SEARCH

SEARCH BY CITATION

Keywords:

  • DNA methylation;
  • green tea;
  • gastric cancer;
  • CDX2;
  • BMP-2

Abstract

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Epigenetic silencing of genes by aberrant DNA methylation is recognized as a crucial component of the mechanism underlying tumorigenesis. However, the relationship between DNA methylation and the past lifestyle in cancer patients remains largely unknown. We examined the methylation statuses of 6 tumor-related genes, CDX2 (homeobox transcription factor), BMP-2 (bone morphogenetic protein 2), p16 (INK4A), CACNA2D3 (calcium channel-related), GATA-5 (transcription factor) and ER (estrogen receptor), in 106 primary gastric carcinomas by methylation-specific PCR and compared them with the past lifestyles of the patients. The methylation frequencies of the genes were 23.6, 21.7, 9.4, 32.4, 40.8 and 59.1%, respectively. Significant association was found between a decreased intake of green tea and methylation of CDX2 and BMP-2. More physical activity was correlated with a lower methylation frequency of CACNA2D3. Of these 6 genes, the methylation statuses of CDX2, BMP-2 and p16 revealed a significant interrelationship and those of CACNA2D3, GATA-5 and ER did likewise. Thus, some epidemiological factors, such as green tea intake, could be important as to determination of the methylation statuses of selected genes and may influence the development of cancer, including that of the stomach. © 2008 Wiley-Liss, Inc.

Epigenetic changes, particularly methylation of cytosine in CpG dinucleotides in gene promoters, are found in almost every type of human neoplasm and are associated with transcriptional gene silencing.1, 2 Such promoter hypermethylation is as common as the disruption of tumor-suppressor genes in human cancer by mutation. Unlike irreversible genetic changes, epigenetic changes are thought to possibly be reversible by the environment, diet or pharmacological intervention. For example, monozygotic twins are considered genetically identical and are thus ideal for studying the effects of environmental and dietary factors on human health and diseases. In a study of a large cohort of identical twins, the patterns of DNA methylation across the genome were found to be very similar in young monozygotic twins in several cell types, but in older twins the patterns diverged.3 This strongly suggests that 1 or more environmental factors affect individuals throughout life, modifying gene expression through epigenetic mechanisms that have important implications for health.

Dietary factors are important determinants of cancer risk.4 Aberrant DNA methylation is associated with dietary factors and other lifestyle factors and may underlie carcinogenesis. The prevalence of promoter hypermethylation of 6 genes, such as APC, p14ARF, p16/INK4a (hereafter p16) and hMLH1, was higher in colorectal cancers derived from patients with a low folate/high alcohol intake than in ones with a high folate/low alcohol intake, but the differences were not statistically significant.5 The incidences of hypermethylation of D17S5 and p16 in lung cancer are significantly higher in cigarette smokers than in those who have never smoked.6–8 However, the relationship between DNA methylation and the past lifestyle in cancer patients remains largely unknown.

In 2000, gastric cancer was the second most frequent cause of cancer death worldwide.9 Infection with Helicobacter pylori is a strong risk factor for gastric cancer but is not a sufficient cause for its development.10 Epidemiological studies have strongly suggested that the risk may be increased with a high intake of salt and salt-preserved foods and decreased with a high intake of fruit and vegetables.11 The aberrant methylation of many genes has been reported in gastric cancer.12–14 We previously reported that CDX2 methylation in men was correlated with a decreased intake of green tea, suggesting that diet could be an important factor determining the methylation status of genes such as CDX2 and the resultant aberrant expression of genes involved in carcinogenesis.15 However, these effects may not be universal but gene-specific, and female patients have not been examined. Thus, we analyzed the methylation states of 6 genes in more gastric cancer patients. Five of the 6 genes, that is, CDX2,15BMP2,16p16,17CACNA2D318 and GATA5,19 were often methylated in gastric cancers but rarely in noncancerous epithelia. We, then, compared the relationship between DNA methylation and the past lifestyle in cancer patients including female ones.

