SEARCH

SEARCH BY CITATION

Keywords:

  • endometrial cancer;
  • animal model;
  • orthotopic implantation;
  • metastasis;
  • RUNX1

Abstract

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. References

Endometrial carcinoma is the most common malignancy of the female genital tract in industrialized countries. Metastasis is the major cause of endometrial cancer deaths. Therefore, there is a vital need for clinically relevant in vivo models allowing the elucidation of the molecular and cellular mechanisms underlying metastatic behavior. In this study, we describe an innovative experimental orthotopic model of human endometrial carcinoma. Implantation in the bifurcation of the uterine horns resulted in tumors integrated into the myometrial compartment, which can be used and further exploited for the study of in vivo angiogenesis, myometrial invasion, and the metastatic capacity of endometrial cancer cells. This orthotopic model also represents a suitable tool to analyze how tumorigenesis and distant metastasis of endometrial cancer might be influenced by gene alteration, by modulating its expression in the original cancer cell line. One of the candidate genes implicated in endometrial cancer is the transcription factor RUNX1. The over-expression of RUNX1 in the endometrial cancer cell line HEC1A and the transplantation of these cells to the uterus of nude mice were associated specifically with distant metastasis in the lung. RUNX1 plays a role in the establishment of metastases in endometrial cancer. Translated to the clinics, these models would be equivalent to an advanced undifferentiated carcinoma with node affectation (stage IIIC) and distant metastasis (stage IVB). These patients would be candidates for adjuvant therapy, not efficient until today, and therefore, our models are actually suitable for the design and evaluation of experimental therapies. © 2009 UICC

Endometrial carcinoma is the most frequently diagnosed malignancy of the female genital tract in industrialized countries. Its incidence is estimated at 15–20 of 100,000 women per year. Overall, 90% of the cases are sporadic whereas the remaining 10% arise from a genetic background. Approximately, 80% of the cases are diagnosed at the FIGO stage I, because of early clinical signs (peri- and post-menopausal metrorrhagia). They are usually well to moderately differentiated endometrioid adenocarcinomas, which are confined to the uterine corpus at diagnosis, and thus, most can be cured. Notwithstanding the excellent prognosis, myometrial infiltration and particularly distant metastasis are the most devastating points in EC; approximately 25% of the patients who have undergone surgical staging are found to have extra-uterine disease.1, 2 Since endometrial carcinoma spreads primarily to the pelvic and para-aortic lymph nodes, as well as to adnexa and pelvic viscera, distant metastases via the hematogenous route have a low incidence. Even so, pulmonary metastases, which usually occur via the hematogenous route, have been reported to be one of the most common distant metastasis stemming from endometrial carcinoma. However, its incidence ranges from 2.3 to 4.6%.3, 4 The precise molecular events that occur during the development, progression/invasion and formation of metastasis in endometrial carcinoma are largely uncharacterized and are still relatively poorly understood.5–8

Experimental models based on human endometrial adenocarcinoma cells are widely used; the existing animal-derived models mainly use subcutaneous xenografts, injecting tumor cells into the subcutis of nude rodents.9 Although there is evidence that these models can predict clinical efficacy, they still have significant limitations, which make the development of more complex models desirable. The subcutaneous tumor model, for example, often causes central tumor necrosis because of the low blood supply in the subcutaneous tissue. They normally show solitary tumor growth without invasion, because of the lack of surrounding visceral organs and, also, due to the unusual tissue compartment (the subcutis) where tumor growth occurs. Finally, and most importantly, they show a lack of metastatic behavior, which is most closely linked to clinical outcome and the most important cause of death from cancer.

A step toward the development of more complex models was first described in 1984 by Sordat and Wang10 in colon cancer. Later Fidler et al.11, 12 observed that the orthotopic injection of suspensions of human tumor cells in the corresponding organs of nude mice can enhance their metastatic capability. Similar results have also been achieved with the orthotopic implantation of cell lines from human lung cancer, pancreatic cancer, bladder cancer, ovarian cancer, colon cancer and stomach cancer.13 However, recent reports have indicated that cell suspensions used for orthotopic implantation may not express the full metastatic potential of the original tumor.14, 15 To address this problem, surgical orthotopic implantation of histologically intact tissue is currently being widely used, maintaining a three-dimensional tissue architecture, cell-to-cell interactions and subsequent tumor angiogenesis, which all seem to be important to metastatic behavior.14–16 The biological characteristics of these models, such as improved tumor take and invasive and metastatic properties are now well established.

Although an animal model of endometrial cancer, such as the subcutaneous implantation of endometrial cancer cells in a xenograft model, has been used in experimental oncology, there has been no report of an appropriate orthotopic endometrial cancer model. A surgical orthotopic implantation animal model of endometrial cancer, which reflects invasion and metastatic capacity, must still be established. The conditions that cause myometrial invasion, cellular dissemination to vessels, and finally, distant metastasis, as well as how these processes are influenced by gene expression, remain to be elucidated.

