DNA methylation of microRNA genes in gastric mucosae of gastric cancer patients: Its possible involvement in the formation of epigenetic field defect

Authors


Abstract

Accumulation of aberrant DNA methylation in normal-appearing gastric mucosae, mostly induced by H. pylori infection, is now known to be deeply involved in predisposition to gastric cancers (epigenetic field defect), and silencing of protein-coding genes has been analyzed so far. In this study, we aimed to clarify the involvement of microRNA (miRNA) gene silencing in the field defect. First, we selected three miRNA genes as methylation-silenced after analysis of six candidate “methylation-silenced” tumor-suppressor miRNA genes. Methylation levels of the three genes (miR-124a-1, miR-124a-2 and miR-124a-3) were quantified in 56 normal gastric mucosae of healthy volunteers (28 volunteers with H. pylori and 28 without), 45 noncancerous gastric mucosae of gastric cancer patients (29 patients with H. pylori and 16 without), and 28 gastric cancer tissues (13 intestinal and 15 diffuse types). Among the healthy volunteers, individuals with H. pylori had 7.8–13.1-fold higher methylation levels than those without (p < 0.001). Among individuals without H. pylori, noncancerous gastric mucosae of gastric cancer patients had 7.2–15.5-fold higher methylation levels than gastric mucosae of healthy volunteers (p < 0.005). Different from protein-coding genes, individuals with past H. pylori infection retained similar methylation levels to those with current infection. In cancer tissues, methylation levels were highly variable, and no difference was observed between intestinal and diffuse histological types. This strongly indicated that methylation-silencing of miRNA genes, in addition to that of protein-coding genes, contributed to the formation of a field defect for gastric cancers. © 2008 Wiley-Liss, Inc.

Metachronous occurrence of gastric cancers is becoming an important issue as localized resection of early gastric cancers by endoscopic submucosal dissection (ESD) has become common.1 The incidence of secondary primary gastric cancers after ESD reaches as high as 2.0% per year2 whereas the incidence of gastric cancer in the general Japanese population is 0.14% per year.3 This indicates that noncancerous gastric mucosae are already predisposed to developing gastric cancers, forming a field defect (field for cancerization). High incidences of metachronous cancers have been known not only for gastric cancers but also for bladder, liver, and esophageal cancers4–6 and are becoming recognized for lung, breast and colorectal cancers.7–9

A molecular basis for the field defect has been considered as an accumulation of genetic and epigenetic alterations in normal-appearing tissues. Traditionally, cells with a genetic alteration were considered to form a physically continuous patch, producing a genetically altered field.10 Recently, we found that aberrant DNA methylation of specific genes can be induced in as high as several percentage of cells in noncancerous gastric mucosae (thus in multiple independent gastric glands), and the degree of methylation is associated with gastric cancer risks.11, 12 Importantly, Helicobacter pylori infection, a major carcinogenic factor in the stomach, was shown to potently induce aberrant DNA methylation in gastric epithelial cells.11 In addition to gastric cancers, the presence of aberrant DNA methylation in noncancerous tissues and possible association with cancer risks have been reported for liver,13 colon,14 esophageal,15 breast16 and renal cancers.17

Genes so far analyzed in noncancerous gastric mucosae are those methylated in gastric cancers, including tumor-suppressor genes, such as CDKN2A, MLH1, CDH1, LOX and APC,2, 11, 18, 19 and genes with little or no expression in normal gastric mucosae, such as FLNc, HAND1 and THBD. The latter group of genes is methylated in parallel with tumor-suppressor genes but with higher frequencies, and is considered as a good marker to detect the presence of an epigenetic field defect.11 In contrast with these protein-coding genes, involvement of microRNA (miRNA) silencing in field defect formation has not been clarified yet. Since the role of aberrant expression or reduction of various miRNAs in human multistep carcinogenesis is now clear,20, 21 there is a possibility that miRNAs silencing by aberrant DNA methylation is involved in field defect formation. Indeed, several tumor-suppressor miRNAs, including miR-124a,22miR-137, miR-193a23 and miR-127,24 are reported to be silenced by aberrant DNA methylation of their promoter CpG islands (CGI) in cancers.

In this study, we aimed to clarify whether or not miRNA silencing by DNA methylation can be involved in the formation of a field defect for gastric cancers. First, we searched for miRNAs that are reported to have tumor-suppressive functions and be controlled by DNA methylation, and confirmed methylation-silencing of these candidate genes. Then, we quantified their methylation levels in gastric mucosae of healthy volunteers, noncancerous gastric mucosae of gastric cancer patients, and primary gastric cancer tissues.