Material and methods

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Study population

Cancer tissue specimens were collected from 106 consecutive patients with primary gastric carcinoma in a hospital affiliated to Tokyo Medical and Dental University during 2000–2005. Informed consent was obtained from all patients, and the study was approved by the institutional review committee of Tokyo Medical and Dental University. A self-administered questionnaire was used in this study to assess the lifestyle before cancer onset, covering the disease history, familial history of cancer, medication, cigarette smoking, alcohol consumption, physical activity, intake frequencies of selected food groups and food items, daily consumption of tea (green tea, oolong tea and black tea), regularity of sleep and meals, eating quantity, bowel motion, height and body weight. The food groups were beef, pork, chicken, ham/sausage/bacon, grilled meat, all meat, grilled fish, salted/dried/other processed fish products, pickled vegetables, green leaf vegetables, yellow colored vegetables, cruciferous vegetables, all vegetables, fruits and probiotics-fermented milk. The intake frequencies of these food groups were categorized into not eaten, 1–2 times/month, 1–2 times/week, 3–4 times/week, almost every day and almost every meal. Most lifestyle factors in this questionnaire were selected from those which had previously been reported to be risk or preventive factors for gastric and colon cancers on epidemiological observation.

Tumors were reviewed by a pathologist and microdissected prior to DNA extraction. Histological classification was performed according to the general rules established by the Japanese Gastric Cancer Association20 and Laurén's classification.21

Methylation analyses by the methylation-specific PCR procedure

We extracted genomic DNA from paraffin-embedded tissues by the phenol-chloroform method, and then carried out bisulfite modification and the methylation-specific PCR (MSP) procedure as previously described.22 The primer sequences of the CDX2, BMP-2, p16, CACNA2D3, GATA5, and estrogen receptor (ER) genes for the MSP analyses are shown in Table I. The PCR reaction was performed for 35 cycles in a 25 μl mixture comprising bisulfite-modified DNA (∼50 ng), 2.5 μl of 10 × PCR buffer, 1.25 μl of 25 mM dNTP, 10 pmole of each primer and 1 U of JumpStart Red Taq polymerase (Sigma, St. Louis, MO). Each PCR cycle consisted of 95°C for 30 sec, 58°C for 30 sec and 72°C for 30 sec, followed by final extension at 72°C for 5 min. The PCR products were electrophoresed in 2.5% agarose gels. All the MSP procedures were repeated more than twice. The methylation statuses of CDX2 and CACNA2D3 in several gastric cancer samples were also analyzed by LightCycler real-time PCR using bisulfite-modified DNA and methylation-specific primers, and the results were concordant with the MSP results.

Table I. PCR Primer Sequences Used for MSP
 SenseAntisense
CDX2
 UGAAGTTGTTGGTTTGGGGTTTTGTATCCCACAATACTCCACTAACTCCTCACA
 MCGTCGGTTTGGGGTTTCGTACGATACTCCGCTAACTCCTCGCG
BMP2
 UGGATGGTTGTTTTGAGTTATGGGTTGTCCTTAAAAACCAACACCCAAAAAACACA
 MGGTTGTTTCGAGTTATGGGTCGCAAAACCAACGCCCGAAAAACGCG
p16
 UTTATTAGAGGGTGGGGTGGATTGTCAACCCCAAACCACAACCATAA
 MTTATTAGAGGGTGGGGCGGATCGCGACCCCGAACCGCGACCGTAA
CACNA2D3
 UGGATATTGGAGTTTTTGAGTTTTTGTTTGTACAACAACCACCCAACCCCACCTCA
 MATATTGGAGTTTTCGAGTTTTCGTTCGCATATTGGAGTTTTCGAGTTTTCGTTCGC
GATA5
 UTGGAGTTTGTTTTTAGGTTAGTTTTTGGTAACTTCATAAACCCCAAAAAATCAAACA
 MAGTTCGTTTTTAGGTTAGTTTCGGCTTCGTAAACCCCGAAAAATCGAACG
ER
 UGGTGTATTTGGATAGTAGTAAGTTTGTCCATAAAAAAAACCAATCTAACCA
 MGTGTATTTGGATAGTAGTAAGTTCGTCCGTAAAAAAAACCGATCTAACCG

Statistical analysis

The promoter methylation status of specific genes, clinico-pathological parameters and lifestyle variables in the patients were computed. Differences in frequency by methylation status were tested using the χ2 test, and differences in mean values were tested using the t test. The association between the methylation status and dietary variables was also analyzed using a nonparametric test (Mann-Whitney U test). We further studied the association using the backward elimination (Wald test) method of logistic regression analysis. In this analysis, the intake frequencies of food groups were dichotomous as follows: ≤6 cups/day vs. ≥7 cups/day for green tea, ≤twice/week vs. ≥3 times/week for pickled vegetables and ≤twice/week vs. ≥3 times/week for drinking. Physical activity was defined as “recreational and voluntary physical exercise for health promotion” and primarily divided into 4 categories in questionnaire as follows: Never, 1–2 hr/week, 3–4 hr/week and ≥5 hr/week. However, in the logistic regression analysis, we combined these categories into 2 groups, ≥1 hr/week vs. never. Pearson's contingency coefficients for methylation status of an every pair of the 6 genes were calculated in 106 gastric carcinomas. p for trend was calculated by the Cochran-Armitage test. The statistical software used was SPSS software (version 14.0).

