequencing of LPL CGI after treatment with demethylation agent (Aza-dC) or DMSO (as a control). (d) Analysis of LPL mRNA expression by quantitative RT-PCR after treatment with demethylation agent.

Download figure to PowerPoint

Transcriptional silencing of LPL by promoter methylation has not been reported. To evaluate the effect of promoter methylation on LPL expression, the DU145 and PC3 prostate cancer cell lines were treated with DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (decitabine). The methylation status of LPL promoter CGI was analyzed using bislufite sequencing of multiple subclones. Bisulfite sequencing analysis of the LPL promoter CGI in DU145 and PC3 demonstrated that treatment of 5-aza-2′-deoxycytidine resulted in demethylation in the LPL promoter CGI (Fig. 1c and Supplementary Fig. 2). Real-time PCR results demonstrated that demethylation of LPL promoter CGI was accompanied with transcriptional reactivation of LPL (Fig. 1d). The data indicate that silencing of the LPL gene was achieved through promoter methylation in this prostate cancer cell line. The difference in transcriptional reactivation levels between these two cell lines is probably due to a difference in sensitivity to 5-aza-2′-deoxycytidine or a difference in LPL deletion status (PC3 was hemizygously deleted at the LPL locus, and DU145 retained both copies of LPL).

Discussion

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

We have described the methylation status of the LPL promoter CGI at chromosome 8p22 in prostate cancer and its relationship with somatic DNA deletion. Chromosome 8p was the most commonly deleted region in human cancer DNA, and the LPL region has been extensively studied in many different cancers.9, 11–14, 28–30 The frequency of LPL deletion (68%) in this study was in the range of previous studies (22–68%). However, our study is the first to describe differential methylation of the LPL promoter CGI in human cancer.

It is interesting to note that LPL expression levels were downregulated in primary tumors compared with normal prostate tissues, but the expression levels were higher in metastatic tumors compared with primary tumors in several microarray datasets deposited in Oncomine (http://www.oncomine.org/). It is possible that downregulation of LPL in primary tumors through promoter CGI hypermethylation may be involved in tumor initiation, and that reactivation of LPL through promoter CGI demethylation may promote tumor progression and metastasis.

A statistically significant difference of LPL deletion between high-grade (Gleason score >7; 93%) and low-grade (Gleason score <7; 50%) cancers (p < 0.04) has been previously reported.11 When we evaluated the relationship between LPL deletion and Gleason score, contrary to previous published results by Gallucci et al., there was no difference in LPL deletion between the high-grade tumors (67%) and low-grade tumors (67%). The discrepancy between these two studies could be due to the relatively small sample sizes.

Biallelic inactivation by both allelic loss and methylation silencing has been documented for CDKN2A and SPRY2 in prostate cancer. Concomitant methylation and loss of heterozygocity of CDKN2A was found in 1 out of the 24 cancer samples tested.31 Biallelic inactivation of SPRY2 was also found in 40% of 31 prostate cancers.32 This biallelic inactivation via multiple mechanisms also occurs in other tumors as well. Kuroki et al. investigated LOH and promoter methylation of four different tumor suppressor genes in esophageal squamous cell carcinoma.33FHIT hypermethylation was observed in 15 of 23 tumors (65%) with FHIT LOH and in 5 of 21 tumors (24%) without FHIT LOH. This correlation between FHIT hypermethylation and LOH was statistically significant (p = 0.008).

LPL has been known to play key roles in a number of human diseases, including atherosclerosis, obesity, diabetes, chylomicronaemia, Alzheimer's disease and cachexia.34 The LPLS447X polymorphism was found to be associated with an increased risk for high-grade prostate cancer.35 Alterations of the LPL gene in prostate cancer were first reported three decades ago. LPL response to heparin was significantly decreased in prostate cancer patients, compared with a control benign disease group.36 The investigators explained these results as being due to a reduction of enzyme activity in tumor tissue. We show here that this decreased enzyme activity may be explained by chromosomal deletion of the LPL locus and/or CGI hypermethylation of the LPL promoter in prostate cancer.

