BAMBI gene is epigenetically silenced in subset of high-grade bladder cancer

Authors


Abstract

The bone morphogenetic protein (BMP) and activin membrane-bound inhibitor (BAMBI) is a transmembrane TGFRI/BMPRI-related pseudoreceptor, antagonizes transforming growth factor (TGF)-β/BMP signaling by inhibiting the formation of functional authentic receptor complexes (TGFRI/BMPRI and TGFRII/BMPRII). On the assumption that BAMBI gene expression is epigenetically altered during human bladder cancer progression, we screened the expression of BAMBI protein by immunohistochemistry and the methylation status of the BAMBI promoter. In the normal or reactive urothelium, BAMBI expression was mostly overlapped with that of BMPRI, and a similar colocalization pattern was noted in low-grade papillary cancers. In high-grade and invasive cancers, however, mainly two reciprocal immunohistochemical expression patterns were observed: BAMBI-low/BMPRI-high, and BAMBI-high/BMPRI-low, indicating that BAMBI expression is controlled such that it does not interfere with the responsiveness of high-grade cancer cells to TGF-β/BMP signaling. Moreover, methylation of the BAMBI gene correlated significantly with negative BAMBI expression in bladder tumors. Although BAMBI overexpression significantly increased the number of apoptotic cells in T24 line, knock-down small interfering RNA showed no remarkable change. Cell motility assay revealed that on treatment with either TGF-β1 or BMP2, T24 and HTB9 lines showed a marked increase in the number of migrated cells which, however, decreased significantly through the forced expression of BAMBI. Since certain subsets of aggressive tumors often promote cell motility, invasion and survival by inducing epithelial-to-mesenchymal transition through TGF-β/BMP in an autocrine and paracrine manner, hypermethylation of the BAMBI gene promoter that leads to BAMBI gene suppression may be one of the epigenetic events affecting the invasiveness or aggressiveness of bladder cancers. © 2009 UICC

Urinary bladder cancer is the seventh most common cancer worldwide with an annual estimated 260,000 new cases in men and 76,000 in women.1 Of bladder tumors, 70–80% are, at the time of initial examination, detected as low-grade noninvasive or minimally invasive papillary tumors (pTa or pT1) with a high rate of recurrence, but with a low tendency for progression to advanced disease.2, 3 The remaining 20% are, despite improvements in diagnostic methods and treatments, detected as high-grade invasive cancer with poor prognosis,4 and seem as either superficial spreading flat (carcinoma in situ/pTis) or invasive nodular tumors. By conventional histopathological grading and staging of bladder cancer, however, especially at initial biopsy obtained from the superficial area or urinary cytological samples, it is often difficult to foresee which tumors will recur or progress to advanced stages. Further understanding of the underlying molecular pathways and their roles in bladder carcinogenesis and progression is, therefore, needed to obtain new molecular markers for risk assessment of bladder cancer.

Transforming growth factor-β (TGF-β)/bone morphogenetic protein (BMP) signaling plays an important role in a broad spectrum of biology including cell proliferation, differentiation, migration, immune response, angiogenesis and apoptosis. Activin, a member of the TGF-β superfamily, also regulates a wide variety of cellular events, including cell proliferation, differentiation and apoptosis.5–7 The role of TGF-β/BMP in cancer development and progression is also complex and often controversial, involving both aspects of tumor suppression and promotion according to tumor type and stage. The deregulation of activin/BMP signals also contributes to the development of cancer. The receptors and their ligand-binding features, as well as receptor-SMAD interaction, are all similar to those of TGF-β; the activation mechanism of type-I receptor, through phosphorylation in the GS (glycine- and serine-rich sequence) domain by type-II receptor, is conserved among TGF-β, activin and BMP. In general, TGF-β/BMP signaling initially plays the role as a tumor suppressor in epithelial cells, and then as a promoter for invasion and metastasis during the later stages of carcinoma progression.7–11 Numerous genetic alterations in components associated with the TGF-β/BMP signaling pathway that correlate with carcinogenesis, tumor progression and prognosis in various types of malignancies have been identified.8, 12, 13 In colorectal cancers, for example, where the TGF-β/BMP signaling pathway in general negatively regulates tumor cell proliferation from early carcinogenesis to a later progression stage, loss-of-function mutation in TGF-β/BMP signaling, such as the inactivating mutation of SMAD4, has frequently been identified as an important early carcinogenic event.10, 14, 15 On the other hand, in various types of cancers especially at later cancer progression stages, TGF-β/BMPs, frequently produced by cancer cells themselves, promote angiogenesis and epithelial-to-mesenchymal transition (EMT). Furthermore, in a certain subset of aggressive cancers, the TGF-β/BMP signaling pathway often promotes cancer cell invasion and migration in an autocrine and paracrine manner.9, 10, 13

The BMP and activin membrane-bound inhibitor (BAMBI), a transmembrane protein preserved from Xenopus to Homo sapiens, is highly homologous to TGF-β/BMP type-I receptors (TGFRI/BMPRI), except that it lacks an intracellular serine/threonine-kinase domain. It is incorporated into complexes with TGF-β/BMP/activin type-II receptors (TGFRII/BMPRII) and, as a pseudoreceptor, antagonizes all TGF-β/BMP and activin signaling.5, 7, 16–19BAMBI is coexpressed with BMP4 in many developmental processes during embryogenesis in Xenopus, zebrafish and mouse.17, 20, 21 Because BMP4 signaling is an essential and highly regulated process during many developmental processes, BAMBI, by forming a short and direct negative feedback loop, is speculated to play a role in the fine-tuning of BMP4 signaling during embryonic development.17 Little is known, however, about whether or not, or how BAMBI is involved in carcinogenesis and tumor progression, except from few studies that show BAMBI negatively regulates TGF-β/BMP signaling in colorectal, hepatocellular and gastric carcinoma.18, 22, 23

In the current study, on the assumption that BAMBI gene expression is epigenetically altered during human bladder cancer progression, we first screened the expression pattern of BAMBI protein by immunohistochemistry and the methylation status of the BAMBI gene promoter with the use of clinical specimens from Japan and Myanmar, and then examined the functional aspects of the BAMBI gene by forced-expression and knock-down in cancer cell lines in vitro.