Material and methods

Cell lines and tissue samples

Six gastric cancer cell lines, AGS, KATOIII, MKN28, MKN45, MKN74 and NUGC3 were obtained from the Japanese Collection of Research Bioresources (Tokyo, Japan) and the American Type Culture Collection (Manassas, VA). Three gastric cancer cell lines, HSC39, HSC44 and HSC57 were gifted by Dr. K. Yanagihara, National Cancer Center Research Institute, Tokyo, Japan. GC2 was developed by M. T. TMK1 was gifted by Dr. W. Yasui, Hiroshima University, Hiroshima, Japan. 5-Aza-2′-deoxycitidine (5-aza-dC) treatment was performed with AGS, HSC57 and MKN28. Cells were seeded on day 0, media was added with freshly prepared 5-aza-dC on days 1 and 3, and cells were harvested on day 5. The concentrations of 5-aza-dC were determined as minimum concentrations that deplete DNMT1.25

Gastric mucosae were obtained by endoscopic biopsy of antral regions from 56 healthy volunteers (25 male and 31 female; average age 53, ranging from 27 to 91) and 45 gastric cancer patients (35 male and 10 female; average age 66, ranging from 38 to 89). Gastric cancer tissues were obtained from 28 gastric cancer patients (21 male and 7 female; average age 66, ranging from 49 to 81; 13 intestinal and 15 diffuse types) who underwent gastrectomy due to gastric cancers. Gastric epithelial cells were obtained by the gland isolation technique from eight noncancerous gastric tissues. Informed consents were obtained from all the patients and healthy volunteers. Gastric mucosae, noncancerous mucosae and cancer tissues were frozen in liquid nitrogen immediately after biopsy or resection, and stored at −80°C until extraction of genomic DNA. High molecular weight DNA was extracted by the phenol/chloroform method. RNA was isolated with ISOGEN (Nippon Gene, Tokyo, Japan).

H. pylori infection status was analyzed by a serum anti-H. pylori IgG antibody test (SRL, Tokyo, Japan), rapid urease test (Otsuka, Tokushima, Japan), or culture test (Eiken, Tokyo, Japan). All cancers were histologically diagnosed according to the Japanese classification of gastric carcinoma,26 and classified according to the Lauren classification system.27

Sodium bisulfite modification, methylation-specific PCR (MSP), quantitative real-time MSP and bisulfite sequencing

Fully methylated DNA and fully unmethylated DNA were prepared by methylating genomic DNA with SssI methylase (New England Biolabs, Beverly, MA) and by amplifying genomic DNA with the GenomiPhi amplification system (GE Healthcare, Buckinghamshire, UK), respectively. Bisulfite modification was performed using 1 μg of BamHI-digested genomic DNA as previously described,28 and the modified DNA was suspended in 40 μl of Tris-EDTA buffer. An aliquot of 1 μl was used for methylation-specific PCR (MSP) and Quantitative real-time MSP (qMSP) with a primer set specific to methylated (M) or unmethylated (U) sequences.

For MSP, the fully methylated and unmethylated DNA was used to determine an annealing temperature that specifically amplifies only methylated or unmethylated DNA. A minimum number of PCR cycles to obtain visible bands was determined using the fully (un)methylated DNA, and four cycles were added for analysis of gastric cancer cell lines. The primers were designed just upstream of reported transcription start sites within the CGI (Table I; Fig. 1a), whose methylation statuses are now known to be critical for induction of gene silencing.29, 30

Figure 1.

Genomic structures and methylation statuses of the six miRNA genes in gastric cancer cell lines. (a) Structures of the miR-124a-1 gene. Vertical ticks, individual GpC (top) and CpG sites (bottom); gray box, CGI; closed box, genomic location of miR-124a-1; open arrowheads, locations of the primers for MSP and real-time MSP; and closed arrowheads, locations of the primers for bisulfite sequencing. (b) Methylation statuses of miR-124a-1 in normal gastric mucosae and 11 gastric cancer cell lines analyzed by MSP. SssI, genomic DNA methylated by SssI methylase; GenomiPhi, genomic DNA amplified by GenomiPhi; and M and U, primer sets specific to methylated and unmethylated DNA, respectively. (c) The methylation status of a CGI around miR-124a-1 analyzed by bisulfite sequencing. Twelve CpG sites were analyzed in NK56 normal and AGS gastric cancer cell lines, and 15 clones or more were sequenced for each sample. Closed circle, methylated CpG site; and open circle, unmethylated CpG site. (d) Genomic structures of five other miRNA genes and their methylation statuses in normal gastric mucosae and 11 gastric cancer cell lines analyzed by MSP.