LPL has been implicated to be involved in the carcinogenesis process. APC gene-deficient familial adenomatous polyposis model mice have markedly lower levels of LPL mRNA in the liver and small intestine compared with wild-type controls, and upregulation of LPL mRNA levels by LPL activator reduced the number and size of intestinal and colon polyps in these mice.37 Two different mechanisms might be involved in the role of LPL in human carcinogenesis. First is the antiinflammatory activity of LPL. A recent study showed that LPL treatment suppressed tumor necrosis factor-α- and interferon-γ-mediated inflammatory gene expression by inactivation of transcription factor nuclear factor kappa B (NF-κB) in endothelial cells.38 Activation of NF-κB was involved in cancer development and progression. Second, LPL activity could modify the apoptosis pathway. Lipoproteins treated with LPL stimulated the activity of phosphatase type 2C β and trigged apoptosis.39

In summary, we found that promoter CGI hypermethylation of LPL may alter expression of the LPL gene and may therefore contribute to prostate cancer development. Our initial investigation of the LPL locus suggests that biallelic inactivation of LPL by chromosomal deletion and promoter methylation may play an important role in prostate cancer. However, because of the limitations of our study such as limited sample size and lack of RNA expression data in prostate tissues, additional studies are needed to verify our results.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

The authors thank all the study subjects who participated in this study. The authors thank Mr. A.R. Turner and Ms. T.S. Adams for editorial assistance. This study is supported by the National Cancer Institute to J.X. and B.C.

