SEARCH

SEARCH BY CITATION

Keywords:

  • IGF-1 receptor;
  • cell signaling;
  • degradation

Abstract

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

IGF-1 receptor (IGF-1R) plays a key role in the development of numerous tumors. Blockade of IGF-1R axis using monoclonal antibodies constitutes an interesting approach to inhibit tumor growth. We have previously shown that h7C10, a humanized anti–IGF-1R Mab, exhibited potent antitumor activity in vivo. However, mechanisms of action of h7C10 are still unknown. Here, we showed that h7C10 inhibited IGF-1–induced IGF-1R phosphorylation in a dose-dependent manner. Also, h7C10 abolished IGF-1–induced activation of PI3K/AKT and MAPK pathways. Cell cycle progression and colony formation were affected in the presence of h7C10 probably because of the inhibition of IGF-1–induced cyclin D1 and E expression. In addition, we demonstrated that h7C10 induced a rapid IGF-1R internalization leading to an accumulation into cytoplasm resulting in receptor degradation. Using lysosome and proteasome inhibitors, we observed that the IGF-1R α- and β-chains could follow different degradation routes. Thus, we demonstrated that antitumoral properties of h7C10 are the result of IGF-1–induced cell signaling inhibition and down-regulation of IGF-1R level suggesting that h7C10 could be a candidate for therapeutic applications. © 2008 Wiley-Liss, Inc.

The Type I insulin-like growth factor receptor (IGF-1R) is a tyrosine kinase receptor mediating metabolic, mitogenic and antiapoptotic pathways induced by both insulin-like growth factor 1 (IGF-1) and insulin-like growth factor 2 (IGF-2).1 It also binds insulin but with 100 to 1,000-fold lower affinity.2 Several in vitro studies showed that inhibition of IGF-1R expression or activation inhibited cancer cell growth and colony formation.3, 4 These findings were confirmed in animal models, where IGF-1R antisense oligonucleotides injected intraperitoneally in nude mice inhibited the growth of human cancers.5, 6 The link between cancer and IGF signaling is also consistent with epidemiological studies showing that elevated levels of IGF-1 are associated with an increased relative risk of developing colon, prostate, breast, lung and bladder cancers.7–9

IGF-1R functions as a heterotetramer composed of 2 extracellular ligand binding α-subunits and 2 β-subunits comprising both the transmembrane and tyrosine kinase domains.1 Once autophosphorylated, IGF-1R binds and phosphorylates on various tyrosine substrates, such as insulin receptor substrates (IRS-1 to 4)10–12 and Shc (Src Homology Collagen protein).13 These substrates serve as docking molecules for other proteins containing SH2 domains including p85 regulatory subunit of PI 3-kinase and Grb2 that lead to the activation of two main signaling pathways, of PI 3-kinase/Akt14 and MAPK pathways.15 MAPK and of PI 3-kinase/Akt pathways are considered to be essential for cell proliferation, anchorage-independent growth and to mediate antiapoptotic signal of IGF-1.

On ligand binding, tyrosine kinase receptors are usually internalized leading to receptor translocation from plasma membrane to lysosomes.16 Because of homologies of IGF-1R with insulin receptor (IR) signaling, it was suggested that IGF-1 binding to IGF-1R leads to receptor internalization into early endosomes via clathrin-coated pits or caveolae17, 18 resulting in a partial receptor degradation through a process requiring receptor ubiquitination.19–23 Recent studies have implicated 2 E3 ligases, Mdm2 and Nedd4, in IGF-1R ubiquitination and degradation.20, 21 Mdm2 requires β-arrestin as an adaptor to interact with IGF-1R.24 The tumor suppressor p53 has also been described as involved in the regulation of IGF-1R degradation through Mdm2. However, its role seems complex and not very well defined.25 In Nedd4 and IGF-1R overexpressing cells, the Grb10/Nedd4/IGF-1R complex has been shown to induce receptor ubiquitination and internalization.20 These studies indicate that ubiquitination of IGF-1R is a well established event whereas the molecular mechanisms (proteasomal and/or lysosomal pathways) involved in the degradation of IGF-1R are dependent on cell type used and are still unclear.22, 25, 26

Strategies targeting IGF pathway constitute a promising tool to inhibit tumor development. Most of the anti–IGF-1 strategies have been directed against the receptor itself. Monoclonal antibodies,27–33 tyrosine kinase inhibitors,34, 35 antisense oligonucleotides directed against IGF-1R mRNA36 or dominant negative approaches have been reported to inhibit in vitro and/or in vivo tumor proliferation. We have previously shown that h7C10, a humanized monoclonal antibody anti–IGF-1R, inhibits both the in vitro and in vivo growth of breast (MCF-7 and MDA-MB231) and NSCLC tumor cells.29, 31 Here, we investigated the effect of h7C10 on IGF-1–induced cell signaling and examined the mechanisms involved by h7C10 to inhibit tumor growth. Our results suggest that h7C10 antitumor activity results from inhibition of IGF-1–induced MAPK and PI3K/AKT activation pathways leading to inhibition of cell cycle progression and anchorage-independent growth. In addition, we showed that h7C10 also induces both internalization and degradation of IGF-1R.

Material and methods

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Materials

The radionucleide [γ32P] ATP (6000 Ci/mmol) was obtained from Perkin Elmer Life Sciences (Boston, MA). Dulbecco Modified Eagle Medium (DMEM) and F12 media, penicillin, streptomycin and trypsin were obtained from Invitrogen (Gaithersburg, MD). Recombinant human EGF was obtained from Upstate Biotechnology. PMSF, leupeptin, aprotinin and protein A-agarose and phosphatidylinositol were purchased from Sigma. Triton, SDS and nitrocellulose membrane were obtained from Bio-Rad Laboratories (Richmond, CA) and premade polyacrylamide solution protogel was from Prolabo (National Diagnostic, France). Silica TLC plates were obtained from Carlo Erba (France).

Growth factors, compounds and antibodies

Human recombinant IGF-1 and IGF-2 were purchased from Sigma (Sigma Chemical CO, St. Louis). Insulin was purchased from Invitrogen Corporation. h7C10 is a recombinant humanized antibody directed against IGF-1R. 12B1, a murine anti–IGF-1R Mab recognizing an epitope different from the one targeted by h7C10 was produced as previously described in Goetsch et al. An irrelevant human IgG1 (hIgG1) was purchased from The Binding Site (Birmingham, UK). Rabbit polyclonal antibodies to phospho-Akt (Ser 473), Akt, phospho-Erk1/2 (Thr202/Tyr204), beta arrestin 1, phospho-ser-Mdm2, phospho-beta arrestin 1, phospho ser-p53, phospho-p38 (Thr180/Tyr182), phospho-JNK1/2 (Thr183/Tyr185), Rb and phospho-Rb were purchased from New England Biolabs (Beverly, MA); rabbit polyclonal antibodies to EGFR (1005), ERK2 (C14), p38 (C20), JNK2 (N18), IGF-1R (C20), IR (C19), cyclin D1 (M20) and cyclin E (C19) from Santa Cruz Biotechnology (Santa Cruz, CA); antibodies to rabbit IRS-1, IRS-2, phospho-Shc (Y317), Shc (66 kDa), Grb10 and mouse p85 regulatory subunit of PI3′-kinase (αp85) were purchased from Upstate Biotechnology. Antiphosphotyrosine (PY20) and anti-Nedd4 antibodies were from Transduction Laboratories (Lexington, KY); chloroquine, NH4Cl and methylamine, mouse monoclonal anti-actin, anti-tubulin and anti-vinculin antibodies from Sigma Chemical and anti-ubiquitin monoclonal antibody from BIOMOL International, L.P. EEA1 monoclonal antibody was purchased from Affinity Bioreagents (Golden) and lamp1, lamp2 from Abcam (Cambridge, UK) and CD63 from BD biosciences. MG115, MG132 and epoxomycine were purchased from Calbiochem. Bortezomib synthesized in Pierre Fabre Laboratories (Castres, France), were all solubilized in DMSO to achieve a concentration of 0.1% in the final reaction volume.