Abbreviations:

BAMBI, BMP and activin membrane-bound inhibitor; BMP, bone morphogenetic protein; BMPR, BMP receptor; CpG, phosphodiester-linked cytosine-guanine pair; GFP, green fluorescent protein; sFRP, secreted frizzled-related gene; MSP, Methylation-specific polymerase chain reaction; RT-PCR, reverse transcription-polymerase chain reaction; (Q-RT) PCR, quantitative real time polymerase chain reaction; TGF-β, transforming growth factor-β; TGFR, TGF-β receptor.

Material and methods

Cell lines and tissue preparation

Three human bladder cancer cell lines [T24, HTB9 (ATCC, Manassas, VA) and KU1 (Keio University, Tokyo, Japan)] and five human colon and one breast cancer cell lines (COLO201, SW480, HT29, DLD-1, COLO320 and MCF7) (ATCC, Manassas, VA) were cultured in RPMI1640 supplemented with 10% fetal bovine serum, 100 U/ml penicillin and 100 U/ml streptomycin, and maintained at 37 °C in a humidified atmosphere with 5% CO2. Formalin-fixed and paraffin-embedded tissue samples of 74 primary urinary bladder tumors (41 from Japanese patients, mean age 65.4 ± 4.4 years; and 33 Myanmarese patients, mean age 60 ± 4 years) (Table I) were used for H&E staining to determine pathological diagnosis according to the criteria of the World Health Organization (2004) and the International Society of Urological Pathology. This study was reviewed and approved by the local ethics committee at Kobe University.

Table I. Clinicopathological Data of Bladder Cancer Patients
StatusBladder cancer cases
Japan, n (%)Myanmar, n (%)
  1. n indicates number of cases; TCC, transitional cell carcinoma; SCC, squamous cell carcinoma. Two cases of pT1 and one case of pT2 associate with pTis.

No. patients4133
 Male36 (48.6)24 (32.4)
 Female5 (6.8)9 (12.2)
Age in years (mean)65.4 ± 4.460 ± 4
Pathologic grade  
 High grade27 (36.5)20 (27)
 Low grade14 (19)13 (17.5)
Pathologic stage  
 pTa17 (23)15 (20.2)
 pTis1 (1.35)
 pT115 (20.2)9 (12.1)
 pT29 (12.1)8 (11)
Invasion  
 Presence24 (32.4)17 (23)
 Absence17 (23)16 (21.6)
TCC41 (55.4)30 (40.5)
Other (SCC or adenocarcinoma)3 (4.05)

Methylation analysis

DNA extraction and bisulfite modification

The bisulfite reaction was carried out as described.24 Briefly, 10 μl of low-melting agarose beads, containing 0.5 μg genomic DNA derived from each cell line and paraffin tissue samples (n=74), were formed in mineral oil and denatured with NaOH (final concentration, 0.1 M). The beads were dipped in 1 ml of freshly prepared bisulfite solution containing 1 mM hydroquinone and 3.5 M NaHSO3 at pH 5. The liquid surface was sealed with mineral oil, and the samples were incubated for 16 hr at 50 °C. The beads were then washed with Tris-EDTA, desulfonated with 0.5 N NaOH for 30 min, neutralized with 1 N HCl and finally washed with Tris-EDTA. Bead fragments containing up to 0.1 μg DNA were used for polymerase chain reaction (PCR).

Methylation-specific PCR

The methylation status of p16, sFRP1, sFRP2, sFRP4, sFRP5 and BAMBI genes was analyzed by methylation-specific polymerase chain reaction (MSP) after bisulfite conversion of the respective DNA samples, using the sets of primers as previously published.25–27 Briefly, 1 μl bisulfite-modified DNA was amplified in a total volume of 25 μl containing 10× CoralLoad PCR buffer, 5× Q solution, 200 μM of each dNTP, 20 ρmol of each primer and HotStar Taq Plus DNA Polymerase (QIAGEN, Hilden, Germany). Amplification included hot-start at 95 °C for 5 min, denaturing at 94 °C for 30 sec, and annealing (at 56 °C for p16 and 50 °C for sFRPs and BAMBI) for 45 sec, elongation at 72 °C for 60 sec for a total of 40 cycles and a final 10 min for extension. Control DNA with known methylated and unmethylated samples was used in each MSP assay to monitor the technical process. PCR products were analyzed by 3% agarose gel electrophoresis and visualized under ultraviolet (UV) illumination. For BAMBI MSP, we had further confirmed the methylation status of BAMBI by nested MSP using the new sets of primers (Fig. 1 and Supplementary Table I). In nested MSP, the 3′ end of the primers used for the first PCR was set to the position of cytosine in the non-CpG locus so that the bisulfite converted DNA for both methylated and unmethylated populations could be amplified. In the second PCR, the 3′ end of the primers was set to the position of cytosine in the CpG locus to selectively amplify either the methylated (M) or the unmethylated (U) DNA. The first PCR amplification included hot-start at 95 °C for 5 min, denaturing at 94 °C for 30 sec, annealing at 57 °C for 45 sec and elongation at 72 °C for 60 sec for a total of 30 cycles and a final 10 min for extension; the nested PCR amplification started with 95 °C for 5 min, denaturing at 94 °C for 30 sec, annealing at 54 °C for 45 sec, elongation at 72 °C for 60 sec for a total of 25 cycles and a final 10 min for extension. The nested PCR products were analyzed by 3% agarose gel electrophoresis and visualized under UV illumination. At the same time, the first PCR product was cloned into the TA vector (Invitrogen, Carlsbad, CA) and at least 10 independent clones were selected and sequenced using ABI PRISM™ 310 Genetic Analyzer (Perkin-Elmer, Norwalk, CT) to confirm the accuracy of nested MSP. Methylation analysis of normal tissues or the nontumorous surrounding urothelium was carried out for each case.