Table I. Primers and Conditions for MSP and Real-Time MSP
GeneM/UPrimer sequenceLength (bp)Anneal (°C)Number of cycles for MSP
Forward (5′→3′)Reverse (5′ →3′)MSPReal-time MSP
  1. M, Primers specific to methylated DNA; U, Primers specific to unmethylated DNA.

miR-124a-1MAGAGTTTTTGGAAGACGTCGAAAAAAATAAAAAACGACGC155585836
UAATAAAGAGTTTTTGGAAGATGTTCAAAAA AAA AAAATAAAAAACAACAC166585836
miR-124a-2MGGTTTATGTATGTTTTTAGGCGTCCGTAAAAATATAAACGATAG93595632
UTAGGTTTATGTATGTTTTTAGGTGCTATTCCATAAAAATATAAACAATACA99525036
miR-124a-3MGATAGTATAGTCGGTTGAGCGTAGCCCTCAAAACTAAAACGAACGACG152615931
UTAGTTGGTTGAGTGTAGTGTTTTTGCAAAACTAAAACAAACAACAAACATC142615936
miR-137MTAGGGGCGGGTTAGCGTACCGCTACCGCTACTACC995736
UTTTTGGTGGTGGTGGTGGTACCCAAAAATACCATCACCA1136335
miR-193aMGAGGTAGTTTGGTCGGAGCGTACGACCCCCGAAACCAACG866136
UATTGATTTATATTTTTGAGAGTGTTGTCCCAAACTAACATACACTCCA1535835
miR-127MGTTTGGGGAGAGCGTAAACGGTAAACGAACACCGCACCG966334
UGTTTTGTGAATTATTTGGTTTTGTTACAAATATCCCTCCACCAC1765838
GenePrimers for bisulfite sequencingLength (bp)Anneal (°C)Number of cycles
Forward (5′→3′)Reverse (5′ →3′)
miR-124a-1AAGGATGGGGGAGAATAAAGAGTTTCTCAACCAACCCCATTCTTAACATT3546032
miR-124a-2ATTAGATTTATAGGTTTATGTATGTTTTAGGACTCTTCTCTCCCTACCCATC2355430
miR-124a-3GAAAGGGGAGAAGTGTGGGTTTTTCTCTTAACATTCACCGCGTACCTTAAT2685432

qMSP was performed by real-time PCR using SYBR® Green I (BioWhittaker Molecular Applications, Rockland, ME) and an iCycler Thermal Cycler (Bio-Rad Laboratories, Hercules, CA). Although the same primer set was used for qMSP, a specific annealing temperature in the presence of SYBR® Green I was re-determined using the fully methylated and unmethylated DNA. The number of molecules in a sample was determined by comparing its amplification with those of standard DNA that contained exact numbers of molecules (101–106 molecules). Based on the numbers of M molecules and U molecules for a genomic region, a methylation level of the region was calculated as the fraction of M molecules in the total number of DNA molecules (# of M molecules + # of U molecules). The standard DNA samples were prepared by cloning PCR products of methylated and unmethylated sequences into the pGEM-T Easy vector (Promega, Madison, WI), respectively, or by purifying the PCR products using the Wizard SV Gel and PCR clean-up system (Promega).

For bisulfite sequencing, an aliquot of 1 μl of the sodium bisulfite-treated DNA was amplified by PCR with the primers common to methylated and unmethylated DNA sequences (Table I). The PCR product was cloned into pGEM-T Easy vector (Promega), and 15 clones or more were cycle-sequenced for each sample.

Quantitative real-time reverse transcription (RT)-PCR

For quantitative RT-PCR, cDNA was synthesized from 10 ng of total RNA using TaqMan® MicroRNA-specific primers and a TaqMan® MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). Real-time PCR was performed using the ABI Prism 7300 Fast Real-Time PCR System (Applied Biosystems). Expression levels of target miRNAs were normalized to that of a small nuclear RNA RNU6B transcript.