Results

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Methylation statuses of CDX2, BMP-2, p16, CACNA2D3, GATA5 and ER in primary gastric carcinomas

The methylation statuses of CDX2, BMP-2, p16, CACNA2D3, GATA5 and ER were determined in 106 primary gastric carcinomas by MSP analyses using the specific primers shown in Table I. The methylation frequencies of these genes were 23.6, 21.7, 9.4, 32.4, 40.8 and 59.1%, respectively. When we examined the CDX2 methylation statuses of noncancerous gastric tissues in 12 patients with methylation-positive gastric cancer and in 13 patients with methylation-negative one, and the CACNA2D3 methylation statuses of noncancerous tissues in 7 patients with methylation-positive gastric cancer and 19 patients with methylation-negative one, we found no methylation in any samples by MSP, indicating cancer-related methylation of these genes (data not shown).

The relationship between methylation frequencies of the 6 genes and clinicopathological parameters

The clinico-pathological characteristics of the studied patients by the methylation statuses of CDX2, BMP-2, p16, CACNA2D3, GATA5 and ER are shown in Table II. The methylation of p16 was significantly more frequent in diffuse type (8/49, 16.3%) than in intestinal (2/57, 3.5%) type gastric carcinomas (p = 0.04). CACNA2D3 methylation was more frequently found in lymph node metastasis-positive cases (20/45, 44.4%) than in negative ones (14/60, 23.3%) (p = 0.03). In contrast, there was no statistically significant correlation between methylation of 4 of the genes, CDX2, BMP-2, GATA5 and ER, and clinico-pathological parameters (Table II).

Table II. Clinicopathological Characteristics of Studied Patients According to the Methylation Statuses of Six Genes
 CDX2 (n = 106)BMP-2 (n = 106)p16 (n = 106)
Methylated (n = 25)Unmethylated (n = 81)p valueMethylated (n = 23)Unmethylated (n = 83)p valueMethylated (n = 10)Unmethylated (n = 96)p value
  1. Clinicopathological characteristics between patients with and without methylation were compared using the χ2 test for categorical data and the t test for comparison of mean.

Age (mean ± SD)66.0 ± 10.663.8 ± 10.30.3563.6 ± 8.864.5 ± 10.80.7359.4 ± 12.164.8 ± 10.00.12
Sex
 Male22570.1117621.009700.45
 Female324 621 126 
Size (cm, mean ± SD)5.7 ± 4.35.6 ± 3.50.915.6 ± 4.65.7 ± 3.40.926.1 ± 4.05.6 ± 3.70.69
Histology
 Intestinal9480.0711460.522550.04
 Diffuse1633 1237 841 
Depth of tumor invasion
 m, ms15390.3613410.643510.20
 mp - si1042 1042 745 
Lymph node metastasis
 −16440.4917430.103570.10
 +937 640 739 
 CACNA2D3 (n = 105)GATA5 (n = 98)ER (n = 93)
Methylated (n = 34)Unmethylated (n = 71)p valueMethylated (n = 40)Unmethylated (n = 58)p valueMethylated (n = 55)Unmethylated (n = 38)p value
Age (mean ± SD)65.8 ± 11.263.8 ± 9.90.3564.9 ± 9.864.1 ± 10.90.7165.7 ±9.962.3 ± 10.30.12
Sex
 Male25540.8127460.2442250.35
 Female917 1312 1313 
Size (cm, mean ± SD)5.9 ± 3.65.5 ± 3.70.616.4 ± 4.25.4 ± 3.40.235.5 ± 3.45.8 ± 3.80.72
Histology
 Intestinal17400.6820310.8432170.21
 Diffuse1731 2027 2321 
Depth of tumor invasion
 m, ms16370.6821250.4128191.00
 mp - si1834 1933 2719 
Lymph node metastasis
 −14460.0322321.0028250.20
 +2025 1826 2713 