References

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information
  • 1
    Knudson AG,Jr. Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci USA 1971; 68: 8203.
  • 2
    Banks RE,Tirukonda P,Taylor C,Hornigold N,Astuti D,Cohen D,Maher ER,Stanley AJ,Harnden P,Joyce A,Knowles M,Selby PJ. Genetic and epigenetic analysis of von Hippel-Lindau (VHL) gene alterations and relationship with clinical variables in sporadic renal cancer. Cancer Res 2006; 66: 200011.
  • 3
    Peng D,Ren CP,Yi HM,Zhou L,Yang XY,Li H,Yao KT. Genetic and epigenetic alterations of DLC-1, a candidate tumor suppressor gene, in nasopharyngeal carcinoma. Acta Biochim et Biophys Sini 2006; 38: 34955.
  • 4
    Tokumaru Y,Nomoto S,Jeronimo C,Henrique R,Harden S,Trink B,Sidransky D. Biallelic inactivation of the RIZ1 gene in human gastric cancer. Oncogene 2003; 22: 69548.
  • 5
    Wei M,Grushko TA,Dignam J,Hagos F,Nanda R,Sveen L,Xu J,Fackenthal J,Tretiakova M,Das S,Olopade OI. BRCA1 promoter methylation in sporadic breast cancer is associated with reduced BRCA1 copy number and chromosome 17 aneusomy. Cancer Res 2005; 65: 106929.
  • 6
    Yi HM,Li H,Peng D,Zhang HJ,Wang L,Zhao M,Yao KT,Ren CP. Genetic and epigenetic alterations of LTF at 3p21.3 in nasopharyngeal carcinoma. Oncol Res 2006; 16: 26172.
  • 7
    Takada H,Imoto I,Tsuda H,Nakanishi Y,Sakakura C,Mitsufuji S,Hirohashi S,Inazawa J. Genomic loss and epigenetic silencing of very-low-density lipoprotein receptor involved in gastric carcinogenesis. Oncogene 2006; 25: 655462.
  • 8
    Sun J,Liu W,Adams TS,Sun J,Li X,Turner AR,Chang B,Kim JW,Zheng SL,Isaacs WB,Xu J. DNA copy number alterations in prostate cancers: a combined analysis of published CGH studies. Prostate 2007; 67: 692700.
  • 9
    Bova GS,Carter BS,Bussemakers MJ,Emi M,Fujiwara Y,Kyprianou N,Jacobs SC,Robinson JC,Epstein JI,Walsh PC. Homozygous deletion and frequent allelic loss of chromosome 8p22 loci in human prostate cancer. Cancer Res 1993; 53: 386973.
  • 10
    Xu J,Zheng SL,Hawkins GA,Faith DA,Kelly B,Isaacs SD,Wiley KE,Chang B,Ewing CM,Bujnovszky P,Carpten JD,Bleecker ER, et al. Linkage and association studies of prostate cancer susceptibility: evidence for linkage at 8p22–23. Am J Hum Genet 2001; 69: 34150.
  • 11
    Gallucci M,Merola R,Farsetti A,Orlandi G,Sentinelli S,De Carli P,Leonardo C,Carlini P,Guadagni F,Sperduti I,Cianciulli AM. Cytogenetic profiles as additional markers to pathological features in clinically localized prostate carcinoma. Cancer Lett 2006; 237: 7682.
  • 12
    Baffa R,Santoro R,Bullrich F,Mandes B,Ishii H,Croce CM. Definition and refinement of chromosome 8p regions of loss of heterozygosity in gastric cancer. Clin Cancer Res 2000; 6: 13727.
  • 13
    Cunningham C,Dunlop MG,Wyllie AH,Bird CC. Deletion mapping in colorectal cancer of a putative tumour suppressor gene in 8p22-p21.3. Oncogene 1993; 8: 13916.
  • 14
    Liu CJ,Lin SC,Chen YJ,Chang KM,Chang KW. Array-comparative genomic hybridization to detect genomewide changes in microdissected primary and metastatic oral squamous cell carcinomas. Mol Carcinog 2006; 45: 72131.
  • 15
    Merkel M,Eckel RH,Goldberg IJ. Lipoprotein lipase: genetics, lipid uptake, and regulation. J Lipid Res 2002; 43: 19972006.
  • 16
    Beisiegel U,Weber W,Bengtsson-Olivecrona G. Lipoprotein lipase enhances the binding of chylomicrons to low density lipoprotein receptor-related protein. Proc Natl Acad Sci USA 1991; 88: 83426.
  • 17
    Havel RJ,Gordon RS,Jr. Idiopathic hyperlipemia: metabolic studies in an affected family. J Clin Invest 1960; 39: 177790.
  • 18
    Antequera F,Bird A. Number of CpG Islands and Genes in Human and Mouse. Proc Natl Acad Sci USA 1993; 90: 119959.
  • 19
    Hiltunen MO,Alhonen L,Koistinaho J,Myohanen S,Paakkonen M,Marin S,Kosma VM,Janne J. Hypermethylation of the APC (adenomatous polyposis coli) gene promoter region in human colorectal carcinoma. Int J Cancer 1997; 70: 6448.
  • 20
    Dammann R,Yang G,Pfeifer GP. Hypermethylation of the cpG island of Ras association domain family 1A (RASSF1A), a putative tumor suppressor gene from the 3p21.3 locus, occurs in a large percentage of human breast cancers. Cancer Res 2001; 61: 31059.
  • 21
    Li LC,Carroll PR,Dahiya R. Epigenetic changes in prostate cancer: implication for diagnosis and treatment. J Natl Cancer Inst 2005; 97: 10315.
  • 22
    Yegnasubramanian S,Kowalski J,Gonzalgo ML,Zahurak M,Piantadosi S,Walsh PC,Bova GS,De Marzo AM,Isaacs WB,Nelson WG. Hypermethylation of CpG islands in primary and metastatic human prostate cancer. Cancer Res 2004; 64: 197586.