Statistical analysis

A difference in mean methylation levels was analyzed by the t-test Welch method, and differences in methylation incidence in gastric cancer tissues were analyzed by the chi-square test. Correlation between the age and methylation levels of miRNA genes, and correlation between methylation levels of each gene were analyzed using Spearman's rank correlation coefficient. All the analyses were performed using SPSS (SPSS, Inc., Chicago, IL), and the results were considered significant when a p value less than 0.05 was obtained by two-sided tests.

Results

Identification of miRNAs silenced in gastric cancer cell lines

Six genes of four miRNAs (miR-124a, miR-137, miR-193a and miR-127) were reported to have a tumor-suppressive function and be controlled by DNA methylation in colon, bladder and oral cancers.22–24 We first analyzed methylation statuses of their putative promoter regions in 11 gastric cancer cell lines and two normal gastric mucosae of healthy individuals without H. pylori. It was found that miR-124a-1, miR-124a-2, miR-124a-3 and miR-137 were unmethylated in the normal gastric mucosae, but were completely methylated (no unmethylated DNA molecules detected) frequently in the cell lines (Figs. 1b–1d). miR-193a was partially methylated in one of the two normal gastric mucosae, and completely methylated frequently in gastric cancer cell lines. In contrast, miR-127 was completely methylated in the normal gastric mucosae, but unmethylated in the gastric cancer cell lines.

We then examined the effect of methylation of the putative promoter regions on miRNA expression (miR-124a for miR-124a-1, miR-124a-2 and miR-124a-3 genes; miR-137; miR-193a; miR-127) in the 11 gastric cancer cell lines and gastric epithelial cells obtained by the gland isolation technique (Fig. 2). miR-124a was consistently unexpressed in six cell lines with simultaneous methylation of its three isoforms (miR-124a-1, miR-124a-2 and miR-124a-3), but was expressed in the gastric epithelial cells. In contrast, miR-137, miR-193a, and miR-127 were expressed even in cell lines with complete methylation. This showed that these three miRNA genes were not silenced by their “promoter” methylation, and indicated that, in contrast, miR-124a was silenced by promoter methylation of its three isoforms.

Figure 2.

Expression levels of miRNAs in gastric epithelial cells and gastric cancer cell lines. Expression levels were analyzed by quantitative RT-PCR, and normalized to RNU6B expression. Gastric epithelial cells were obtained by gland isolation technique from noncancerous tissues of eight gastric cancer patients, and average expression levels of the eight patient samples are shown. Results of MSP were duplicated from Figure 1 for convenience. M, M/U and U represent the presence of only methylated DNA, both methylated and unmethylated DNA, and only unmethylated DNA, respectively. NA, not applicable. Only miR-124a showed consistent repression in cell lines without unmethylated DNA molecules. After treatment by 5-aza-dC, miR-124a was re-expressed abundantly in HSC57, in association with demethylation, and in AGS and MKN28.

Methylation-silencing of miR-124a was further confirmed by analyzing its re-expression in association with its promoter demethylation after treatment with a demethylating agent, 5-aza-dC, in three cell lines (AGS, HSC57 and MKN28). Re-expression and appearance of unmethylated DNA molecules were observed in all the three cell lines, HSC57 being prominent. This further orted that miR-124a was methylation-silenced.

The presence of miR-124a methylation in primary gastric cancers

Since methylation-silencing was identified only for miR-124a, we analyzed methylation levels of its three genes (miR-124a-1, miR-124a-2 and miR-124a-3), along with a representative protein-coding gene (LOX), in 28 primary gastric cancer tissues (13 intestinal and 15 diffuse types) by qMSP. The fact that densely methylated DNA molecules were being measured was confirmed by bisulfite sequencing (Supp. Info. Fig. 1). miR-124a-1 showed a distribution of methylation levels similar to LOX, some having no methylation and the others having various levels of methylation (Fig. 3a). This was consistent with our previous finding that cancer samples could be essentially classified into two groups (cancers with and without methylation), and that the various degrees of methylation levels in methylation-positive cancer samples were mainly due to contamination of normal cells.18 On the other hand, miR-124a-2 and miR-124a-3 showed a unimodal distribution of methylation levels, suggesting that they are susceptible to methylation induction in cancer tissues. Using a cut-off value of 6%, as in previous reports,31, 32miR-124a-1, miR-124a-2 and miR-124a-3 were methylated in 11, 23 and 26 of the 28 samples, respectively. Between the two histological types, the incidences of methylation were the same for miR-124a-1, miR-124a-2 and miR-124a-3 (p = 0.95, 0.84 and 0.67) (Supp. Info. Fig. 2a).