Figure 1.

A schema of the human BAMBI gene promoter region. CpG loci (indicated by vertical lines) are scattered in the 5′-flanking region of the BAMBI gene and form a CpG-island. TATA-box, 3 tandem repeats of SMAD binding elements (3XSBE) and a T-cell transcription factor (Tcf) are shown. Three pairs of primers 120bps for the first PCR and 100bps for nested PCR (horizontal gray arrows) were used for nested methylation-specific PCR. TSS indicates transcription start site.

Immunohistochemistry and Immunocytochemistry

Formalin-fixed, paraffin-embedded tissues from the 74 urinary bladder tumor specimens were deparaffinized in xylene and rehydrated in a series of graded ethanol. Antigens of tissue and cytological slides were then retrieved by microwave treatment at 350 watts for 10 min in 10 mM citrate buffer (pH 6.0). The slides were incubated in a mixture of 3% H2O2 and methanol for 10 min at room temperature to block endogenous peroxidase activity. After treatment with a blocking antibody, the primary antibodies were added and the slides were incubated for 60 min at room temperature. Anti-human BAMBI/NMA antibody (goat IgG) raised against NSO/nonsecreting mouse myeloma cell-derived human BAMBI (aa 1-152) (R&D Systems, Minneapolis, MN), mouse monoclonal anti-human β-catenin (IgG1, kappa) raised against recombinant C-terminal β-catenin-GST fusion protein (DAKO, Carpinteria, CA) and rabbit polyclonal antibody raised against a recombinant protein corresponding to amino acids 466-510 mapping near the carboxy terminus of bone morphogenetic protein receptor type-I, BMPRI(H-45), which was recommended for the detection of BMPRIA and BMPRIB of human origin (Santa Cruz, CA) were used as primary antibodies. Nonimmunized mouse serum was used for preparing negative controls. The streptavidin-biotin-peroxidase complex method was used with a MaxiTags™ kit (ThermoShandon, Pittsburgh, PA). Final development of the sections was carried out with 3,3′-diaminobenzidine containing 0.03% H2O2. Immunohistochemical staining was graded as negative (no staining) and positive (immunoreactive staining) for BAMBI and BMPRI protein expression, and as negative (no staining), membranous and nucleus (immunoreactive staining) for β-catenin protein expression.

Mutation analysis

Genomic DNA containing agarose beads (74 tissue samples) without bisulfite treatment were used for mutational analysis on exon3 of the β-catenin gene. First, nested PCR was done by using the following sets of primers. For the first PCR, 5′-ATTTGATG GAGTTGGACATG GC-3′, sense and 5′-CCAGCTACTTGT TCTTGA GTGAAGG-3′, antisense; for the second PCR, 5′-TGGACATGGCCATGGAACCAG-3′, sense and 5′-TTGTTCTT GAGTGAAG GACTG-3′, antisense.28 DNA (1 μl) was then amplified in a total volume of 25 μl containing 10× CoralLoad PCR buffer, 5× Q solution, 200 μM of each dNTP, 20 ρmol of each primer and HotStar Taq Plus DNA Polymerase. In both PCRs, amplification started with 95 °C for 5 min, denaturing at 94 °C for 30 sec, annealing at 50 °C for 45 sec, elongation at 72 °C for 60 sec for a total of 35 cycles and a final 10 min for extension. PCR products were analyzed by 3% agarose gel electrophoresis and visualized under UV illumination. For mutational screening, single-strand conformation polymorphism analysis was carried out by diluting 5 μl of the PCR product in 30 μl of loading buffer (0.1% bromophenol blue, 0.1% xylene cyanol and 20 mM EDTA in formamide) and then denatured at 80 °C for 5 min. Samples were run on polyacrylamide e-PAGEL electrophoresis and stained with AE-1360 Ez silver stain (ATTO, Tokyo, Japan) according to the manufacturer's protocol. The amplified DNA showing a positive single-strand conformation polymorphism mobility shift band was cloned into the TA Vector (Invitrogen, Carlsbad, CA). At least 10 independent clones were selected and the recombinant plasmids were recovered for DNA sequencing with M13F primer. The sequencing was done by using the ABI PRISM BigDye Terminator v3.1 Cycle Sequencing Kit according to the manufacturer's instructions (Applied Biosystems, Foster City, CA). Samples were run on an ABI prism 310 Genetic Analyzer (Perkin-Elmer, Norwalk, CT).