The relationship between methylation frequencies of the 6 genes and epidemiological parameters in gastric carcinoma patients

As shown in Table III, the methylation frequencies of CDX2 and BMP-2 were lower in patients consuming 7 cups or more per day of green tea than those consuming 6 cups or less per day (2/25 (8%) vs. 22/80 (27.5%), p = 0.06 and 1/25 (4%) vs. 22/80 (27.5%), p = 0.02, respectively). Patients consuming more pickled vegetables exhibited a higher methylation frequency of GATA5 than ones consuming less (p = 0.04). CACNA2D3 methylation was more frequently found in patients with no physical activity (20/44, 45.5%) than in those with more physical activity (14/59, 23.7%) (p = 0.03). In contrast, there was no statistically significant correlation between methylation of 2 of the genes, p16 and ER, and clinico-pathological parameters (Table III).

Table III. Relationships Between the Methylation Status and Lifestyle Factors
 CDX2 (n = 106)BMP-2 (n = 106)p16 (n = 106)
Menthylated (n = 25)Unmethylated (n = 81)Univariate p valueMenthylated (n = 23)Unmethylated (n = 83)Univariate p valueMenthylated (n = 10)Unmethylated (n = 96)Univariate p value
  1. p values for χ2 test.

Green tea         
 ≥7 cups/day2230.061240.021240.45
 ≤6 cups/day2258 2258 971 
Pickled vegetables         
 ≥3 times/week14400.513410.625491.00
 ≤twice/week1040 1040 545 
Physical activity         
 ≥1 hr/week12470.4913460.805540.74
 Never1233 936 540 
 CACNA2D3 (n = 105)GATA5 (n = 98)ER (n =93)
Menthylated (n = 34)Unmethylated (n = 71)Univariate p valueMenthylated (n = 40)Unmethylated (n = 58)Univariate p valueMenthylated (n = 55)Unmethylated (n = 38)Univariate p value
Green tea         
 ≥7 cups/day7180.6310151.001580.63
 ≤6 cups/day2752 3042 3930 
Pickled vegetables         
 ≥3 times/week19340.5426240.0429190.68
 ≤twice/week1535 1432 2419 
Physical activity         
 ≥1 hr/week14450.0320350.4029230.67
 Never2024 1922 2415 

When the intake of green tea was stratified, the prevalence of aberrant methylation of CDX2 and BMP-2 decreased significantly with a higher intake of green tea (Mann-Whitney U-test, both p = 0.04; Cochran-Armitage test, ptrend = 0.03 and 0.02, respectively) (Figs. 1a and 1b). A distinct distribution of patients with methylated and unmethylated CACNA2D3 was also demonstrated for physical activity (Mann-Whitney U-test, p = 0.03; Cochran-Armitage test, ptrend = 0.03) (Fig. 1c). On the other hand, an increased intake of pickled vegetables was not associated with an increased methylation frequency of GATA5 (p = 0.11).

thumbnail image

Figure 1. Frequencies of the presence (closed bars) or absence (open bars) of CDX2 (a) and BMP-2 (b) methylation in gastric cancers stratified as to intake of green tea and those of CACNA2D3 methylation and physical activity (c).

Download figure to PowerPoint

Since dietary factors are closely interrelated, we further performed the backward elimination (Wald) method of logistic regression analysis of the methylation status of each gene in gastric cancer patients including female ones (Table IV). A significant association was found between the intake of green tea and methylation of 2 of the genes, CDX2 and BMP-2. Increased daily consumption of green tea (7 cups or more per day) showed a significant association with decreased methylation frequencies of CDX2 and BMP-2 after adjustment (p = 0.04 and p = 0.049, respectively). On the other hand, an increased methylation frequency of CACNA2D3 was associated with less physical activity (negative versus positive), adjusting for confounding variables (p = 0.06) (Table IV). As for factors other than dietary ones, the logistic regression analysis also showed significant associations between CDX2 methylation and gender or histology, p16 methylation and histology, and CACNA2D3 methylation and lymph node metastasis (Table IV).

Table IV. Standardized Partial Regression Coefficients of Variables Related with Methylation Status of Each Gene
 βSEp
  1. These variables were selected using the backward elimination (Wald) method of logistic regression analysis for the methylation status of each gene.