Cell culture and transfection

The estrogen-dependent breast cancer cell line MCF-7 was obtained from the American Type Culture Collection (Rockville, MD). MCF-7 cells were subcultured twice a week in phenol red-free RPMI 1640 medium (Invitrogen Corporation, Scotland, UK) supplemented with 10% fetal calf serum (FCS) (Invitrogen Corporation) and 1 mM L-glutamine (Invitrogen Corporation). Cells demonstrated more than 95% viability and were routinely tested for the absence of Mycoplasma contamination. Cells were transfected using the GeneSilencer transfection reagent (Roche Diagnostics, Meylan, France), according to the manufacturer's instructions.

Synthesis of siRNAs

To design β-arrestin-1–specific siRNA duplexes, the mRNA sequences for human β-arrestin 1 was screened for unique 21-nt sequences in the National Center for Biotechnology Information database by using the BLAST search algorithm. The accession number in brackets given below is from GenBank. The siRNA sequence targeting beta-arrestin 1 (NM-020251) is 5′-AAAGC CUUCUGCGCGGAGAAU-3′ and correspond to the positions 439–459 relative to the start codon. One small RNA duplex was synthesized and used as a control. The design of this latter RNA is 5′AAGUGGACCCUGUAGAUGGCG3′ and has no silencing effects on β-arrestin expression.

PI3K assay

PI3K activity was determined as previously described.37 Briefly, cell lysates were prepared on ice in extraction buffer composed of 20 mM Tris (pH 7.5), 137 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 150 mM Na3VO4, 1% Nonidet P-40, 10% glycerol (v/v), 2 mM PMSF and 10 μg/mL aprotinin in phosphate buffered saline (PBS). Cell lysates were clarified and total p85 was immunoprecipitated. The pellet was resuspended in 40 μL of a buffer containing 10 mM Tris-HCl (pH 7.5), 100 mM NaCl and 1 mM EDTA. Ten microliters of MnCl2 (100 mM) and 20 μg of phosphatidylinositol were added in each tube. The reaction was initiated by addition of 10 μL of ATP (440 μM) containing 30 μCi of (γ-32P)ATP. Reactions were performed at room temperature for 10 min and quenched with 20 μL of HCl (8N) and 160 μL of CHCl3:CH3OH (1:1). After centrifugation (3000g for 4 min at 4°C), the organic phase was extracted and applied to a silica gel thin layer chromatography (TLC) plate. TLC plates were developed in CHCl3/CH3OH/H2O/NH4OH (120:94:22.6:4), dried and the radioactivity was quantified with a PhosphoImager apparatus (Storm, Molecular Dynamic).

Immunoprecipitation and immunoblotting

Cells were plated into 75 cm2 culture dishes and grown in complete medium (red phenol-free RPMI with 10% FCS and 1% L-glutamine) to 70–80% confluence. Monolayers were washed twice with PBS, cultured in serum-free medium overnight and then incubated for appropriate times with various molecules as described in the figure legend section. Cells were scraped in a lysis buffer (pH 7.5) containing 10 mM Tris HCl buffer (pH 7.5), 15% NaCl (1 M), 10% detergent mix (10 mM Tris-HCl, 10% Igepal lysis buffer) (Sigma Chemical), 5% sodium deoxycholate (Sigma Chemical Co.), 1 protease inhibitor cocktail complete TM tablet (Roche), 1% phosphatase inhibitor Cocktail Set II (Calbiochem), for 90 min at 4°C. The lysates were clarified by centrifugation at 4°C. After immunoprecipitations, immunocomplexes were resuspended in 2× Laemmli sample buffer and heated for 5 min at 100°C and kept at −20°C or directly loaded on 4–12% SDS-PAGE gels. Incubation of primary antibody was performed for 2 hr at room temperature and incubated with HRP-linked secondary antibodies for 1 hr at room temperature. Membranes were washed in TBST prior to visualization of proteins with ECL (Amersham Biosciences AB, Uppsala, Sweden). Blots were quantified using the software MacBas V2.52 (Fuji PhotoFilm). Phospho-protein values were normalized with total protein level and then represented as a ratio of unstimulated state (time 0 or unstimulated state = 1) as reported (Dupont et al., 2000).

Internalization and degradation of IGF-1R α- and β-chains by FACS analysis

Internalization and degradation studies of IGF-1R α-chain (IGF-1R α) were performed using the 12B1 murine anti–IGF-1R Mab. Adherent MCF-7 cells were seeded at 6 × 104 cells/cm2 for 20 hr in complete culture medium. Cells were washed twice with PBS and serum was withdrawn. Cells were incubated for one additional hour at 37°C with either lysosome or proteasome inhibitors before adding h7C10 or hIgG1 antibodies at the final concentration of 10 μg/mL for indicated times. To assess membrane expression of IGF-1Rα, monoclonal antibody 12B1 was incubated with cells at 20 μg/mL for 20 min in PBS/BSA 1%/ NaN3 0.09%. After 3 washes, cells were incubated with anti-mouse IgG Alexa Fluor® 488-conjugated secondary antibody (Molecular Probes) for 20 min at 4°C. Cells were washed and analyzed by flow cytometry (Facscalibur, Becton Dickinson). Permeabilization of MCF-7 was performed to evaluate total IGF-1R expression. Cells were fixed for 15 min with PFA 2% at room temperature and washed with saponine 0.1% either in the presence of 12B1 or with a polyclonal anti–IGF-1R β-chain antibody. Secondary antibody was incubated in PBS-saponine 0.01% for 20 min, washed and analyzed by fluorescence-activated cell-sorting. The level of IGF-1R-α or IGF-1R-β in cells treated with h7C10, but without inhibitors, was considered as a maximal degradation and referred as 100% of degradation. Percentage of protective effect was calculated as 100 − % of degradation.

Immunofluorescence microscopy

Adherent MCF-7 cells were incubated with either 10 μg/mL h7C10 or hIgG1 for indicated times at 37°C. Cells were washed 3 times with PHEM buffer and fixed in 4% PFA in PHEM for 20 min at room temperature. Cells were permeabilized with triton X100, 0.1% for 25 min and nonspecific binding was blocked with 5% goat serum (DAKO, Glostrup, Denmark) in PBS for 1 hr at 4°C, rinsed with PBS and incubated with Mab 12B1 for 2 hr at 4°C. Cells were then incubated with Alexa Fluor 488-conjugated anti-mouse antibody for 1 hr at 4°C and rinsed in PBS. For double-immunofluorescence labeling, EEA1, Lamp1, Lamp2 and CD63 antibodies were directly labeled by using Zenon Alexa Fluor 555 IgG labeling kit (Molecular Probes, Eugene, OR) according to manufacturer's instructions. Slides were examined with an LSM510 laser scanning microscope (Carl Zeiss, Jena, Germany) equipped with 63× objectives 1.4NA, using the LSM software and processed with image J software. For observation of double-immunolabeled cells by Alexa 488 and Alexa 555, 488- and 543 lasers were used for excitation sequentially.

In vivo down-regulation of IGF-1R

Female athymic 6–8 weeks old Swiss Nude mice purchased from Charles River, (L'Arbresle, France) were housed in sterilized filter-topped cages, maintained in sterile conditions and manipulated according to French and European guidelines. Mice received subcutaneous (s.c.) implants of slow release estrogen pellets (0.72 mg 17β-estradiol; Innovative Research of America, Toledo, OH) one day before tumor cell inoculation. Mice were then injected s.c. with 5 × 106 MCF-7 cells. When tumors reached ∼100 mm2, tumors from 3 mice were removed before any treatment, 3 other mice were treated once with h7C10 (1 mg/dose) and, finally, 2 mice received 1 injection (1 mg/dose) of a commercially available human IgG1 as an isotype control (The binding Site, Birmingham, UK). Six hours after antibody injection tumors were removed, quickly snap frozen in liquid nitrogen, pulverized in lysis buffer and treated for Western blotting as described above. Cytokeratin 19 was blotted as a loading control with an antibody specific to MCF-7 cytokeratin 19 (Sigma Chemical).