RNA extraction, quantitative real-time PCR and reverse transcription PCR

Total RNA (1 μg), isolated from each cell line and reverse transcribed to produce cDNA, was then amplified and quantified by the ABI PRISM 7300 Real Time PCR system (Applied Biosystems) using a set of BAMBI primers and probes (assay ID: Hs00180818_m1) and Human 18S primers and probes purchased from Biosearch Tech (Applied Biosystems). The amount of mRNA was quantified relative to that of 18S in each reaction by using the following sets of primers:

  • 18S (forward): 5′d (ATGAGTCCACTTTAAATCCTTTAA CGA) 3′

  • 18S (reverse): 5′d (CTTTAATATACGCTATTGGAGCTGG AA) 3′

  • 18S (probe): 5′FAMd (ATCCATTGGAGGGCAAGTCTGG TGC) BHQ-1 3′

Small interfering RNA transfection

Cells (2 × 105/well) of each bladder cancer cell line were plated in a six-well plate in OPTI-MEM (Invitrogen, Carisbad, CA) containing 10% fetal bovine serum for 24 hr to yield 60–80% confluency. The cell lines were then transiently transfected with BAMBI small interfering RNA (siRNA) or nontargeting (random) siRNA (Ambion, Austin TX) using Silencer™ siRNA Transfection Kit II (Ambion) for 48 hr. Scrambled siRNA was used as a control. After transfection, total RNA was extracted for quantification of BAMBI gene expression and viable cells were counted with a hemocytometer and apoptotic analysis was done by using APOPercentage™ assay (Biocolor, UK). The number of purple-red stained apoptotic cells was counted under a light microscope at ×400 magnification.

Transient transfection studies

The plasmid constructs, pEGFP-N3-hBAMBI (kindly provided by Dr. Tetsu Akiyama) and pGL3 Basic were transfected into the cell lines using Lipofectamine™ LTX Reagent (Invitrogen) according to the manufacturer's instructions. Empty vector was used as a control. First, the bladder cancer cell lines were cultured in 12-well plates for 24 hr to yield 60–80% confluency. The mixture of 1 μl (1 μg) of each plasmid DNA and 1 μl of PLUS™ reagent was then incubated for 5 min at room temperature. Lipofectamine LTX (2.5 μl) was then added to diluted DNA and incubated for 30 min at room temperature. A DNA-lipofectamine complex (200 μl) was added to each well. After 48 hr incubation in 5% CO2 at 37 °C, apoptotic analysis was done by using Annexin V-Cy3 Apoptosis Detection Kit (BioVision, Mountain View, CA). Briefly, the cells were stained with Annexin V-Cy3 solution (1:100 dilution) for 5 min in the dark and analyzed under BZ-9000 BIOREVO fluorescence microscope (KEYENCE, Osaka, Japan). The number of red apoptotic cells/HPF (high power field) under rhodamine filter and yellow to orange pEGFP-N3-hBAMBI expressing apoptotic cells/HPF (high power field) were detected for each cell line.

5-Aza-2′-deoxycytidine (5-aza-dC) treatment

Steady-state BAMBI mRNA expression was examined in HTB9, T24 and KU1 cells with or without 5-aza-dC treatment, while changes in the methylation status of the BAMBI promoter region were monitored by sodium bisulfite mapping. Exponentially growing cells were seeded at a density of 1.5 × 106 cells/60 mm-diameter dish and allowed to attach overnight. The cells were then treated with freshly prepared 1 μM 5-aza-dC (Sigma, St. Louis, MO) (day 0). After 24, 72 and 120 hr (Days 1, 3 and 5), treatment of the cells was continued by changing to a fresh medium containing 5-aza-dC. After 168 hr (Day 7), genomic DNA and total RNA were collected from each dish and purified by standard methods. After confirming through sodium bisulfite mapping that all CpG loci in the BAMBI 5′-flanking region were completely demethylated, RNA was used as a template for semiquantitative reverse transcription (RT)-PCR to evaluate BAMBI mRNA levels.

Cell motility assay

The bladder cancer cell lines were cultured for 24 hr on 3-μm pore PET track-etched membrane inserts that formed the upper chambers of 24-well format cell culture plates (BD) to yield 80–90% confluency. Plasmid constructs pEGFP-N3-hBAMBI and pGL3 Basic were then transfected into the cells, using Lipofectamine LTX Reagent (Invitrogen) according to the manufacturer's instructions. After 48 hr transfection, the cells were treated with freshly prepared 3 μg/ml reconstituted recombinant human TGF-β1 solution (Genzyme/Techne, USA), and incubated in 5% CO2 incubator at 37 °C. The cells were allowed to migrate for 24 hr, and the insert chambers were removed and stained with Giemsa. The membranes were air dried, detached from the inserts and fixed onto microscope slides. The migratory cells on each membrane insert were counted under a light microscope at ×400 magnification. Empty vector was used as a control. A similar procedure was followed for BMP-2-induced cell motility assay with 1 mg/ml of recombinant human (rh) BMP-2 (kindly provided by Astellas Pharma Inc., Tokyo, Japan).

Western blotting

Five human colon and one breast cancer cell lines (COLO201, SW480, HT29, DLD-1, COLO320 and MCF7) were lysed with 1.0 ml of ice-cold lysis buffer [50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 0.2% Nonidet P-40, 0.2% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), and 50 μM/ml aprotinin]. After sonication for 1 min, the lysates were centrifuged at 15,000 rpm (revolutions per minute) for 20 min. The supernatant, equalized by protein concentrations, was separated by 10% SDS-PAGE, transferred to the nylon membrane, Hybond-P (Amersham Biosciences, Piscataway, NJ) and immunoblotted with monoclonal anti-human β-catenin antibodies (DAKO, Carpinteria, CA) against β-actin (BT-560; Biomedical Technologies, Stoughton, MA). Immunocomplexes were visualized by the enhanced chemiluminescence Western blotting system (Amersham) according to the manufacturer's instructions.

Statistical analysis

Statistical analysis was carried out using JMP 7.0/SAS software. Categorical variables from primary bladder tumors from Japanese and Myanmarese cases were plotted into 2 × 2 contingency tables and evaluated using the Chi-square and Fisher's Exact Test. Results of apoptosis and cell motility in cell culture were plotted as mean ± SD and analyzed with Student's t test. All reported p values were two sided and considered significant when p value was <0.05.