One of the candidate genes implicated in endometrial cancer and metastasis is the transcription factor RUNX1. It belongs to the RUNX family of transcription factors encoded by three genes, RUNX1, RUNX2 and RUNX3.17, 18 The RUNX genes are closely related to each other and are essential for hematopoiesis, osteogenesis and neurogenesis, but they are also important for other developmental processes.19 They bind DNA as heterodimers with the non-DNA binding protein core binding factor (CBF)β, creating a RUNX/CBFβ complex, termed CBF.20 The RUNX proteins bind to the consensus DNA site (TGT/CGGT) via the runt homology domain (rhd), and they function as both transcriptional activators and repressors, depending upon promoter and cellular context.21, 22 RUNX1 is of special interest in EEC, because myometrial affectation, as the initial event in tumor invasion, and distant dissemination determine an increase in the rate of recurrence after a first surgical treatment and a decrease in survival at the 5-year follow-up.8, 23

This article reports an orthotopic endometrial cancer model with node metastases in nude mice using a human endometrial cancer cell line, since the interpretation of experiments using subcutaneously implanted endometrial tumors is limited, due to different tissue-specific factors. By modulating RUNX1 expression, in addition to addressing in vivo invasion and the metastatic capacity of endometrial cancer cells, we investigated how these processes are influenced by gene expression.

Material and methods

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. References

Cell lines, constructs and stable transfection

Human endometrial carcinoma 1A (HEC1A) cell line was cultured as described.7 pEGFP-C2 vector was purchased from BD Biosciences (Franklin Lakes, NJ). Plasmid construction consisted of the full-length human RUNX1 being removed with EcoRI from a pSV-hRUNX1 construct; it was then inserted at the EcoRI position at the multiple cloning site of the pEGFP-C2 vector. The correct orientation and reading frame were confirmed by sequencing.

Stable HEC1A cell lines were either transfected with the pEGFP-C2 vector alone or the hRUNX1 containing pEGFP-C2 vector. Stably expressing cells were selected by incubation with 500 μg/ml of geneticin G-418 sulphate (GIBCO, Invitrogen, Carlsbad, CA).

Animals and tumor implantation procedure

Athymic Swiss Webster mice, 5-week-old female (Charles River Laboratories, Wilmington, MA), were used for this study. The animals were housed in individually ventilated cage units and were maintained under pathogen-free conditions. Food and water were provided ad libitum. Animal care and experiments were carried out in accordance with the guidelines of the Spanish Council on Animal Care and the Institutional Review Board.

Subcutaneous xenografts were established by the injection of 2 × 106 HEC1A (H), HEC1A/GFP (HG) and HEC1A/GFP/RUNX1 (HGR) tumor cells in 200 μl PSB into the subscapular region of 12 nude mice (for each cell line). The animals were killed at 6 weeks. Primary tumors were subcutaneously transplanted to other nude mice for a second passage, to amplify tumor tissue.

For orthotopic implantation, 24 nude mice were anesthetized with intraperitoneal 1.25% sodium pentobarbital (45 mg/kg), and the lower abdomen and back were swabbed with 70% alcohol. A longitudinal incision of the lower abdomen of about 15–20 mm in length was made (medial laparotomy). The retroperitoneum was then opened and the uterus visualized and individualized.

One tissue block of approximately 1 mm3 was implanted onto the posterior face of the uterus making a pocket and fixed with a 5–0 surgical suture to isolate tumor tissue from the rest of the organs in the abdominal cavity. The organs were reintroduced into the abdominal cavity and the retroperitoneum and skin were then closed with a 5–0 surgical suture.

Six weeks later, the animals were killed by cervical dislocation for necropsy. Then, for all of the animals, the peritoneal cavity was opened and examined macroscopically. Samples of the lungs, brains and tumors were snap-frozen in liquid nitrogen for RNA extraction. The remaining tissue was formalin-fixed and processed for routine histological examination, hematoxylin–eosin (H&E) staining and immunohistochemistry (IHC).

Immunohistochemistry

Immunohistochemical staining was performed on 24 hr formalin fixed paraffin-embedded 4 μm sections using routine procedures. All stainings were semiautomated and performed on a TechMate 500 plus (DAKO, Glostrup, Denmark) by using the DAKO Envision+ Detection Kit, as recommended by the manufacturer.

Primary monoclonal antibodies, clones, and dilutions were as follows: β-catenin (βcatenin-1), 1:200; ERα-receptor (1D5), 1:400; PR-receptor (PgR636), 1:400; HER2/NEU (A0485), 1:350; PTEN (6H2.1), 1:100; Ki-67 antigen (MIB-1), 1:100; p53 (DO-7), 1:75; Factor VIII (rabbit polyclonal antibody), 1:320, RUNX1 1:50. All antibodies were from DAKO, except RUNX1 (Santa Cruz).