Statistical analysis

All results were expressed as means ± SD. A one-way analysis of variance (ANOVA) was used to test differences. The data from at least 3 repetitions of the experiments were analyzed separately using one-way ANOVA. If the ANOVA showed significant effects, the means were compared by the Fischer test, with p < 0.05 considered significant. In the various graphs, bars with different superscripts are significantly different (p < 0.05). The superscript “a” indicates values that are significantly different from the IGF-1–stimulated cells (with IGF-1) and the superscript “b” indicates values that are different from cells incubated with vehicle only; “c” is related to values that are statistically different from a and b.

Results

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

h7C10 abolishes specifically IGF-1–induced IGF-1R phosphorylation in breast cancer cells

We first investigated effect of h7C10 on tyrosine phosphorylation of IGF-1R β-subunit in MCF-7 breast cancer cells. As expected, IGF-1–induced IGF-1R phosphorylation of MCF-7 cells in a dose-dependent manner. The maximal stimulation was observed for a 10−9 M concentration when cells were incubated for 10 min with IGF-1 ligand (Fig. 1a). When cells were incubated with 10 μg/mL of h7C10 for 1 hr before stimulation with IGF-1 for 10 min, IGF-1–induced IGF-1R phosphorylation was completely abolished even for the highest concentrations of ligand (Fig. 1a). Addition of h7C10 alone did not induce any IGF-1R phosphorylation. Inhibition of IGF-1–induced IGF-1R phosphorylation by h7C10 was dose-dependent with a complete inhibition achieved for a final concentration of antibody about 5 μg/mL (Fig. 1b). The inhibitory effect of h7C10 was observed whatever the duration of IGF-1 stimulation (Fig. 1c). h7C10 had to be in contact with cells for at least 10 min before stimulation with IGF-1 ligand to significantly inhibit IGF-1–induced IGF-1R phosphorylation (Fig. 1d). The maximal effect of h7C10 was achieved when cells were treated for 30 min before addition of IGF-1 (Fig. 1d). Thus, our results demonstrated that short-term treatment of h7C10 completely abolished IGF-1–induced phosphorylation of IGF-1R.

thumbnail image

Figure 1. Effect of h7C10 on tyrosine phosphorylation of IGF-1R. MCF-7 were serum-starved overnight and preincubated with h7C10 before stimulation with IGF-1. Tyrosine phosphorylation of IGF-1R β-subunit was then determined after immunoprecipitation and immunoblot. (a) MCF-7 cells were incubated or not with h7C10 (10 μg/mL) for 1 hr before addition of various concentration of IGF-1 for 10 min. (b) Cells were incubated for 1 hr with various concentration of h7C10 and then stimulated with IGF-1 (10−8 M) for 10 min. (c) MCF-7 were incubated with h7C10 (10 μg/mL) for 1 hr and then stimulated with IGF-1 (10−8 M) for the indicated times. (d) MCF-7 were incubated with 10 μg/mL h7C10 for the indicated time before stimulation with IGF-1 (10−8 M) for 10 min. Data are representative of 3 experiments. Letters indicate significant differences at p < 0.05.

Download figure to PowerPoint

Since some reports described that antibodies against IGF-1R could also affect tyrosine kinase phosphorylation of insulin receptors (IR), we also investigated the possibility that h7C10 affected phosphorylation of IR. In this experiment, the evaluation of EGF receptor (EGF-R) was investigated as a negative control to validate the specificity of h7C10. As expected, stimulation of MCF-7 with EGF-induced EGF-R phosphorylation whereas EGF-induced EGF-R phosphorylation was not affected by 1 hr incubation with 10 μg/mL dose h7C10 (Fig. 2a). Neither insulin nor IGF-2–induced phosphorylation of IR was impaired by a 1 hr incubation of 10 μg/mL h7C10 (Figs. 2b and 2c). In this experiment, we have also demonstrated that in addition to its strong inhibitory activity on IGF-1–mediated signal (Figs. 1a1d), h7C10 was able to totally abolish IGF-2–induced phosphorylation of IGF-1R (Fig. 2d).

thumbnail image

Figure 2. h7C10 did not affect phosphorylation of other tyrosine kinase receptors. MCF-7 were serum-starved overnight and preincubated with10 μg/mL h7C10 for 1 hr before stimulation with either EGF (a), insulin (b) or IGF-2 (c, d). Phosphorylation of EGFR (a), IR (b, c) and IGF-1R (d) were assessed by western blot. Data are representative of 3 experiments. Letters indicate significant differences at p < 0.05.

Download figure to PowerPoint

h7C10 causes inhibition of IGF-1–mediated activation of IGF-1R downstream signaling molecules

We next determined whether h7C10 inhibited phosphorylation of different IGF-1R substrates including IRS-1, IRS-2 and Shc. MCF-7 cells were treated with a dose range of h7C10 for 1 hr before stimulation with IGF-1 (10−8 M). As shown in Figure 3a (Lane 2 of each panel), IGF-1 treatment resulted in a significant phosphorylation of IRS-1, IRS-2 and Shc. Pretreatment of cells with h7C10 inhibited in a dose-dependent manner IGF-1–induced phosphorylation of IRS-1, IRS-2 and Shc (Fig. 3a, Lanes 3–7 of each panel). As previously reported,1, 37 addition of IGF-1 also induced activation of PI3kinase and MAPK kinase pathways (Figs. 3b and 3c; Lane 2 of each panel). Pretreatment of cells with h7C10 abolished IGF-1–induced activation of PI3K activity, phosphorylation of Akt and phosphorylation of Erk 1/2, JNK 1/2 and P38 (Figs. 3b and 3c, Lanes 3–7 of each panel). The inhibitory effect of h7C10 was dose-dependent and maximal inhibitions were achieved with 5 μg/mL of h7C10. Those results indicated that h7C10 completely blocked the ability of IGF-1 to initiate downstream signaling.

thumbnail image

Figure 3. h7C10 inhibited IGF-1–induced downstream signaling. Serum-starved MCF-7 cells were either preincubated (Lanes 3–7 of each panel) or not (Lanes 1 and 2 of each panel) with various doses of h7C10 for 1 hr. They were then stimulated with IGF-1 (10−8 M) for 10 min (Lanes 2–7 of each panel). (a) Tyrosine phosphorylation of IRS-1, IRS-2 and Shc 52 kDa isoform, (b) PI3K activity and (c) phosphorylation of Akt, Erk1/2, JNK1/2 and p38 were determined by Western blot. Letters indicate significant differences at p < 0.05.

Download figure to PowerPoint

h7C10 inhibits cyclin expression and Rb phosphorylation

h7C10 treatment was shown to delay the IGF-1–induced G1 to S progression29 and to inhibit both number and size of colonies in an anchorage-independent growth assay (data not shown). Here, we examined the effect of h7C10 on cyclin D1 (Fig. 4a) and cyclin E expression (Fig. 4b) and Rb phosphorylation level (Fig. 4c). Serum-starved MCF-7 cells were incubated either in the presence or in the absence of h7C10 (10 μg/mL) for 1 hr and then stimulated with IGF-1 for 3 hr (cyclin D1) or 24 hr (cyclin E and pRb). As shown in Figure 4 (Lane 2), IGF-1–induced a significant increase of cyclin D1 and E expression. It also increased Rb protein phosphorylation. MCF-7 cells pretreatment with h7C10 totally abolished IGF-1 effects on expression of both cyclin D1 and E proteins. It also dramatically inhibited Rb phosphorylation. Thus, the G1 growth arrest in response to IGF-1 in MCF-7 cells preincubated with h7C10 is due, at least, to some extent to the reduction of the activation of several components of cell cycle including cyclin D1 and E expression and Rb phosphorylation.

thumbnail image

Figure 4. Effects of h7C10 on cyclin D1, cyclin E, and phospho-Rb levels in MCF-7 cells. Serum-starved MCF-7 cells were incubated with h7C10 (10 μg/mL) for 1 hr and then stimulated with IGF-1 (10−8 M) for either 3 hr or 24 hr as described below in each panel. (a) Cells were harvested after 3 hr and cyclin D1 levels were measured by Western blotting. (b and c) Cells were harvested after 24 hr and Western blot analysis was performed to determine the cyclin E and phospho-pRb immunoreactive levels, respectively. Samples contained equal levels of protein, as confirmed by reprobing each membrane with an anti–α-actin antibody. In each panel, immunoreactivity was quantified by scanning densitometry and expressed as percent of that for cells maintained in serum-free medium (i.e., unstimulated). These results are representative of 3 independent experiments. Letters indicate significant differences at p < 0.05.