Results

Immunohistochemical expression of BAMBI, BMPRI and β-catenin in normal and reactive urothelium

Strong membranous BAMBI staining with occasional nuclear and cytoplasmic staining was observed especially in superficial umbrella cells of the normal urothelial epithelium (Figs. 2a and 2b, arrows) and in almost all layers, including intermediate and basal layers, of the reactive inflammatory urothelial epithelium (Figs. 2d and 2e, arrows). Neither the normal nor the reactive urothelium showed BAMBI methylation (Figs. 2b and 2e, insets). BMPRI protein expression was observed as overlapping with BAMBI expression but seen mostly in the superficial layer (Figs. 2c and 2f, arrows). Although commercially available and widely used for the detection of BMPRIA and BMPRIB of human origin by BMPRI (H-45) immunohistochemistry, we cannot exclude the possibility that this antibody may still cross-react with other similar molecules. The β-catenin expression pattern was mainly linear membranous in both the normal and reactive urothelium (data not shown). Negative controls prepared with nonimmunized mouse serum did not show any significant staining (Supplementary Fig. 4).

Figure 2.

Immunohistochemical analysis of BAMBI and BMPRI protein expression in normal (a, HE, ×400; b and c, IHC, ×400) and inflammatory reactive urothelial cells (d, HE, ×400; e and f, IHC, ×400) with their respective methylation status (MSP) of the BAMBI gene. Membranous BAMBI protein expression with occasional nuclear and cytoplasmic staining is observed in urothelial cells, especially in superficial umbrella cells in the normal urothelial epithelium (arrows, b) and in almost all layers including intermediate and basal layers in the reactive inflammatory urothelial epithelium (arrows, e). No methylation band of the BAMBI gene is observed in either normal or reactive urothelium (insets in b and e). BMPRI protein expression is present especially in superficial urothelial cells of both normal (arrows, c) and reactive urothelium (arrows, f). U and M represent unmethylated and methylated DNA, respectively, of the BAMBI gene. [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

Immunohistochemical expression of BAMBI, BMPRI and β-catenin in primary bladder tumors

The results of immunohistochemical analyses, and epigenetical and genetical studies are summarized in Figure 3. In 44.59% (33/74) of cases, tumor cells showed diffuse and membrano-perinuclear as well as some nuclear localization of BAMBI expression (>25% of cells). On the other hand, BMPRI was expressed in 63.5% (47/74) of cases, and a significant correlation was observed between strong intensity with high percentage (>75%) of BMPRI expression and high-grade bladder tumors (p < 0.0001). A significant correlation was observed between high-grade invasive tumors and the absence of BAMBI immunoexpression (p < 0.0001) with positive BMPRI immunostaining (Table I and Fig. 3). The histopathological and immunohistochemical findings of representative cases are shown in Figure 4. Coexpression of BAMBI and BMPRI was frequently found in low-grade tumors (Figs. 4a4c). In high-grade invasive cancers, a BAMBI-low and BMPRI-high pattern was frequently observed (Figs. 4d4f). The most frequent expression pattern of β-catenin was the membranous 74.3% (55/74), followed by no staining 22.9% (17/74) and then nuclear staining 2.7% (2/74). These two cases with strong nuclear β-catenin staining were high-grade tumors with positive BAMBI and negative BMPRI immunostaining (Figs. 4g4i), had point mutation at the phosphorylation site in exon 3 of the β-catenin gene involving nucleotide change from C:G to T:A transition, and amino acid substitution at codon 40 from threonine to isoleucine (T40I), as revealed by single-strand conformational polymorphism followed by direct sequencing. Negative controls prepared with nonimmunized mouse serum did not show any significant staining for BAMBI, BMPRI or β-catenin (Supplementary Fig. 4).

Figure 3.

Summary of methylation-specific PCR (MSP) analysis of p16, sFRP1, sFRP2, sFRP4, sFRP5 and BAMBI genes; mutational analysis of β-catenin; BMPRI and BAMBI protein expression in the 74 primary bladder carcinomas from Japan (a) and Myanmar (b), and 3 bladder cancer cell lines (c). The promoter region of all genes is frequently methylated in a subset of high-grade primary bladder tumors and bladder cancer cell lines; BAMBI also seems to contribute to the formation of a CpG-island methylator phenotype (CIMP). Obviously, methylation of these genes is more frequent in samples from Myanmar than in those from Japan. The two positive cases of β-catenin mutation are shown with asterisks. IHC: immunohistochemistry; ICC, immunocytochemistry. [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

Figure 4.

Immunohistochemical analysis of BAMBI and BMPRI protein expression in bladder tumors with their respective methylation status (MSP) of the BAMBI gene. Comparison of typical BAMBI staining between low-grade (a, HE, ×400; b, IHC, ×400) and high-grade bladder tumors (d, HE, ×400; e, IHC, ×400) reveals strong BAMBI expression with no BAMBI gene methylation in the low-grade papillary tumor (arrows, b with inset) and no BAMBI expression with hypermethylation of the BAMBI gene in the high-grade papillary tumor (e with inset). In contrast, BMPRI expression is present in superficial urothelial cells of the low-grade papillary tumor (arrows, c, IHC, ×400) and strong expression in the high-grade invasive tumor (arrows, f, IHC, ×400). Occasionally, spindle-shaped fibroblastic cells around cancer cell nest are also positive for BMPRI (asterisks, f). Exceptionally, two samples of high-grade invasive tumor (g, HE, ×400; h and i, IHC, ×400) show strong BAMBI expression without BAMBI gene methylation (arrows, h with inset), and BMPRI expression is absent (i). These two samples bear nuclear accumulation of β-catenin by IHC and mutation at the phosphorylation site by direct sequencing of the SSCP. U and M represent unmethylated and methylated DNA of the BAMBI gene, respectively.