CDX2   
 Gender (men vs women)−1.870.780.02
 Histology (intestinal vs diffuse)2.610.780.001
 Green tea (≤6 cups/day vs. ≥7 cups/day)−1.870.920.04
BMP-2   
 Green tea (≤6 cups/day vs. ≥7 cups/day)−2.081.060.049
p16   
 Histology (intestinal vs. diffuse)2.066.030.01
CACNA2D3   
 Lymph node metastasis (negative vs. positive)0.930.450.04
 Physical activity (never vs. ≥1 hr/week)−0. 860.450.06

Interrelationship of the 6 genes relative to their methylation statuses in gastric carcinomas

The methylation statuses of the 6 genes in 106 gastric carcinomas are shown in Figure 2. The methylation patterns of 3 genes, CACNA2D3, GATA-5 and ER, were distinct from other 3 genes, CDX2, BMP-2 and p16. To determine the relationship of the methylation statuses among the 6 genes, Pearson's contingency coefficients for methylation status of an every pair of the 6 genes were calculated (Table V). On the basis of the contingency coefficients, we found that the 6 genes were divided into 2 groups, Group I (CDX2, BMP-2 and p16) and Group II (CACNA2D3, GATA-5 and ER), where a statistically significant interrelationship within each group but no intergroup association was noted. The methylation frequencies in gastric carcinomas were lower for Group I genes (CDX2, 23.6%; BMP-2, 21.7% and p16, 9.4%) than Group II ones (CACNA2D3, 32.4%; GATA-5, 40.8% and ER, 59.1%).

thumbnail image

Figure 2. Summary of the methylation statuses of the 6 genes in 106 gastric carcinomas. Each column represents a different gene indicated on the top. Each row represents a primary gastric carcinoma. Black squares, methylated alleles in the carcinoma. White squares, unmethylated alleles in the carcinoma. CACN, CACNA2D3; GA5, GATA5. NA, not amplified.

Download figure to PowerPoint

Table V. Contingency Coefficients for Methylation Status Between Two Genes
 CDX2BMP2p 16CACNA2D3GATA5ER
  • p value for χ2 test.

  • 1

    p < 0.05.

  • 2

    p < 0.01.

  • 3

    p < 0.0001.

  • 4

    p < 0.001.

CDX2      
BMP-20.241     
p160.3320.221    
CACNA2D30.090.080.312   
GATA50.100.120.090.393  
ER0.010.020.20.3640.364 

As described earlier, aberrant methylation of CDX2 and BMP-2 was inversely correlated with green tea intake. The prevalence of p16 methylation was also higher in patients with a lower green tea intake than those with a higher intake, although the difference was not significant. When we analyzed the relationship between green tea intake and the methylation of combinations of Group I genes by the multinominal logistic regression model, the odds ratios of methylation for any 1 gene and ≥2 genes vs. no methylation were 4.9 (confidence interval (CI) 1.0–24.3) and 14.8 (CI 1.1–206.7), respectively, in patients consuming 6 cups or less per day of green tea compared with those consuming 7 cups or more per day. On the other hand, no lifestyle factors were associated with the methylation of combinations of Group II genes.

Discussion

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The methylation frequencies of the 6 genes in 106 gastric carcinomas varied from 9.4 to 59.1%. The prevalence of promoter hypermethylation of CDX2 and BMP-2 was significantly higher in gastric carcinomas derived from patients with a low green tea intake than those with a high intake. When we analyzed the association between the methylation status and variables using a nonparametric test, increased intake of green tea was found to be significantly associated with decreased methylation frequencies of CDX2 and BMP-2. In a previous study,15 methylation of 1 of 3 genes, CDX2, was correlated with a decreased intake of green tea in 58 male gastric carcinoma patients. Since an inverse relationship with green tea intake was also found for BMP-2 promoter methylation in 106 gastric carcinoma patients including female ones in this study, the effect of green tea on the decrease of gene promoter methylation might be more common for many genes.