Download figure to PowerPoint

h7C10-induced IGF-1R degradation in xenograft tumor model

We have already demonstrated that h7C10 inhibits tumor growth in several xenograft tumor models including MCF-7.29 Interestingly, preliminary results suggested that the possible mechanism involved in h7C10 tumor growth inhibition could be the down-regulation of IGF-1R expression.29 In this study, we have investigated the effect of h7C10 on IGF-1R expression in human xenograft model. MCF-7 cells were implanted s.c. in nude mice. Mice were treated once either with h7C10 (1 mg/dose) or with a hIgG1 isotype control Mab. Six hours posttreatment, tumors were removed and IGF-1R β-chain level was evaluated by Western blot. As illustrated in Figure 5, treatment of mice with h7C10 dramatically decreased IGF-1R level in all 3 tested mice. No effect on IGF-1R level was noticed with an irrelevant hIgG1 antibody indicating that the down-regulation observed in vivo after h7C10 treatment was antibody-specific and that this latter mechanism could participate in h7C10 antitumor properties.

thumbnail image

Figure 5. h7C10 induces IGF-1R degradation in MCF-7 human xenograft. Female athymic Swiss Nude mice bearing tumors were injected i.p. either with 1 mg/dose of h7C10 or with a hIgG1 isotype control (1 mg/mL). Six hours after antibody injection, mice were sacrificed and tumors were removed and frozen. Tumors were homogenized in lysis buffer as described in Material and methods. Tumors were removed from (i) 3 mice before injection (Lanes 1–3), (ii) 3 mice treated with h7C10 (Lanes 4–6) and (iii) 2 mice with an irrelevant hIgG1 antibody (Lanes 7–8). They were proceeded for SDS-PAGE and immunoblotted for IGF-1R β-chain. Cytokeratine 19 was used as loading control.

Download figure to PowerPoint

The PI3K/Akt and MAPK\Erk1/2 pathways are not required for h7C10-induced IGF-1R degradation

We have shown above that h7C10 inhibited phosphorylation of IRS-1, Akt and Erk1/2 kinases and that it also induced IGF-1R internalization and degradation. We sought that blocking PI3K or Erk1/2 pathways could inhibit IGF-1R degradation on antibody binding. To determine whether Akt is involved in regulation of IGF-1R degradation, MCF-7 were pretreated with Ly294002 (1 PI3 kinase inhibitor). Although Akt phosphorylation was blocked with Ly294002, h7C10-induced IGF-1R degradation was not impaired (data not shown). Using U1206, phosphorylation of Erk1/2 was abolished in response to IGF-1. The IGF-1R degradation in response to h7C10 was not affected indicating that Erk1/2 was not involved in IGF-1R degradation (data not shown).

Degradation of α-chain is reversed by lysosomes inhibitors

To further elucidate the mechanism by which h7C10-induced IGF-1R degradation, various inhibitors of proteasome and lysosomal protease inhibitors were used. MCF-7 were grown sub-confluently and incubated in serum-deprived culture medium. Cells were pretreated with either proteasome inhibitors including MG132, MG115, bortezomib or epoxomycin or with lysosome inhibitors such as NH4Cl, chloroquine, methylamine or bafilomycin A1 for 1 hr. Cells were then exposed to h7C10 or human irrelevant antibody for 4 additional hours, and IGF-1R α-chain degradation was evaluated by Western blot. As expected, exposure of MCF-7 cells to h7C10 caused a dramatic reduction of IGF-1R α-subunit level (Fig. 6a). The use of either DMSO or ethanol as vehicle did not influence h7C10-induced down-regulation of IGF-1R α-chain. Pretreatment with either MG132, MG115, 2 proteasome inhibitors or with lysosome inhibitors significantly reduced IGF-1R α-chain degradation. A slight protective effect of epoxomycin and bortezomib, 2 other proteasome inhibitors, was observed.

thumbnail image

Figure 6. Degradation of IGF-1R α-subunit. MCF-7 cells were serum-starved and incubated for 1 hr with lysosome and proteasome inhibitors before addition of antibodies. h7C10 and hIgG1 were then incubated for 4 hr at 37°C with 5% CO2. (a) IGF-1R α-chain was evaluated by Western blot. Equal amount of protein was immunoblotted. All lysosome inhibitors, chloroquine, methylamine, NH4Cl and bafilomycin A1 reversed h7C10-induced IGF-1R α-subunit degradation. Bortezomib and epoxomycin had a minor effect on IGF-1R α-subunit degradation. (b) Flow cytometry detection of IGF-1R α-chain with 12B1. Black bars represent the effect of lysosome inhibitors and white bars proteasome inhibitors. Results represent the mean of at least 6 different experiments except for epoxomycin and bafilomycin A1. Letter indicates significant difference at p < 0.05.

Download figure to PowerPoint

To confirm the effect of inhibitors on IGF-1R α-chain degradation, total IGF-1R α was also evaluated by flow cytometry. As illustrated in Figure 6b, proteasome inhibitors MG132 and MG115 and also all lysosomal inhibitors significantly protected IGF-1R α-chain from h7C10-induced degradation. Epoxomycin and bortezomib, 2 other proteasome inhibitors, had only a minor effect on IGF-1R α-chain degradation. To validate functional activity of proteasome inhibitors, we evaluated ubiquitinated proteins increase in whole cell lysates. As shown in Figure 7, all proteasome inhibitors increased ubiquitinated protein level whereas lysosome inhibitors had no effect on ubiquitination demonstrating that proteasome inhibitors are efficient. Thus, our results suggested that IGF-1R α-subunit degradation is more protected by lysosomal inhibitors than by proteasome inhibitors.

thumbnail image

Figure 7. Proteasome inhibitors increased ubiquitinated protein levels. MCF-7 cells were incubated for 1 hr with indicated inhibitors and then treated with either h7C10 or irrelevant antibody hIgG1 for 4 hr. Next, cells were lyzed and whole cells lysates were immunoblotted. Ubiquitinated proteins were revealed using an antibody that recognized poly-ubiquitinated proteins.