Methylation status of BAMBI, p16 and sFRP genes in primary bladder tumors and in cancer cell lines

To explore whether or not the BAMBI gene is included among CpG-island methylator phenotype (CIMP)-affected genes, the CpG-island methylator phenotype study of bladder cancer needs to be assessed. To fulfill the criteria for CIMP, we analyzed the aberrant methylation of BAMBI, p16 and sFRP genes in primary bladder tumors from Japan (n=41, Fig. 3a) and Myanmar (n=33, Fig. 3b), in three bladder (Fig. 3c) and five colon and one breast cancer cell lines. The prevalence of hypermethylation was 43.24% (32 of 74), 21.62% (16 of 74), 32.43% (24 of 74), 12.16% (9 of 74), 50% (37 of 74) and 31.08% (23 of 74) in p16, sFRP1, sFRP2, sFRP4, sFRP5 and BAMBI, respectively. The hypermethylation of one or more genes was significantly frequent in high-grade and invasive tumors (p = 0.0005 and 0.0024, respectively). Especially, methylation of sFRP2 and BAMBI was significantly correlated with high-grade and invasive tumors (p = 0.003 and 0.0188 for sFRP2 and p = 0.0049 and 0.0315 for BAMBI). Moreover, even in low-grade papillary tumors, the rate of methylation was higher in samples from Myanmar than in those from Japan. The frequent hypermethylation of the BAMBI gene was significantly correlated with negative BAMBI protein immunoexpression (p=0.0002) and high-grade invasive primary bladder tumors (Table II). Promoters of these genes were also frequently hypermethylated in the bladder cancer cell lines, except that there was no methylation of p16 in HTB9 and KU1, of sFRP5 in T24 or of BAMBI in KU1 (Fig. 3c). In contrast, hypermethylation of the BAMBI promoter region was not found in any of the five colon and one breast cancer cell lines tested (data not shown). For BAMBI MSP, bisulfite sequencing data clearly reflected the MSP results: the DNA samples from cases with positive MSP showed high frequency of CpG methylation and, conversely, DNA samples from negative MSP cases revealed a low rate of or no CpG methylation.

Table II. Association of BAMBI Gene Hypermethylation with High-Grade Invasive Pattern in Primary Bladder Tumors
BAMBI methylation statusGradeInvasion
High, n (%)Low, n (%)pPresent, n (%)Absent, n (%)p
  1. n indicates number of cases.

Positive20 (27.03)3 (4.05)0.004917 (22.97)6 (8.11)0.0315
Negative27 (36.49)24 (32.43) 24 (32.43)27 (36.49) 

Restoration of BAMBI expression with 5-aza-2′-deoxycytidine treatment in bladder cancer cell lines and its positive correlation with β-catenin in colon and breast cancer cell lines

We found that the inhibition of DNA methylation with 5-aza-dC treatment for 7 days restored the expression of BAMBI mRNA significantly in T24 and HTB9 bladder cancer cell lines (p = 0.049 and 0.0130, respectively) (Fig. 5a); in KU1, however, where no BAMBI promoter methylation was detected, no significant difference was observed in the expression of the mRNA transcript before and after 5-aza-dC treatment (Fig. 5a, middle). On the other hand, reflecting the fact that BAMBI gene expression is controlled by β-catenin and TGF-β/BMP signaling,18, 22 the steady-state expression level of the BAMBI gene was almost parallel to that of β-catenin in cell lines without hypermethylation of the BAMBI gene promoter (Fig. 5b).

Figure 5.

Expression of BAMBI in bladder cancer, colon and breast cancer cell lines. (a) BAMBI expression was analyzed by real time RT-PCR in bladder cancer cell lines (T24, KU1 and HTB9) before and after the treatment with 5-aza-dC. Before the treatment, steady-state BAMBI mRNA expression was highest in KU1, lower in T24 and relatively lowest in HTB9. The cells were treated with 1 μM of 5′-aza-dC for 7 days and isolated RNA was amplified by RT-PCR. After the treatment, BAMBI expression increased significantly in T24 and HTB9. 18S ribosomal RNA was used as a control for RNA integrity. Bars indicate mean ± SD of 6 independent samples (*p < 0.05). The results of MSP of each cell line before and after 5′-aza-dC treatment are shown. U and M represent unmethylated and methylated BAMBI gene promoter, respectively. (b) The steady-state BAMBI mRNA expression of colon and breast cancer cell lines (COLO201, SW480, HT29, DLD-1, COLO320 and MCF7) and positive correlation with their respective β-catenin protein expression by Western blot. β-actin was used as control. None of the colon cancer cell lines revealed BAMBI promoter methylation (data not shown).

Effect of knock-down of BAMBI gene by small interfering RNA on apoptosis and cell motility in bladder cancer cell lines

Small interfering RNA (siRNA)-mediated knock-down studies of BAMBI in T24, HTB9 and KU1 revealed that BAMBI siRNA effectively suppressed BAMBI mRNA expression by at least 40% compared with that of its control, as determined by RT-PCR (Fig. 6a). Although a slight decrease in the apoptotic count by siRNA transfection was observed in HTB9, BAMBI knock-down did not have much effect on the number of apoptotic cells (Fig. 6b). Cell motility assays also revealed no effect on the cell motility of any of the three cell lines. Also, there was no significant change in viable cell count by hemocytometer (data not shown).