The evidence derived from epidemiologic studies on the relationship between drinking of green tea and cancer-preventive effects is inconclusive; some indicated preventive effects23, 24 and some did not.25, 26 In a detailed study, consumption of green tea was found to be associated with a decreased risk of gastric carcinoma in Japanese women after adjustment for potential confounding factors, whereas no association was observed among Japanese men.27 The difference between women and men might be explained by the much higher cigarette smoking rate in men than women in Japan, which may play a role as an effect modifier.28

Green tea contains several polyphenolic compounds, such as (−)-epigallocatechin-3-gallate (EGCG). A significant inhibitory effect of EGCG on chemical carcinogenesis in the rat stomach has been reported.29 As for its action on methylation, it was reported that EGCG dose-dependently inhibited DNA methyltransferase activity in several cancer cells, resulting in reactivation of methylation-silenced genes, such as retinoic acid receptor β, p16 and hMLH1.30, 31 Polyphenols are rapidly metabolized to forms with quite different bioactivities. But the epithelial surfaces of the gut, particularly those of the esophagus and the stomach, are exposed on the luminal side to high concentrations of tea polyphenols before they undergo metabolism. These characteristics may make gastrointestinal epithelial tissues particularly susceptible to what are probably the beneficial effects of DNA methyltransferase inhibitors.

In other studies, however, EGCG did not inhibit DNA methyltransferase activity or reactivate genes, whereas nucleoside analogue methylation inhibitors, such as 5-aza-2′-deoxycytidine, were far more effective.32, 33 We also analyzed the effect of EGCG on transcriptional levels of CDX2 and BMP-2 in 3 human gastric cancer cell lines. Upregulation of both genes was not found in any cell lines (Hashimoto et al., personal communication). Thus, further studies are necessary to determine how tea polyphenols act on DNA methylation.

CACNA2D3 methylation was more frequently found in gastric carcinoma patients with no physical activity than in those with physical activity. It is known from epidemiological studies that physical activity protects against cancers of the colon, breast (postmenopause) and endometrium.4 As for gastric carcinoma, a population based case-control study in Canada and a prospective cohort study in Norway indicated that recreational physical activity might have a protective effect against gastric cancer.34, 35 To determine the association of physical activity with promoter hypermethylation of APC and RASSF1A in breast tissue, a cross-sectional study on 45 women without breast cancer was performed, which revealed that physical activity was inversely associated with promoter hypermethylation of APC but not RASSF1A.36 It is, therefore, possible that physical activity may affect the methylation of genes, such as CACNA2D3, and gastric carcinogenesis.

There are 2 types of genes according to contingency coefficients for methylation status in gastric carcinomas. The methylation frequencies were lower for Group I genes (9.4–23.6%) than Group II ones (32.4–59.1%). The odds ratios of methylation for any 1 gene and ≥2 genes vs. no methylation among the Group I genes were much higher in patients consuming 6 cups or less per day of green tea than in those consuming 7 cups or more per day. These data suggest that green tea intake may be inversely related to the methylation of Group I genes, which may be involved in carcinogenesis. The logistic regression analysis also showed significant associations between histology and the methylation of CDX2 and p16. But there was no association between BMP-2 methylation and histology. Further investigations are required to clarify the significance of the 2 different types of genes as to methylation in gastric carcinomas.

In conclusion, there were inverse associations between the intake of green tea and the methylation of CDX2 and BMP-2, and between physical activity and CACNA2D3 methylation. We, therefore, hypothesized that some of the lifestyle factors, which have been reported to be preventive as to gastric cancer on epidemiological observation, may influence the development of gastric cancer through the demethylation or retaining of unmethylated status of selected genes. Because an epigenetic drift may contribute to the development of cancer, strategies involving changes in lifestyle including diet might be highly beneficial in preventing/reversing epigenetic alterations and counteracting cancer.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

This work was supported by Grant-in-Aid for Scientific Research on Priority Areas-Cancer 17015013 from the Ministry of Education, Culture, Sports, Science, and Technology, Japan (Y. Yuasa). The authors thank Ms. Y. Ozawa for assistance in the preparation of the manuscript.