Figure 3.

Methylation levels of miR-124a-1, miR-124a-2, miR-124a-3 and LOX in gastric mucosae of healthy volunteers, noncancerous mucosae of gastric cancer patients, and cancer tissues. (a) Distribution of methylation levels in gastric cancers. Gray areas show samples with methylation levels below the cut-off value of 6%. (b) Expression of miR-124a in eight cancer samples with methylation (three miR-124a genes, methylation positive) and 11 cancer samples with at least one unmethylated gene (miR-124a-1 or miR124a-3). Five of the 11 cancers with unmethylated genes had high miR-124a expression levels. (c) Distribution of methylation levels in gastric mucosae of healthy volunteers (HV) and noncancerous mucosae of gastric cancer patients (Ca-Pt). A horizontal line represents a mean methylation level for each group. Among the healthy volunteers, H. pylori-positive individuals had 7.8–46.7-fold as high methylation levels as H. pylori-negative individuals (*p < 0.005; **p < 0.001). Among the H. pylori-negative individuals, noncancerous gastric mucosae of gastric cancer patients had 7.2–24.7-fold as high methylation levels as gastric mucosae of healthy volunteers (*p < 0.005; **p < 0.001).

We further analyzed an association between methylation and expression of miR-124a in an additional 19 gastric cancer samples. Using a cut-off value of 6%, eight samples had methylation of all the three miR-124a genes, and the other 11 samples had methylation of only one or two genes and retained at least one unmethylated gene. miR-124a was barely expressed in all the eight samples with methylation of the three genes whereas it was expressed in 5 of 11 cancer samples with at least one unmethylated gene (Fig. 3b).

Accumulation of methylation in H. pylori positive gastric mucosae, and its association with gastric cancer risk

Methylation levels of miR-124a-1, miR-124a-2 and miR-124a-3, again along with LOX, were analyzed by qMSP in gastric mucosae of 56 healthy volunteers (28 volunteers with H. pylori and 28 without) and noncancerous gastric mucosae of 45 gastric cancer patients (29 patients with H. pylori and 16 without) (Fig. 3b). Among the healthy volunteers, the mean methylation levels of miR-124a-1, miR-124a-2, miR-124a-3 and LOX in the H. pylori-positive individuals were 13.1-, 7.8-, 8.9- and 46.7-fold, respectively, as high as those in H. pylori-negative individuals. This showed that H. pylori infection was associated with aberrant methylation of not only protein-coding genes but also miRNA genes.

Next, methylation levels in gastric mucosae of healthy volunteers were compared with those of noncancerous gastric mucosae of gastric cancer patients. Since potent methylation induction by H. pylori can mask a difference in H. pylori-positive individuals, the comparison was made among H. pylori-negative individuals only (28 healthy volunteers and 16 gastric cancer patients) (Table II; Fig. 3c). The mean methylation levels of the three miRNA genes and LOX were much higher in noncancerous gastric mucosae of gastric cancer patients than those of gastric mucosae of healthy volunteers (15.5-, 7.2-, 13.3- and 24.7-fold, respectively). Between the two histological types, the mean methylation levels were not different (Supp. Info. Fig. 2b).

Table II. Mean Methylation Levels and Standard Deviations of the Four Genes in Gastric Mucosae of Healthy Volunteers and Gastric Cancer Patients
  NmiR-124a-1miR-124a-2miR-124a-3LOX
H.pylori(−)(1) Healthy volunteers280.76 ± 1.705.75 ± 7.734.45 ± 9.290.43 ± 1.22
(2) Gastric cancer patients1611.82 ± 12.9441.66 ± 19.3359.42 ± 30.7110.64 ± 11.33
 H.pylori(+)(3) Healthy volunteers289.96 ± 12.2844.79 ± 23.9639.66 ± 30.0820.10 ± 15.72
(4) Gastric cancer patients2912.28 ± 14.3146.33 ± 28.3637.48 ± 25.1315.93 ± 12.58
 p value(1) vs. (3) <0.001<10−8<10−5<10−6
(1) vs. (2) 0.004<10−5<10−60.003
(3) vs. (4) 0.510.770.770.28

Correlations among methylation levels of miRNA genes and LOX were examined by calculating correlation coefficients. Correlations among the three miRNA genes were very strong, but correlations between a miRNA gene and LOX were weak or absent (Table III; Supp. Info. Fig. 3).