Figure 6.

siRNA-mediated knock-down of BAMBI expression. (a) RT-PCR of BAMBI expression in T24, KU1 and HTB9 after the treatment with BAMBI siRNA (BAMBI) or with nonspecific control (NS) for 48 hours. BAMBI expression levels are significantly reduced in all bladder cancer cell lines after siRNA treatment. The level of 18S ribosomal RNA expression was used to standardize BAMBI expression. (B) Effect of siRNA-mediated knock-down of BAMBI on apoptotic cell count of the 3 cell lines. Typical photographic demonstration of red-purple stained apoptotic cells in BAMBI- (+) and control-siRNA treated (NS) cell lines. Although a slight decrease in apoptotic cell count by siRNA transfection was observed in HTB9, BAMBI knock-down did not have much effect on the number of apoptotic cells. Cell lines treated with nonspecific siRNA showed no significant effect on apoptotic count. Bars indicate mean ± SD of 6 independent samples. [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

Overexpression of BAMBI enhances apoptosis and reduces TGF-β1/BMP-2 induced cell motility in bladder cancer cell lines

After transfection with pEGFP-N3-hBAMBI for 48 hr, the number and intensity of green fluorescent cells (about 60%) was almost evenly observed in the 3 cell lines. Annexin V-Cy3 apoptosis assay revealed that the number of yellow to orange apoptotic cells expressing pEGFP-N3-hBAMBI was slightly but significantly higher in T24, but not in KU1 or HTB9, than in mock-transfected control (Figs. 7a and 7b). Cell motility assay, on the other hand, revealed that after 24 hr treatment with TGF-β1 or BMP-2, T24 and HTB9 cells showed a marked increase in the number of migrated cells that decreased significantly through the forced expression of BAMBI by the transfection of the pEGFP-N3-hBAMBI expression vector in cell lines T24 and HTB9 (p < 0.05). By contrast, TGF-β1 and BMP-2 had no effect on the motility of KU1 cells (Figs. 7c and 7d).

Figure 7.

Effect of restored expression of the BAMBI gene on apoptotic cell count and TGF-β-induced and BMP-2-induced cell migration in T24, KU1 and HTB9 bladder cancer cell lines. (a) After transient transfection with either pEGFP-N3-hBAMBI (BAMBI) or control vector (Mock), the number of apoptotic cells was evaluated and plotted after staining with Annexin V-Cy3. Mean ± SD of 6 independent samples is shown. A slight but significant increase in the apoptotic count is observed in T24 (*p < 0.05), but not in KU1 or HTB9. Mock-transfected cell lines showed no effect on apoptotic count. (b) A typical photographic demonstration of pEGFP-N3-hBAMBI expression and apoptotic cells. Restored BAMBI expression is represented by green fluorescence in each bladder cancer cell line. After staining with Annexin V-Cy3, apoptotic cells show red fluorescence, and pEGFP-N3-hBAMBI-expressing apoptotic cells reveal yellow to orange fluorescence (white arrows) with some nonapoptotic green fluorescent part remaining in each bladder cancer cell line. (c and d) The in vitro migratory behavior of cells transiently transfected with pEGFP-N3-hBAMBI or with control vector (Mock) was assessed in the presence of 3 μg/ml reconstituted recombinant human TGF β-1 containing culture media (C) and 1 mg/ml of recombinant human (rh) BMP-2 containing culture media (D) for 24 hr. The number of migrated cells per square millimeter was evaluated and plotted. Mean ± SD of 12 independent samples is shown. TGF-β-1-induced and BMP-2-induced cell migration was significantly reduced in pEGFP-N3-hBAMBI expressed T24 and HTB9 bladder cancer cell lines (*p < 0.05). Mock shows no effect on TGF-β-1/BMP2-induced cell migration in any of the cell lines.

Discussion

Using our hospital-based bladder cancer cases from Japan and Myanmar, we examined histopathologically, the prevalence of epigenetic alterations, especially the silencing of particular genes by hypermethylation, as biological markers for bladder cancer.

So far numerous genetical alterations including the activation of oncogenes like HRAS,29MYC,30CCND1,31FGFR332 and E2F3,33 and alternatively the silencing of tumor suppressor genes like TP53, RB134 and p1635 are reported to occur and to be linked to carcinogenesis and tumor progression in bladder tumors.36 On the other hand, there is substantial evidence for the role of epigenetic silencing of genes by promoter hypermethylation in urinary bladder carcinogenesis (e.g., p16, sFRP, E-cadherin, DAPK and RASSF1A),37–44 indicating that both genetical and epigenetical alterations contribute to bladder tumor development through multiple or stepwise carcinogenesis, as well as to the diversity of cancer cells in later progression stages.36–43 Recently, a distinct group of cancers carrying frequent DNA hypermethylation on CpG-islands has been identified and designated as a CIMP in a certain subset of colorectal and stomach malignancies.45–47 In addition, Dr. Issa's group has reported in their colon cancer studies, that CIMP can be subclassified into cases with microsatellite instability and BRAF mutation (CIMP1) and with somatic KRAS mutation and rare microsatellite instability (CIMP2).48

Although there are some contradictory opinions regarding the concept of CIMP, a distinct subset of cancers, other than gastrointestinal malignancy with frequent DNA hypermethylation on CpG-islands, has also been linked to specific genetical alterations or clinicopathological features.49–51 In bladder cancers, a certain subset has increased methylation of CpG-islands relative to its normal counterpart suggesting the occurrence of a hypermethylator phenotype in which multiple independent CpG-islands become concurrently methylated in individual tumors in a process associated with tumor progression. The fact that the greater the number of methylated CpG-islands, the more aggressive the cancer suggests that these subsets of tumors should be categorized as methylator phenotypes. Moreover, distinct histopathological features of either a flat carcinoma in situ or a nodular invasive carcinoma was correlated with hypermethylation of multiple CpG-islands associated with increased DNA methyltransferase dnmt1 (a key enzyme controlling maintenance methylation), indicating that overexpression of dnmt1 may be an important and one of the early events that lead to the development of high-grade invasive bladder carcinoma of the CIMP type.43, 52, 53 Taken together, CIMP may be a secondary event resulting from preceding genetical alterations that ultimately cause increased activity of dnmt1 or of other enzymes with de novo DNA methyltransferase.49, 50 It is still unclear, however, whether such secondarily augmented methyltransferase activity, maintenance or de novo, triggers hypermethylation of multiple CpG-islands in a promoter-specific or nonspecific manner.