  • 23
    Han W,Cauchi S,Herman JG,Spivack SD. DNA methylation mapping by tag-modified bisulfite genomic sequencing. Anal Biochem 2006; 355: 5061.
  • 24
    Heintel D,Kienle D,Shehata M,Krober A,Kroemer E,Schwarzinger I,Mitteregger D,Le T,Gleiss A,Mannhalter C,Chott A,Schwarzmeier J, et al. High expression of lipoprotein lipase in poor risk B-cell chronic lymphocytic leukemia. Leukemia 2005; 19: 121623.
  • 25
    Livak KJ,Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001; 25: 4028.
  • 26
    Liu W,Chang B,Sauvageot J,Dimitrov L,Gielzak M,Li T,Yan G,Sun J,Sun J,Adams TS,Turner AR,Kim JW, et al. Comprehensive assessment of DNA copy number alterations in human prostate cancers using Affymetrix 100K SNP mapping array. Genes Chromosomes Cancer 2006; 45: 101832.
  • 27
    Liu W,Chang BL,Cramer S,Koty PP,Li T,Sun J,Turner AR,Kap-Herr C,Bobby P,Rao J,Zheng SL,Isaacs WB, et al. Deletion of a small consensus region at 6q15, including the MAP3K7 gene, is significantly associated with high-grade prostate cancers. Clin Cancer Res 2007; 13: 502833.
  • 28
    Macoska JA,Trybus TM,Benson PD,Sakr WA,Grignon DJ,Wojno KD,Pietruk T,Powell IJ. Evidence for three tumor suppressor gene loci on chromosome 8p in human prostate cancer. Cancer Res 1995; 55: 53905.
  • 29
    Kagan J,Stein J,Babaian RJ,Joe YS,Pisters LL,Glassman AB,von Eschenbach AC,Troncoso P. Homozygous deletions at 8p22 and 8p21 in prostate cancer implicate these regions as the sites for candidate tumor suppressor genes. Oncogene 1995; 11: 21216.
  • 30
    Vocke CD,Pozzatti RO,Bostwick DG,Florence CD,Jennings SB,Strup SE,Duray PH,Liotta LA,Emmert-Buck MR,Linehan WM. Analysis of 99 microdissected prostate carcinomas reveals a high frequency of allelic loss on chromosome 8p12–21. Cancer Res 1996; 56: 24116.
  • 31
    Jarrard DF,Bova GS,Ewing CM,Pin SS,Nguyen SH,Baylin SB,Cairns P,Sidransky D,Herman JG,Isaacs WB. Deletional, mutational, and methylation analyses of CDKN2 (p16/MTS1) in primary and metastatic prostate cancer. Genes Chromosomes Cancer 1997; 19: 906.
  • 32
    McKie AB,Douglas DA,Olijslagers S,Graham J,Omar MM,Heer R,Gnanapragasam VJ,Robson CN,Leung HY. Epigenetic inactivation of the human sprouty2 (hSPRY2) homologue in prostate cancer. Oncogene 2005; 24: 216674.
  • 33
    Kuroki T,Trapasso F,Yendamuri S,Matsuyama A,Alder H,Mori M,Croce CM. Allele loss and promoter hypermethylation of VHL, RAR-beta, RASSF1A, and FHIT tumor suppressor genes on chromosome 3p in esophageal squamous cell carcinoma. Cancer Res 2003; 63: 37248.
  • 34
    Mead JR,Irvine SA,Ramji DP. Lipoprotein lipase: structure, function, regulation, and role in disease. J Mol Med 2002; 80: 75369.
  • 35
    Narita S,Tsuchiya N,Wang L,Matsuura S,Ohyama C,Satoh S,Sato K,Ogawa O,Habuchi T,Kato T. Association of lipoprotein lipase gene polymorphism with risk of prostate cancer in a Japanese population. Int J Cancer 2004; 112: 8726.
  • 36
    Ham JM,Jones M,Kemp D. Platelet adhesiveness and lipoprotein lipase activity in patients with benign and malignant disease of the prostate. Br J Surg 1972; 59: 602.
  • 37
    Niho N,Mutoh M,Takahashi M,Tsutsumi K,Sugimura T,Wakabayashi K. Concurrent suppression of hyperlipidemia and intestinal polyp formation by NO-1886, increasing lipoprotein lipase activity in Min mice. Proc Natl Acad Sci USA 2005; 102: 29704.
  • 38
    Kota RS,Ramana CV,Tenorio FA,Enelow RI,Rutledge JC. Differential effects of lipoprotein lipase on tumor necrosis factor-alpha and interferon-gamma-mediated gene expression in human endothelial cells. J Biol Chem 2005; 280: 3107684.
  • 39
    Schwarz S,Hufnagel B,Dworak M,Klumpp S,Krieglstein J. Protein phosphatase type 2Calpha and 2Cbeta are involved in fatty acid-induced apoptosis of neuronal and endothelial cells. Apoptosis 2006; 11: 11119.

Supporting Information

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
IJC_22972_sm_suppinfofigure1.tif1513KSupplementary Figure 1. Bisulfite sequencing of LPL CGI in prostate cancer samples. Each row represents one tumor sample with one circle symbolizing one CpG site. The percentage of methylation in each CpG site was calculated from methylated clones of each sample.
IJC_22972_sm_suppinfofigure2.tif1487KSupplementary Figure 2. Bisulfite sequencing of LPL CGI in PC3 after treatment with demethylation agent (Aza-dC) or DMSO (as a control). Methylated and unmethylated CpG sites were indicated by black and white circles, respectively.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.