Table III. Correlation among Methylation Level of miR-124a-1, miR-124a-2, miR-124a-3 and LOX
 miR-124a-1miR-124a-2miR-124a-3LOX
rprprprp
  1. r, correlation coefficient.

miR-124a-10.70<10−150.77<10−200.030.76
miR-124a-20.7010−150.72<10−160.37<10−3
miR-124a-30.77<10−200.72<10−160.200.04

No effect of age and sex on methylation levels on miRNA genes

Methylation of various CGIs is reported to be correlated with age.33, 34 Also, males have twice as high an incidence of gastric cancers as females.1 In H. pylori-negative healthy volunteers, methylation levels of miR-124a-1, miR-124a-2 and miR-124a-3 were not correlated with age (Spearman correlation test: r = 0.19, 0.01 and 0.29; p = 0.35, 0.94 and 0.15), and not associated with sex (p = 0.05, 0.68 and 0.19). Also, in H. pylori-positive healthy volunteers, methylation levels were not correlated with age (r = 0.13, 0.18 and −0.1; p = 0.51, 0.35 and 0.51), and not associated with sex (p = 0.70, 0.20 and 0.67).

Discussion

The present study showed that significantly higher methylation levels of three miRNA genes (miR-124a-1, miR-124a-2 and miR-124a-3) were present in gastric mucosae of H. pylori-positive healthy volunteers, indicating that H. pylori infection can induce DNA methylation of miRNA genes, in addition to protein-coding genes. Moreover, it was also shown that methylation levels of the miRNA genes in noncancerous gastric mucosae of gastric cancer patients were higher than those in gastric mucosae of healthy volunteers among H. pylori negative individuals, indicating that miRNA silencing is involved in the formation of a field defect for gastric cancers. To our knowledge, the presence of miRNA silencing in a field for cancerization was shown here for the first time.

Recent studies demonstrated that expression of some miRNAs is regulated by epigenetic mechanisms.24, 35 From six miRNA genes that were reported to be silenced by promoter methylation and to have tumor-suppressor functions, we were able to confirm that three genes of miR-124a were methylation-silenced in gastric cancer cell lines. The other three genes, miR-137, miR-193a and miR-127, were expressed even in cell lines with complete methylation, and were unlikely to be silenced by promoter methylation in gastric cancers. Since methylation of putative promoter regions consistently represses transcription of their downstream genes,29, 30 the presence of the expression of the three genes in gastric cancer cell lines with complete methylation of their “promoter” CGI indicated that the three genes had additional or alternative promoters.

Lujambio et al.22 discovered that miR-124a was silenced by promoter methylation after screening 320 miRNA genes. They also found that miR-124a down-regulates CDK6, a demonstrated oncogene involved in cell cycle progression and differentiation, and induces hypophosphorylation of RB.22 Therefore, it is possible that miR-124a silencing is also involved in gastric carcinogenesis, and the presence of its silencing in noncancerous tissues could be directly associated with predisposition to developing gastric cancers.

As repeatedly shown by epidemiological studies, the majority of H. pylori-negative individuals with a gastric cancer are considered to have past exposure to H. pylori.36 Methylation levels of protein-coding genes, including LOX, in the gastric mucosae of individuals with past infection (gastric cancer patients without H. pylori) were lower than those of individuals with current infection (both healthy volunteers and gastric cancer patients) in our previous study.11 Actually, incidences of aberrant methylation and methylation levels of CDH1 are reported to decrease after the eradication of H. pylori,19, 37 showing that DNA methylation in gastric mucosae decreases when H. pylori infection discontinues. Interestingly, methylation levels of the three miRNA genes in the gastric mucosae of individuals with past infection by H. pylori (gastric cancer patients without H. pylori) did not decrease compared with those of individuals with current infection (healthy volunteers and gastric cancer patients). Since aberrant methylation induced in stem cells is expected to persist even after H. pylori infection discontinues, DNA methylation of these miRNA genes might be relatively more easily induced in gastric stem cells than those of protein-coding genes.

In conclusion, our data indicated that DNA methylation of certain miRNA genes was associated with H. pylori infection, in addition to protein-coding genes, and involved in the formation of field defect for gastric cancers.

Acknowledgements

The authors thank Drs. Eriko Okochi-Takada and Satoshi Yamashita for their advice.

Ancillary