The deparaffinized tissue sections were treated with heat before the IHC staining procedure for epitope retrieval by immersion of tissue sections in citrate buffer pH 6.0 in an autoclave at 121°C for 1 min.

Detection of disseminated tumor cells by RT-PCR

The extraction of total RNA from the frozen tumor samples, weighing approximately 20 mg, was performed using the Rneasy Mini kit (Qiagen, Hilden, Germany), and 1 μg of the total RNA was subjected to one-step RT-PCR (Qiagen), according to the manufacturer's protocol.

PCR detection of tumoral cells was based on the amplification of the β2-microglobulin gene (β2-m) as a marker for cells of human origin. Polymerase chain reaction was performed using forward primer β2-m: CCATCCGACATTGAAGTTGA and reverse primer β2-m: TGGAGCAACCTGCTCAGATA (annealing temperature 57°C, 35 cycles). PCR detection was normalized with GAPDH, forward primer GAPDH: 5′-CGTCTTCACCACCATGGAGA-3′ and reverse primer GAPDH: 5′-CGGCCATCACGCCACAGTTT-3′ (annealing temperature 61°C, 27 cycles). All primers were obtained from Thermo Electron Corporation (Waltham, MA).

Results

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. References

Orthotopic tumor grafting generated a clinically relevant endometrial cancer model

The generation of an orthotopic model for endometrial cancer, by surgical implantation in the uterus of a subcutaneous tumor, is described in Figure 1. Primary tumors were derived from the injection of 2 × 106 HEC1A tumor cells, derived from an adenocarcinoma of the endometrium (Fig. 1a), in 200 μl PSB into the flank region of nude mice (Fig. 1b). The tumor volume doubling time was approximately 7 days and, similar to the original HEC1A cell line, the HEC1A xenografts were poorly differentiated, generally lacking glandular differentiation (data not shown).

thumbnail image

Figure 1. Establishing an orthotopic metastatic endometrial cancer model. The human endometrial cancer cell line HEC1A was injected subcutaneously in female nude mice. After successful tumor development, pieces of tumor tissue were regrafted onto the posterior face of the uterus of nude mice and orthotopic tumors were generated. HEC1A cells in culture (a). Subcutaneous tumor (arrow), 6 weeks after injection of 2 × 106 HEC1A cells in the flank of the mice (b). Macroscopic view of the subcutaneous tumor (c). Visualized uterus and bladder for orthotopic implantation (d). Implantation of a tissue block of approximately 1 mm3 on the bifurcation of the uterine horns at the posterior face of the uterus with a 5–0 surgical suture (arrowhead for implantation area; arrow for implanted tumor (e,f). Overview of the orthotopic tumor generated in situ, 6 weeks after implantation (g). Extracted tumor in the uterine bifurcation with neovasculation. Ovaries are shown at the tip of the uterus (h). Cross-section of the orthotopic tumor showing direct interaction with the uterus of the mouse (i). [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

Download figure to PowerPoint

As can be observed macroscopically, the subcutaneous tumors grew encapsulated and, although superficial vascularization demonstrated a response of the host to the tumor, no evident interaction with the environment could be described (Fig. 1c). To overcome this limitation and to try to develop a more clinically relevant model, we implanted the endometrial tumor into the uterus context. To this purpose, nude mice were anesthetized with intraperitoneal 1.25% sodium pentobarbital (45 mg/kg), and a longitudinal incision of the lower abdomen of about 15–20 mm in length was made (medial laparotomy). The retroperitoneum was then opened and the uterus visualized and individualized. One tissue block from the subcutaneous tumor of approximately 1 mm3 was implanted onto the posterior face of the uterus making a pocket (Figs. 1d,1e) and fixed with a 5–0 surgical suture to isolate tumor tissue from the rest of the organs in the abdominal cavity (Fig. 1f). The organs were reintroduced into the abdominal cavity, and the retroperitoneum and skin were then closed with a 5–0 surgical suture. Six weeks later, the animals were killed by cervical dislocation for necropsy, and the peritoneal cavity was opened and examined macroscopically. The grafting of approximately 1 mm3 of HEC1A subcutaneous xenograft into the posterior face of the uterus of nude mice produced tumor take rates of 96% (n = 24). As can be observed, orthotopic tumors grew in the area of implantation in the uterus, without affecting other organs or the peritoneum (Fig. 1g). Of interest, the macroscopic examination indicated a close direct contact with the host tissue and suggests a contribution from the microenvironment to the development of the tumor (Figs. 1h1i).