Consistent with previous reports,43, 52, 53 we also observed that a certain group of high-grade bladder cancers with invasive growth patterns from Japan and Myanmar, and bladder cancer cell lines carried frequent hypermethylation of multiple gene promoters (Figs. 3a3c). Although genetic alteration of β-catenin is rare in bladder cancer,54 epigenetic inactivation of sFRPs, secreted antagonists of Wnt signaling, is responsible for the invasive phenotype of bladder cancer.43 Since hypermethylation of the BAMBI gene was frequently associated with hypermethylation of p16 tumor suppressor gene (one of the most frequently silenced genes in CIMP), and Wnt-related genes sFRP1, sFRP2, sFRP4 and sFRP5, and thus BAMBI can be regarded as a member of CIMP-affected genes in high-grade bladder cancer. Previous studies have reported that Wnt/β-catenin signaling activates the transcription of BAMBI, and that BAMBI expression is aberrantly elevated in most colorectal carcinomas reflecting the activation status of β-catenin.18, 22 We also confirmed that BAMBI gene promoter hypermethylation was not observed and positive correlation of its expression with β-catenin in either the 9 CIMP-high clinical samples or the 5 colorectal and 1 breast cancer cell lines tested (data not shown). Moreover, inactivation or blockage of the TGF-β/BMP signaling pathway in colon epithelium is one of the important initial steps in carcinogenesis, and TGF-β/BMP signaling serves mostly as an inhibitory factor for growth and survival throughout the progression of colorectal cancer. Continuous BAMBI expression due to activated β-catenin (through the direct binding of TCF/LEF transcription factor to BAMBI promoter region) or TGF-β/BMP signaling itself (through the evolutionary conserved BMP-responsive elements in BAMBI promoter, by the direct binding of SMAD3 and SMAD4 to its promoter region) favors the growth and survival of colorectal cancer cells by acting as a negative feedback system against TGF-β/BMP signaling.18, 19, 22, 55 It follows, therefore, that colorectal cancer cells expressing the BAMBI gene with hypomethylation of the BAMBI gene promoter have a better chance of surviving in the tumor microenvironment. To the contrary, the effect of the TGF-β/BMP signaling pathway at later progression stages in some aggressive tumors, such as in malignant melanoma,56 ovarian57 and bladder cancers,58, 59 often promotes cancer cell invasion and migration by inducing EMT in an autocrine and paracrine manner. We speculate, therefore, that the choice of hypermethylated genes in CIMP is more a flexible than a rigid phenomenon resulting from a clonal selection of the specific tumor cell type according to the tumor microenvironment.

In the normal or reactive urothelium, on the other hand, immunohistochemical localization of BAMBI expression was mostly overlapped with that of BMPRI (Fig. 2), supporting a previous report17 that BAMBI may be physiologically important as a direct fine-tuner of TGF-β/BMP by counteracting and bufferizing its activity, and thereby, keeping its signal transduction within a limited range. Among cases of low-grade papillary noninvasive urothelial cancer, because the immunohistochemical colocalization pattern of BAMBI and BMPRI was similar to that of the normal and reactive urothelium (Figs. 4a4c), such physiological bufferizing action of BAMBI may remain functionally intact in such low-grade cancers. In high-grade and invasive cancers, however, 2 reciprocal immunohistochemical expression patterns were mainly observed between BAMBI and BMPRI (Figs. 4d4i): BAMBI-low and BMPRI-high, and BAMBI-high and BMPRI-low, indicating that BAMBI expression is controlled such that it does not interfere with cellular demand for TGF-β/BMP signaling defined by the authentic level of TGF-β/BMP receptors. Taken together with the fact that the role of TGF-β/BMP signaling in cancer is both tumor suppressive and progressive according to the difference of intercellular signal transduction systems followed by the activation of authentic receptors, we speculate that when cancer cells need to be irresponsive to tumor-suppressive TGF-β/BMP signaling, BAMBI expression is kept high while authentic receptors for TGF-β/BMP are kept low to accomplish full blocking. Conversely, when TGF-β/BMP signaling is favorable for cancer cell survival or motility, cells with suppressed BAMBI expression by promoter hypermethylation have a better chance to survive. To support this hypothesis, in the BAMBI high and BMPRI low KU1 cell, where epidermal growth factor (EGF) stimulates anchorage-independent growth through the amplified and overexpressed its cognate receptor (EGFR),60, 61 TGF-β stimulation showed almost no effect on cell motility (Fig. 7c). On the other hand, in BAMBI low and BMPRI high bladder cancer cell lines T24 and HTB9, TGF-β treatment enhanced cell motility, which was significantly suppressed by forced BAMBI expression (Fig. 7c). Together with case studies from Japan and Myanmar, these results of bladder cancer cell lines indicate that among high-grade bladder cancers at least 2 types can be differentiated in response to TGF-β/BMP signaling: one with irresponsive to TGF-β/BMP and the other in which TGF-β/BMP signaling positively promotes the aggressive character of the tumor cells. This differentiation may be useful for future therapeutic strategy based on epigenetics.

In conclusion, since certain subsets of aggressive tumors often promote cell motility, invasion and survival (e.g., EMT) by TGF-β/BMP signaling, BAMBI gene suppression by promoter hypermethylation with negative BAMBI immunoexpression may be one of the important epigenetic events affecting the invasiveness or aggressiveness of bladder cancers.

Acknowledgements

The authors thank Mr. Shuichi Matsuda, Ms. Noriko Sakamoto and Ms. Miki Zenigami for their excellent technical assistance.

Ancillary