References

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • 1
    Esteller M,Corn PG,Baylin SB,Herman JG. A gene hypermethylation profile of human cancer. Cancer Res 2001; 61: 32259.
  • 2
    Jones PA,Baylin SB. The fundamental role of epigenetic events in cancer. Nat Rev Genet 2002; 3: 41528.
  • 3
    Fraga MF,Ballestar E,Paz MF,Ropero S,Setien F,Ballestar ML,Heine-Suñer D,Cigudosa JC,Urioste M,Benitez J,Boix-Chornet M,Sanchez-Aguilera A, et al. Epigenetic differences arise during the lifetime of monozygotic twins. Proc Natl Acad Sci USA 2005; 102: 106049.
  • 4
    Marmot M,Atinmo T,Byers T,Chen J,Hirohata T,Jackson A,James WPT,Kolonel LN,Kumanyika S,Leitzmann C,Mann J,Powers HJ, et al., eds. Food, nutrition, physical activity, and the prevention of cancer: a global perspective. Washington, DC: World Cancer Research Fund/American Institute for Cancer Research, 2007. 517p.
  • 5
    van Engeland M,Weijenberg MP,Roemen GM,Brink M,de Bruïne AP,Goldbohm RA,van den Brandt PA,Baylin SB,de Goeij AF,Herman JG. Effects of dietary folate and alcohol intake on promoter methylation in sporadic colorectal cancer: the Netherlands cohort study on diet and cancer. Cancer Res 2003; 63: 31337.
  • 6
    Eguchi K,Kanai Y,Kobayashi K,Hirohashi S. DNA hypermethylation at the D17S5 locus in non-small cell lung cancers: its association with smoking history. Cancer Res 1997; 57: 49135.
  • 7
    Kim DH,Nelson HH,Wiencke JK,Zheng S,Christiani DC,Wain JC,Mark EJ,Kelsey KT. p16INK4a and histology-specific methylation of CpG islands by exposure to tobacco smoke in non-small cell lung cancer. Cancer Res 2001; 61: 341924.
  • 8
    Belinsky SA. Gene-promoter hypermethylation as a biomarker in lung cancer. Nat Rev Cancer 2004; 4: 70717.
  • 9
    Shibuya K,Mathers CD,Boschi-Pinto C,Lopez AD,Murray CJL. Global and regional estimates of cancer mortality and incidence by site. II. Results for the global burden of disease 2000. BMC Cancer 2002; 2: 37.
  • 10
    Yuasa Y. Control of gut differentiation and intestinal-type gastric carcinogenesis. Nat Rev Cancer 2003; 3: 592600.
  • 11
    Tsugane S,Sasazuki S. Diet and the risk of gastric cancer: review of epidemiological evidence. Gastric Cancer 2007; 10: 7583.
  • 12
    Toyota M,Ahuja N,Suzuki H,Itoh F,Ohe-Toyota M,Imai K,Baylin SB,Issa JP. Aberrant methylation in gastric cancer associated with the CpG island methylator phenotype. Cancer Res 1999; 59: 543842.
  • 13
    Ushijima T,Nakajima T,Maekita T. DNA methylation as a marker for the past and future. J Gastroenterol 2006; 41: 4017.
  • 14
    Kang GH,Lee S,Cho NY,Gandamihardja T,Long TI,Weisenberger DJ,Campan M,Laird PW. DNA methylation profiles of gastric carcinoma characterized by quantitative DNA methylation analysis. Lab Invest 2008; 88: 16170.
  • 15
    Yuasa Y,Nagasaki H,Akiyama Y,Sakai H,Nakajima T,Ohkura Y,Takizawa T,Koike M,Tani M,Iwai T,Sugihara K,Imai K, et al. Relationship between CDX2 gene methylation and dietary factors in gastric cancer patients. Carcinogenesis 2005; 26: 193200.
  • 16
    Wen XZ,Akiyama Y,Baylin SB,Yuasa Y. Frequent epigenetic silencing of the bone morphogenetic protein 2 gene through methylation in gastric carcinomas. Oncogene 2006; 25: 266673.
  • 17
    Leung WK,Yu J,Ng EK,To KF,Ma PK,Lee TL,Go MY,Chung SC,Sung JJ. Concurrent hypermethylation of multiple tumor-related genes in gastric carcinoma and adjacent normal tissues. Cancer 2001; 91: 2294301.
  • 18
    Wanajo A,Sasaki A,Nagasaki H,Shimada S,Otsubo T,Owaki S,Shimizu Y,Eishi Y,Kojima K,Nakajima Y,Kawano T,Yuasa Y, et al. Methylation of the calcium channel-related gene, CACNA2D3, is frequent and a poor prognostic factor in gastric cancer. Gastroenterology 2008; 135: 58090.
  • 19