Download figure to PowerPoint

h7C10-induced degradation of β-chain of IGF-1R

To determine whether α- and β-chains of IGF-1R followed the same degradation pathway, we analyzed the degradation of IGF-1R β-chain in the presence of h7C10. IGF-1R β-chain degradation was studied by Western blot after immunoprecipitation using anti–IGF-1R β-chain antibody.29 As illustrated in Figure 8a, h7C10-induced IGF-1R β-chain degradation was prevented by MG115, MG132 and bafilomycin A1. Methylamine, bortezomib and epoxomycin reversed only partially IGF-1R β-chain degradation. These results are in agreement with the one already obtained for the α-chain. Surprisingly, and in contrast to what we have observed for the α-chain, chloroquine and NH4Cl did not have any effect on IGF-1R β-chain degradation. To confirm Western blot results, degradation of IGF-1R β-chain was also assessed by flow cytometry (Fig. 8b). We confirmed the protective effect of MG115, MG132 and bafilomycin A1 on the degradation of IGF-1R β-chain induced by h7C10 (Fig. 8b). Effect of methylamine was partial whereas epoxomycin, bortezomib, NH4Cl had only a minor protective effect on IGF-1R β-chain degradation. As shown by Western blot analysis, chloroquine had no effect on IGF-1R β-subunit degradation on h7C10 binding. Thus, we showed that among proteasome inhibitors, only MG115 and MG132 dramatically reversed IGF-1R β-chain degradation. Likewise, within lysosome inhibitors, the only one capable of protecting IGF-1R β-chain from h7C10-induced degradation was bafilomycin A1.

thumbnail image

Figure 8. Degradation of IGF-1R β-subunit. MCF-7 were serum-starved and incubated for 1 hr with inhibitors. h7C10 was then incubated for 4 hr at 37°C with 5% CO2. (a) IGF-1R β-chain was evaluated by Western blot. Equal amount of protein was submitted to SDS-PAGE. MG115, MG132 and bafilomycin A1 reversed the degradation of the β-subunit. All others inhibitors had either partial (methylamine, bortezomib, epoxomycin) or no (chloroquine, NH4Cl) protective effect on h7C10-induced degradation of IGF-1R β-chain. (B) Flow cytometry detection of IGF-1R β-chain with a polyclonal anti–IGF-1R β-subunit antibody. Black bars represent the effect of lysosome inhibitors and white bars proteasome inhibitors. Letter indicates significant difference at p < 0.05.

Download figure to PowerPoint

h7C10-induced IGF-1R internalization in lysosomes

Preliminary flow cytometry experiments revealed that h7C10-induced internalization and degradation of IGF-1R in a time-dependent manner (Supplementary Data S1). To monitor the involvement of lysosomes in IGF-1R degradation, colocalization analysis was performed using a marker of early endosomes (EEA1) and markers of late endosomes/lysosomes, including CD63, lamp1 and lamp2. As illustrated in Figure 9, IGF-1R relocated from the surface to intracellular vesicles in a time-dependent manner. After 20 min of incubation with h7C10, IGF-1R accumulated in early endosomes (Fig. 9). This colocalization was still present after 30 min and in a lesser extend after 1 hr of incubation with h7C10 (Fig. 9). Kinetics analysis with late endosomes and lysosomes markers (CD63 and Lamp-1) showed that IGF-1R started to accumulate in late endosomes and lysosomes after 30 min but colocalization was more evident after 1 hr of incubation (Fig. 10).

thumbnail image

Figure 9. IGF-1R colocalized with early endosomes. Serum-starved MCF-7 cells were incubated with 10 μg/mL h7C10 for the indicated time. Fixed cells were permeabilized and stained with 12B1 to detect IGF-1R (Green). Early endosomes were detected with a rabbit polyclonal antibody EEA1 coupled with Alexa 555 (Red). Yellow dots represent colocalized signals. Insets: enlarged views of boxed region. Images are single representative confocal sections.

Download figure to PowerPoint

thumbnail image

Figure 10. IGF-1R colocalized with late endosomes/lysosomes. Serum-starved MCF-7 were incubated with 10 μg/mL h7C10 for the indicated time. Fixed cells were permeabilized and stained with 12B1 to detect IGF-1R (Green). Late endosomes/lysosomes were detected with a mouse monoclonal antibody anti-CD63 (a) or anti-lamp-1 (b) coupled with Alexa 555 (Red). Insets: enlarged views of boxed region. Yellow dots represent colocalized signals.

Download figure to PowerPoint

h7C10 induces sustained ubiquitination and p53 association with IGF-1R

Since it is well established that ubiquitination could be responsible for protein internalization and degradation,38 we have investigated the effect of h7C10 on ubiquitination. Addition of IGF-1 ligand-induced a rapid and transient ubiquitination that peaked at 5 min and immediately declined (Fig. 11a). On the contrary, h7C10 effect on ubiquitination was sustained for 30 min (Fig. 11b), when a large fraction of IGF-1R is internalized (Supplementary Data). Those results suggest that deubiquitination is not necessary for h7C10-induced internalization.

thumbnail image

Figure 11. h7C10-induced a sustained ubiquitination. Serum-starved MCF-7 cells were incubated either with IGF-1 (50 ng/mL) or h7C10 (10 μg/mL) for indicated time. Following stimulation, cells were lyzed and IGF-1R β-chain was immunoprecipitated. The recovered immunocomplexes were separated by SDS-PAGE and immunoblotted. (a) MCF-7 cells were incubated for 5 and 15 min with IGF-1, h7C10 or istoype control hIgG1. (b) h7C10-induced ubiquitination is sustained and still observed after 30 min of incubation.

Download figure to PowerPoint

Ubiquitination of IGF-1R involves both Mdm2 and Nedd 4.20, 21 β-Arrestin 1/2 was also shown to function as a scaffold for Mdm2.21 Similarly, Nedd-4 requires Grb10 to function as an adaptor protein.20 To monitor the role of those proteins in IGF-1R degradation, we firstly investigated their association in response to either IGF-1 or h7C10. As already reported21 and as illustrated in Figure 12a, Mdm2 is associated with IGF-1R in untreated cells. Incubation of MCF-7 cells with either IGF-1 ligand or h7C10 did not modify the level of associated Mdm2 protein with IGF-1R (Fig. 12a). Mdm2 phosphorylation also remained unchanged indicating that h7C10 did not increase Mdm2 association with IGF-1R nor Mdm2 phosphorylation (Fig. 12b). We therefore sought that β-arrestin association with IGF-1R could be modulated in the presence of h7C10. However, h7C10 did not up-regulate or down-regulate β-arrestin 1/2 association with IGF-1R (Fig. 12b). To further investigate the role of β-arrestin-1 in IGF-1R degradation, we down-regulated its expression using siRNA. β-arrestin-1 (Supplemental Data S2). Down-regulation did not alter h7C10-induced IGF-1R degradation indicating that β-arrestin-1 did play any major role in antibody-induced IGF-1R degradation (Supplemental Data S2). Unexpectedly, p53 association with IGF-1R increased in presence of h7C10, whereas IGF-1 ligand did not alter its association with IGF-1R (Fig. 12a and 12b). The association of p53 with IGF-1R in response to h7C10 started after 20 min and was statically significant after 30 min in our conditions (Fig. 12b).

thumbnail image

Figure 12. h7C10-induced p-53 association with IGF-1R. Serum-starved MCF-7 cells were incubated either with IGF-1 (10−8 M) or h7C10 (10 μg/mL) for the indicated times. The association levels between Mdm2, β arrestin 1/2, p53, Nedd4 or Grb10 and IGF-1R were determined after immunoprecipitation and immunoblot. Panel A represents the association of Mdm2, β arrestin and p53 with IGF-1R after IGF-1 stimulation whereas Panel B described these associations after h7C10 incubation. Data are representative of 3 independent experiments. Histogram represents the mean of densitometric analysis of p53 association with IGF-1R of 3 independent experiments ±SD. Letter b indicates values that are different from the one obtained with cells incubated with vehicle only (without h7C10). Panel C represents the association of Grb10 and Nedd4 with IGF-1R.

Download figure to PowerPoint

Both Grb10 and Nedd4 were also described as potent regulators of IGF-1R degradation.20 However, Grb10 association with IGF-1R was increased neither in the presence of h7C10 nor in the presence of IGF-1 (Fig. 12c). Similar preliminary results were obtained with Nedd4 (Fig. 12c).

Discussion

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

IGF-1R antibodies demonstrated in vitro and in vivo activities against numerous tumors. h7C10 is a humanized monoclonal antibody that induced tumor regression in subcutaneous xenograft and orthotopic models. We have already shown that h7C10 specifically inhibited IGF-1 binding to IGF-1R, receptor autophosphorylation and proliferation. To better characterize mechanisms by which h7C10 inhibits tumor growth, we first studied the h7C10 effect on IGF-1R signaling in MCF-7 cells. Here, we have shown that h7C10 inhibited specifically IGF-1–induced and IGF-2–induced IGF-1R autophosphorylation. No effect of this antibody was observed on insulin-induced or on IGF-2–induced activation of insulin receptor. Likewise, no interference was observed with EGF-R phosphorylation evaluated as a negative control. The dramatic inhibition of IGF-1R phosphorylation by h7C10 could probably explain the complete abrogation of tyrosine phosphorylation of IRS-1, IRS-2 and Shc, but also the total inactivation of the PI3K/Akt and MAPK signaling pathways in response to IGF-1. These two latter signaling pathways are survival signals able to protect cancer cells from apoptosis and it has been described that simultaneous inactivation of both PI3K/Akt and MAPK Erk1/2 is required to inhibit IGF-1R capacity of protecting cells from apoptotic injuries.39 The concomitant inactivation of PI3K/Akt and MAPK Erk1/2 pathways by h7C10 is probably one of the mechanisms directly involved in the successful in vivo inhibition of cell proliferation and tumor growth. Signaling impairment could also lead to cell cycle perturbations. Indeed, it has been well described that defective function of cell cycle regulators is a main cause for tumor development and progression. For example, the cell cycle promoter cyclin D1 is frequently overexpressed in cancer cells.40 IGF-1 has been shown to regulate both the expression and the activity of various molecules involved in cell cycle progression. In MCF-7 cells, IGF-1 induces cyclin D1 expression and Rb hyperphosphorylation through PI3K but not MAPK pathways.41 In this study, we showed that h7C10 treatment decreased expression of both IGF-1–induced cyclins D1 and E and inhibited Rb phosphorylation. Thus, we can speculate that these data are related to the inhibition of the PI-3-kinase/Akt signaling pathway in response to h7C10.

In another set of experiment, we have observed that h7C10-induced both in vivo and in vitro down-regulation of IGF-1R. Down-regulation of IGF1-R is a mechanism of action that has already been described for most of the monoclonal antibodies directed against IGF-1R.27, 30, 42 However, molecular mechanisms involved in this process are still unclear. Degradation of cell surface receptor can be due to either receptor internalization or receptor shedding. In this study, we have shown that h7C10 induces IGF-1R internalization and degradation, suggesting that IGF-1R degradation did not involve receptor shedding. On the other hand, IGF-1 ligand did not induce apparent IGF-1R degradation in MCF-7 as already reported.27, 29, 43 To further investigate the mechanism of down-regulation, both lysosome (methylamine, chloroquine, bafilomycin A1) and proteasome (epoxomycin, bortezomib, MG115, MG132) inhibitors were used and either α-chain or β-chain degradation were monitored. Uncorrelated results between degradation of these two chains were noticed suggesting that they followed different degradation pathways. Indeed, we have demonstrated that all lysosome inhibitors significantly reversed IGF-1R α-chain degradation whereas bafilomycin A1 and in a lesser extend methylamine reversed β-chain degradation. Results obtained with MG115 and MG132 suggested that proteasomes could also participate in both IGF-1R α- and β-chains degradation. However, only one minor effect was observed with either bortezomib or epoxomycin. This apparent discrepancy could be explained by the lack of specificity described for some proteasome inhibitors. Although specificity of bortezomib and epoxomycin on proteasome activity was clearly demonstrated,44, 45 the specificity of MG115 and MG132 is less evident. Several reports clearly described that peptide aldehydes could inhibit lysosomal enzymes.46–48 For example, MG132 can also inhibit cathepsin B, which is a lysosomal proteinase of the papain family involved in protein degradation.46 Based on this observation, cathepsin B could be responsible for α-chain degradation. However, the inefficiency of chloroquine and NH4Cl, 2 lysosome inhibitors, on β-chain-degradation lead us to speculate that degradation of α- and β-chains occur in different compartments.

Bafilomycin A1 which blocked both α- and β-chains degradation is a specific inhibitor of the vacuolar proton pump V-type ATPase that prevents from acidification of endosome compartments required for lysosomal proteases maturation.49, 50 Since it does not interfere with localization of surface molecules to early endosome or late multivesicular bodies (MVBs) but inhibits their transport to lysosome,50, 51 our data suggest that h7C10 binding leads to IGF-1R endocytosis of both α- and β-chains into endosomes and then into MVBs. Colocalization of α-chain with either early endosomes and lysosomes and protective effect of lysosome inhibitors on α-chain suggests that IGF-1R α-chain is mainly degraded into lysosomes, whereas the degradation route of β-chain remains to be elucidated. The involvement of proteasome pathway in β-chain degradation was already suggested.27, 52 Since proteasome inhibitors slightly protect both IGF-1R α- and β-chains from degradation, we can not exclude a role of proteasome in IGF-1R process degradation. For example, it has been reported that treatment with proteasome inhibitors decreased the translocation efficiency of the EGFR from outer limiting membrane to internal vesicles of MVB,46 but proteasome inhibitors failed to protect EGFR from degradation.48 The fact that IGF-1–induced a rapid and transient ubiquitination, whereas h7C10 effect was sustained which lead us to hypothesize that ubiquitination is required for h7C10-induced IGF-1R degradation but not absolutely necessary.

IGF-1R ubiquitination on IGF-1 binding was described to play a role in IGF-1R degradation. In melanoma cells, Mdm2-mediated ubiquitination of IGF-1R.21 In this study, they suggested that p53/mdm2 could decide the fate of IGF-1R by controlling receptor internalization and endosomal sorting process. Mdm2-mediated IGF-1R ubiquitination under both basal and IGF-1–stimulated conditions required β-arrestins.21 However, in our study, neither IGF-1 nor h7C10 increased association of either Mdm2 or β-arrestin with IGF-1R. This discrepancy could be explained by the fact that IGF-1R signaling and degradation are different according to the cell type.22, 26 Although Grb10/nedd4 were also shown to participate to IGF-1R ubiquitination,20 h7C10 did not increase basal association of Gbr10 or Nedd4 with IGF-1R. Further investigations using knockdown and/or overexpression of Mdm2 and Nedd4 are needed to confirm that these E3 ubiquitin ligases (Mdm2 and Nedd4) are not involved in the h7C10-induced IGF-1R ubiquitination and degradation. Recently, c-Cbl was also shown to participate in IGF-1R ubiquitination leading to IGF-1R degradation through the caveolin/lipid raft pathway.53 The role of c-Cbl in h7C10-induced IGF-1R ubiquitination and degradation remains to be determined but could represent an alternative E3 ligase to Mdm2 in ubiquitination of IGF-1R. Unexpectedly, h7C10 significantly increased p53 association with IGF-1R. The regulation of p53 activity occurs through a variety of mechanisms but interaction of p53 directly with other proteins seems to be the most important factor in regulating p53 function and stability. Mdm2 is required to maintain p53 at low levels and to suppress the ability of p53 to induce cell death. In this study, p53 level started to increase after 30 min in the presence of h7C10. At this time point, most of the receptors are internalized suggesting that p53 associates with internalized IGF-1R. On the basis of our preliminary results, it is tempting to suggest that this p53 up-regulation in response to h7C10 is responsible to cell cycle arrest and anchorage-independent growth inhibition. The data described herein also suggest that p53 pathway may play a central role in the regulation of IGF-1R expression but the exact role of p53 in IGF-1R degradation remains to be elucidated.

Several neutralizing antibodies anti–IGF-1R were described and their binding induced receptor internalization and degradation. In this study, we have shown that anti–IGF-1R antibody h7C10 inhibited tumor growth through IGF-1R internalization and degradation. Degradation of IGF-1R α-chain occurs through lysosomes, but ubiquitination of IGF-1R could also play a role in facilitating IGF-1R degradation. Our preliminary results suggest that receptor internalization could induce p53 up-regulation and consequently contribute to cell cycle arrest and induction of apoptosis as suggested by Baserga et al.54 The effect of h7C10 on cell cycle arrest and anchorage-independent growth probably constitutes an important property to target tumor growth. The effect of h7C10 on cell cycle is due to inhibition of IGF-1–induced cyclinD1 and cyclin E expression and Rb phosphorylation. In conclusion, h7C10 could block IGF-1R signaling and inhibit tumor growth via antagonization of ligand binding and via a rapid IGF-1R internalization and degradation.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

The authors thank Mrs. Claire Catry for preparation of the manuscript.