    Akiyama Y,Watkins N,Suzuki H,Jair KW,van Engeland M,Esteller M,Sakai H,Ren CY,Yuasa Y,Herman JG,Baylin SB. GATA-4 and GATA-5 transcription factor genes and potential downstream antitumor target genes are epigenetically silenced in colorectal and gastric cancer. Mol Cell Biol 2003; 23: 842939.
  • 20
    Japanese Gastric Cancer Association. Japanese Classification of Gastric Carcinoma—2nd English Edition. Gastric Cancer 1998; 1: 1024.
  • 21
    Laurén P. The two histological main types of gastric carcinoma: diffuse and so-called intestinal-type carcinoma. Acta Pathol Microbiol Scand 1965; 64: 3149.
  • 22
    Herman JG,Graff JR,Myohanen S,Nelkin BD,Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA 1996; 93: 98216.
  • 23
    Tajima K,Tominaga S. Dietary habits and gastro-intestinal cancers: a comparative case-control study of stomach and large intestinal cancers in Nagoya, Japan. Jpn J Cancer Res 1985; 76: 70516.
  • 24
    Mu L-N,Lu Q-Y,Yu S-Z,Jiang Q-W,Cao W,You N-C,Setiawan VW,Zhou X-F,Ding B-G,Wang R-H,Zhao J,Cai L, et al. Green tea drinking and multigenetic index on the risk of stomach cancer in a Chinese population. Int J Cancer 2005; 116: 97283.
  • 25
    Tsubono Y,Nishino Y,Komatsu S,Hsieh CC,Kanemura S,Tsuji I,Nakatsuka H,Fukao A,Satoh H,Hisamichi S. Green tea and the risk of gastric cancer in Japan. N Engl J Med 2001; 344: 6326.
  • 26
    Hoshiyama Y,Kawaguchi T,Miura Y,Mizoue T,Tokui N,Yatsuya H,Sakata K,Kondo T,Kikuchi S,Toyoshima H,Hayakawa N,Tamakoshi A, et al. A prospective study of stomach cancer death in relation to green tea consumption in Japan. Br J Cancer 2002; 87: 30913.
  • 27
    Sasazuki S,Inoue M,Hanaoka T,Yamamoto S,Sobue T,Tsugane S. Green tea consumption and subsequent risk of gastric cancer by subsite: the JPHC Study. Cancer Causes Control 2004; 15: 48391.
  • 28
    Sasazuki S,Inoue M,Miura T,Iwasaki M,Tsugane S. Plasma tea polyphenols and gastric cancer risk: a case-control study nested in a large population-based prospective study in Japan. Cancer Epidemiol Biomarkers Prev 2008; 17: 34351.
  • 29
    Yamane T,Takahashi T,Kuwata K,Oya K,Inagake M,Kitao Y,Suganuma M,Fujiki H. Inhibition of N-methyl-N′-nitro-N-nitrosoguanidine-induced carcinogenesis by (-)-epigallocatechin gallate in the rat glandular stomach. Cancer Res 1995; 55: 20814.
  • 30
    Fang MZ,Wang Y,Ai N,Hou Z,Sun Y,Lu H,Welsh W,Yang CS. Tea polyphenol (-)-epigallocatechin-3-gallate inhibits DNA methyltransferase and reactivates methylation-silenced genes in cancer cell lines. Cancer Res 2003; 63: 756370.
  • 31
    Lee WJ,Shim JY,Zhu BT. Mechanisms for the inhibition of DNA methyltransferases by tea catechins and bioflavonoids. Mol Pharmacol 2005; 68: 101830.
  • 32
    Chuang JC,Yoo CB,Kwan JM,Li TW,Liang G,Yang AS,Jones PA. Comparison of biological effects of non-nucleoside DNA methylation inhibitors versus 5-aza-2′-deoxycytidine. Mol Cancer Ther 2005; 4: 151520.
  • 33
    Stresemann C,Brueckner B,Musch T,Stopper H,Lyko F. Functional diversity of DNA methyltransferase inhibitors in human cancer cell lines. Cancer Res 2006; 66: 2794800.
  • 34
    Campbell PT,Sloan M,Kreiger N. Physical activity and stomach cancer risk: the influence of intensity and timing during the lifetime. Eur J Cancer 2007; 43: 593600.
  • 35
    Sjödahl K,Jia C,Vatten L,Nilsen T,Hveem K,Lagergren J. Body mass and physical activity and risk of gastric cancer in a population-based cohort study in Norway. Cancer Epidemiol Biomarkers Prev 2008; 17: 13540.
  • 36
    Coyle YM,Xie X-J,Lewis CM,Bu D,Milchgrub S,Euhus DM. Role of physical activity in modulating breast cancer risk as defined by APC and RASSF1A promoter hypermethylation in nonmalignant breast tissue. Cancer Epidemiol Biomarkers Prev 2007; 16: 1926.