References

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information
  • 1
    LeRoith D,Roberts CT,Jr. The insulin-like growth factor system and cancer. Cancer Lett 2003; 195: 12737.
  • 2
    Steele-Perkins G,Turner J,Edman JC,Hari J,Pierce SB,Stover C,Rutter WJ,Roth RA. Expression and characterization of a functional human insulin-like growth factor I receptor. J Biol Chem 1988; 263: 1148692.
  • 3
    Butler JC,Spika JS,Nichol KL,Shapiro ED,Breinan RF. Effectiveness of pneumococcal vaccine. Lancet 1998; 351: 1961.
  • 4
    Lee AV,Yee D. Insulin-like growth factors and breast cancer. Biomed Pharmacother 1995; 49: 41521.
  • 5
    Baserga R. The insulin-like growth factor I receptor: a key to tumor growth? Cancer Res 1995; 55: 24952.
  • 6
    Neuenschwander S,Roberts CT,Jr,LeRoith D. Growth inhibition of MCF-7 breast cancer cells by stable expression of an insulin-like growth factor I receptor antisense ribonucleic acid. Endocrinology 1995; 136: 4298303.
  • 7
    Giovannucci E,Pollak MN,Platz EA,Willett WC,Stampfer MJ,Majeed N,Colditz GA,Speizer FE,Hankinson SE. A prospective study of plasma insulin-like growth factor-1 and binding protein-3 and risk of colorectal neoplasia in women. Cancer Epidemiol Biomarkers Prev 2000; 9: 3459.
  • 8
    Hankinson SE,Willett WC,Colditz GA,Hunter DJ,Michaud DS,Deroo B,Rosner B,Speizer FE,Pollak M. Circulating concentrations of insulin-like growth factor-I and risk of breast cancer. Lancet 1998; 351: 13936.
  • 9
    Chan JM,Stampfer MJ,Giovannucci E,Gann PH,Ma J,Wilkinson P,Hennekens CH,Pollak M. Plasma insulin-like growth factor-I and prostate cancer risk: a prospective study. Science 1998; 279: 5636.
  • 10
    Sun XJ,Goldberg JL,Qiao LY,Mitchell JJ. Insulin-induced insulin receptor substrate-1 degradation is mediated by the proteasome degradation pathway. Diabetes 1999; 48: 135964.
  • 11
    Sun XJ,Wang LM,Zhang Y,Yenush L,Myers MG,Jr,Glasheen E,Lane WS,Pierce JH,White MF. Role of IRS-2 in insulin and cytokine signaling. Nature 1995; 377: 1737.
  • 12
    Lavan BE,Lienhard GE. The insulin-elicited 60-kDa phosphotyrosine protein in rat adipocytes is associated with phosphatidylinositol 3-kinase. J Biol Chem 1993; 268: 59218.
  • 13
    Pelicci G,Lanfrancone L,Grignani F,McGlade J,Cavallo F,Forni G,Nicoletti I,Grignani F,Pawson T,Pelicci PG. A novel transforming protein (SHC) with an SH2 domain is implicated in mitogenic signal transduction. Cell 1992; 70: 93104.
  • 14
    Backer JM,Myers MG,Jr,Shoelson SE,Chin DJ,Sun XJ,Miralpeix M,Hu P,Margolis B,Skolnik EY,Schlessinger J. Phosphatidylinositol 3′-kinase is activated by association with IRS-1 during insulin stimulation. EMBO J 1992; 11: 346979.
  • 15
    Skolnik EY,Lee CH,Batzer A,Vicentini LM,Zhou M,Daly R,Myers MJ,Jr,Backer JM,Ullrich A,White MF. The SH2/SH3 domain-containing protein GRB2 interacts with tyrosine-phosphorylated IRS1 and Shc: implications for insulin control of ras signaling. EMBO J 1993; 12: 192936.
  • 16
    Haglund K,Sigismund S,Polo S,Szymkiewicz I,Di Fiore PP,Dikic I. Multiple monoubiquitination of RTKs is sufficient for their endocytosis and degradation. Nat Cell Biol 2003; 5: 4616.
  • 17
    Lin FT,Daaka Y,Lefkowitz RJ. Beta-arrestins regulate mitogenic signaling and clathrin-mediated endocytosis of the insulin-like growth factor I receptor. J Biol Chem 1998; 273: 316403.
  • 18
    Biedi C,Panetta D,Segat D,Cordera R,Maggi D. Specificity of insulin-like growth factor I and insulin on Shc phosphorylation and Grb2 recruitment in caveolae. Endocrinology 2003; 144: 5497503.
  • 19
    Chow JC,Condorelli G,Smith RJ. Insulin-like growth factor-I receptor internalization regulates signaling via the Shc/mitogen-activated protein kinase pathway, but not the insulin receptor substrate-1 pathway. J Biol Chem 1998; 273: 467280.
  • 20
    Vecchione A,Marchese A,Henry P,Rotin D,Morrione A. The Grb10/Nedd4 complex regulates ligand-induced ubiquitination and stability of the insulin-like growth factor I receptor. Mol Cell Biol 2003; 23: 336372.
  • 21
    Girnita L,Girnita A,Larsson O. Mdm2-dependent ubiquitination and degradation of the insulin-like growth factor 1 receptor. Proc Natl Acad Sci USA 2003; 100: 824752.
  • 22
    Carelli S,Di Giulio AM,Paratore S,Bosari S,Gorio A. Degradation of insulin-like growth factor-I receptor occurs via ubiquitin-proteasome pathway in human lung cancer cells. J Cell Physiol 2006; 208: 35462.
  • 23
    Sehat B,Andersson S,Vasilcanu R,Girnita L,Larsson O. Role of ubiquitination in IGF-1 receptor signaling and degradation. PLoS ONE 2007; 2: e340.
  • 24
    Girnita L,Shenoy SK,Sehat B,Vasilcanu R,Girnita A,Lefkowitz RJ,Larsson O. {beta}-Arrestin is crucial for ubiquitination and down-regulation of the insulin-like growth factor-1 receptor by acting as adaptor for the MDM2 E3 ligase. J Biol Chem 2005; 280: 244129.
  • 25
    Larsson O,Girnita A,Girnita L. Role of insulin-like growth factor 1 receptor signaling in cancer. Br J Cancer 2005; 92: 2097101.
  • 26
    Bartucci M,Morelli C,Mauro L,Ando S,Surmacz E. Differential insulin-like growth factor I receptor signaling and function in estrogen receptor (ER)-positive MCF-7 and ER-negative MDA-MB-231 breast cancer cells. Cancer Res 2001; 61: 674754.
  • 27
    Burtrum D,Zhu Z,Lu D,Anderson DM,Prewett M,Pereira DS,Bassi R,Abdullah R,Hooper AT,Koo H,Jimenez X,Johnson D, et al. A fully human monoclonal antibody to the insulin-like growth factor I receptor blocks ligand–dependent signaling and inhibits human tumor growth in vivo. Cancer Res 2003; 63: 891221.
  • 28
    Maloney EK,McLaughlin JL,Dagdigian NE,Garrett LM,Connors KM,Zhou XM,Blattler WA,Chittenden T,Singh R. An anti-insulin-like growth factor I receptor antibody that is a potent inhibitor of cancer cell proliferation. Cancer Res 2003; 63: 507383.
  • 29
    Goetsch L,Gonzalez A,Leger O,Beck A,Pauwels PJ,Haeuw JF,Corvaia N. A recombinant humanized anti-insulin-like growth factor receptor type I antibody (h7C10) enhances the antitumor activity of vinorelbine and anti-epidermal growth factor receptor therapy against human cancer xenografts. Int J Cancer 2005; 113: 31628.
  • 30
    Cohen BD,Baker DA,Soderstrom C,Tkalcevic G,Rossi AM,Miller PE,Tengowski MW,Wang F,Gualberto A,Beebe JS,Moyer JD. Combination therapy enhances the inhibition of tumor growth with the fully human anti-type 1 insulin-like growth factor receptor monoclonal antibody CP-751,871. Clin Cancer Res 2005; 11: 206373.
  • 31
    Pandini G,Wurch T,Akla B,Corvaia N,Belfiore A,Goetsch L. Functional responses and in vivo anti-tumor activity of h7C10: a humanized monoclonal antibody with neutralizing activity against the insulin-like growth factor-1 (IGF-1) receptor and insulin/IGF-1 hybrid receptors. Eur J Cancer 2007; 43: 131827.
  • 32
    Feng Y,Zhu Z,Xiao X,Choudhry V,Barrett JC,Dimitrov DS. Novel human monoclonal antibodies to insulin-like growth factor (IGF)-II that potently inhibit the IGF receptor type I signal transduction function. Mol Cancer Ther 2006; 5: 11420.
  • 33
    Yeh J,Litz J,Hauck P,Ludwig DL,Krystal GW. Selective inhibition of SCLC growth by the A12 anti-IGF-1R monoclonal antibody correlates with inhibition of Akt. Lung Cancer 2008; 60: 16674.
  • 34
    Mitsiades CS,Mitsiades NS,McMullan CJ,Poulaki V,Shringarpure R,Akiyama M,Hideshima T,Chauhan D,Joseph M,Libermann TA,Garcia-Echeverria C,Pearson MA, et al. Inhibition of the insulin-like growth factor receptor-1 tyrosine kinase activity as a therapeutic strategy for multiple myeloma, other hematologic malignancies, and solid tumors. Cancer Cell 2004; 5: 22130.
  • 35
    Garcia-Echeverria C,Pearson MA,Marti A,Meyer T,Mestan J,Zimmermann J,Gao J,Brueggen J,Capraro HG,Cozens R,Evans DB,Fabbro D, et al. In vivo antitumor activity of NVP-AEW541—a novel, potent, and selective inhibitor of the IGF-IR kinase. Cancer Cell 2004; 5: 2319.
  • 36
    Andrews DW,Resnicoff M,Flanders AE,Kenyon L,Curtis M,Merli G,Baserga R,Iliakis G,Aiken RD. Results of a pilot study involving the use of an antisense oligodeoxynucleotide directed against the insulin-like growth factor type I receptor in malignant astrocytomas. J Clin Oncol 2001; 19: 2189200.
  • 37
    Dupont J,Karas M,LeRoith D. The potentiation of estrogen on insulin-like growth factor I action in MCF-7 human breast cancer cells includes cell cycle components. J Biol Chem 2000; 275: 35893901.
  • 38
    Staub O,Rotin D. Role of ubiquitylation in cellular membrane transport. Physiol Rev 2006; 86: 669707.
  • 39
    Salatino M,Schillaci R,Proietti CJ,Carnevale R,Frahm I,Molinolo AA,Iribarren A,Charreau EH,Elizalde PV. Inhibition of in vivo breast cancer growth by antisense oligodeoxynucleotides to type I insulin-like growth factor receptor mRNA involves inactivation of ErbBs. PI-3K/Akt and p42/p44 MAPK signaling pathways but not modulation of progesterone receptor activity. Oncogene 2004; 23: 516174.
  • 40
    Tashiro E,Tsuchiya A,Imoto M. Functions of cyclin D1 as an oncogene and regulation of cyclin D1 expression. Cancer Sci 2007; 98: 62935.
  • 41
    Dufourny B,Alblas J,van Teeffelen HA,van Schaik FM,van der BB,Steenbergh PH,Sussenbach JS. Mitogenic signaling of insulin-like growth factor I in MCF-7 human breast cancer cells requires phosphatidylinositol 3-kinase and is independent of mitogen-activated protein kinase. J Biol Chem 1997; 272: 3116371.
  • 42
    Jackson-Booth PG,Terry C,Lackey B,Lopaczynska M,Nissley P. Inhibition of the biologic response to insulin-like growth factor I in MCF-7 breast cancer cells by a new monoclonal antibody to the insulin-like growth factor-I receptor. The importance of receptor down-regulation. Horm Metab Res 2003; 35: 8506.
  • 43
    Wang Y,Hailey J,Williams D,Wang Y,Lipari P,Malkowski M,Wang X,Xie L,Li G,Saha D,Ling WL,Cannon-Carlson S, et al. Inhibition of insulin-like growth factor-I receptor (IGF-IR) signaling and tumor cell growth by a fully human neutralizing anti-IGF-IR antibody. Mol Cancer Ther 2005; 4: 121421.
  • 44
    Adams J,Palombella VJ,Sausville EA,Johnson J,Destree A,Lazarus DD,Maas J,Pien CS,Prakash S,Elliott PJ. Proteasome inhibitors: a novel class of potent and effective antitumor agents. Cancer Res 1999; 59: 261522.
  • 45
    Rodgers KJ,Dean RT. Assessment of proteasome activity in cell lysates and tissue homogenates using peptide substrates. Int J Biochem Cell Biol 2003; 35: 71627.
  • 46
    Longva KE,Blystad FD,Stang E,Larsen AM,Johannessen LE,Madshus IH. Ubiquitination and proteasomal activity is required for transport of the EGF receptor to inner membranes of multivesicular bodies. J Cell Biol 2002; 156: 84354.
  • 47
    Fuertes G,Martin De Llano JJ,Villarroya A,Rivett AJ,Knecht E. Changes in the proteolytic activities of proteasomes and lysosomes in human fibroblasts produced by serum withdrawal, amino-acid deprivation and confluent conditions. Biochem J 2003; 375: 7586.
  • 48
    Alwan HA,van Zoelen EJ,van Leeuwen JE. Ligand-induced lysosomal epidermal growth factor receptor (EGFR) degradation is preceded by proteasome-dependent EGFR de-ubiquitination. J Biol Chem 2003; 278: 3578190.
  • 49
    van Weert AW,Dunn KW,Gueze HJ,Maxfield FR,Stoorvogel W. Transport from late endosomes to lysosomes, but not sorting of integral membrane proteins in endosomes, depends on the vacuolar proton pump. J Cell Biol 1995; 130: 82134.
  • 50
    van Deurs B,Holm PK,Sandvig K. Inhibition of the vacuolar H(+)-ATPase with bafilomycin reduces delivery of internalized molecules from mature multivesicular endosomes to lysosomes in HEp-2 cells. Eur J Cell Biol 1996; 69: 34350.
  • 51
    Clague MJ,Urbe S,Aniento F,Gruenberg J. Vacuolar ATPase activity is required for endosomal carrier vesicle formation. J Biol Chem 1994; 269: 214.
  • 52
    Hailey J,Maxwell E,Koukouras K,Bishop WR,Pachter JA,Wang Y. Neutralizing anti-insulin-like growth factor receptor 1 antibodies inhibit receptor function and induce receptor degradation in tumor cells. Mol Cancer Ther 2002; 1: 134953.
  • 53
    Sehat B,Andersson S,Girnita L,Larsson O. Identification of c-Cbl as a new ligase for insulin-like growth factor-I receptor with distinct roles from Mdm2 in receptor ubiquitination and endocytosis. Cancer Res 2008; 68: 566977.
  • 54
    Baserga R,Peruzzi F,Reiss K. The IGF-1 receptor in cancer biology. Int J Cancer 2003; 107: 8737.

Supporting Information

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
IJC_24186_sm_suppfigure1.tif824KSupporting Figure 1. IGF-1R internalization and degradation upon h7C10 binding.
IJC_24186_sm_suppfigure2.tif938KSupporting Figure 2. Beta arrestin-1 is not involved in the h7C10-induced IGF-1R degradation.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.