Furthermore, we speculated that in this model the hypothetical dissemination of tumor cells arose through the same mechanisms that human endometrial cancer cells make use of to metastasize (i.e., myometrial invasion, angiogenesis). To confirm this hypothesis, tumor tissue was formalin-fixed and processed for histological examination by H&E staining and immunohistochemistry. First, the grafts showed poorly differentiated features and the local invasion of the hosts' uterine tissue (see Figs. 2a2c). The histology of the mice uteri showed both myometrial infiltration (Figs. 2a,2b) and vascular invasion (Fig. 2c). The latter was confirmed by staining the endothelial cells lining the lumen of vessels with anti-Factor VIII (Fig. 2d).

thumbnail image

Figure 2. Histological characterization of the orthotopic endometrial cancer model. General view of the H&E ×20 (a), ×100 (bd), showing orthotopic grafts of HEC1A poorly differentiated and lacking glandular differentiation, in direct contact and interaction with the uterus of the mice at the area of implantation. E, endometrium; T, tumor; M, myometrium. (a) Implanted neoplastic cells infiltrate the mouse myometrium (b) and vessels (arrow; c). Further confirmation of endothelial cells lining the lumen of vessels stained with F-VIII showing vascular invasion (arrow), with negative stained tumor cells inside the vessel (d). Magnification: ×100. [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

Download figure to PowerPoint

Second, none of the tumors expressed estrogen receptor alpha and progesterone receptor, whereas a nuclear staining pattern in the circumventing myometrium of the mice was observed (Fig. 3; upper left panel). An adjacent section stained positively with Ki-67, showing a nuclear staining pattern in the tumor, though negative in the uterus (Fig. 3; upper middle panel). Tumoral cells showed p53 nuclear staining. Normal endometrial cells did not show immunoreactivity for p53 (Fig. 3; upper right panel). Furthermore, the orthotopic grafts intensely expressed β-catenin (Fig. 3; lower left panel) and HER2/neu (Fig. 3; lower middle panel) with a focal labeling of the cell membranes and also positive staining in the normal endometrium (data not shown). At last, PTEN immunoreactivity was shown in the tumor and normal endometrium (Fig. 3; lower right panel), in accordance with the described expression levels of PTEN in the HEC1A cells that originated the tumors.

thumbnail image

Figure 3. Immunohistochemical characterization of the orthotopic endometrial cancer model. Anti-estrogen receptor alpha showing negative staining in tumor and nuclear staining pattern in circumventing myometrium (upper left). Nuclear immunoreactivity of tumoral cells for Ki-67 (upper middle) and p53 with lack of immunoreactivity in normal endometrium (upper right). Membrane immunoreactivity of tumoral cells for β-catenin, intense (lower left), and HER2/neu, focal (lower middle). Note intense immunoreactivity for HER2/neu in cytoplasm of normal endometrial glands. Finally, PTEN immunohistochemistry showed positive staining both in normal endometrium and the orthotopic tumor (lower right). [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

Download figure to PowerPoint

All of this data points to an orthotopic endometrial cancer model showing the characteristics of an aggressive tumor with high levels of ki67 and p53 and low levels of hormone receptors.

Orthotopic xenografts developed metastases to paraaortic lymph nodes

Once demonstrated that the orthotopic endometrial cancer model behaved as human carcinomas in myometrial invasion and vascular dissemination, we analyzed whether the pattern of metastasis also reproduced the one usually present in the clinics, i.e., lymph node affectation. Orthotopically implanted mice developed metastases to para-aortic nodes in 75% of the cases (9 out of 12 grafts). Lymph node lesions had histological and cytological features of the original tumor cells, including a solid growth pattern, moderately pale to clear cytoplasm, and oval nuclei and nucleoli (Fig. 4).

thumbnail image

Figure 4. Metastasis to paraaortic lymph nodes. General view (a) and detail (b) showing a metastasis (arrow) within a lymph node with histological similarities to the parental xenografts (see Fig. 2). [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

Download figure to PowerPoint

These results confirmed this orthotopic model to be a clinically relevant model for endometrial cancer.

Over-expression of RUNX1 resulted in orthotopic xenografts developing distant micrometastasis

Once we characterized the orthotopic animal model for endometrial cancer as suitable for the study of molecular and cellular events related to the early steps of invasion, tumor dissemination and metastasis, we sought to evaluate the contribution of RUNX1 over-expression to this process. We first observed that the orthotopic tumors, which originated from the HEC1A cells that over-expressed RUNX1, behaved as those that originated from the untransfected HEC1A cells or from cells transfected with the empty vector, in myometrial infiltration, vascular invasion, or for the pattern of expression of the different immunohistochemistry markers described above (data not shown).

We then evaluated the promotion of distant metastasis. To detect the presence of disseminated tumor cells in a sensitive and reproducible manner, which could eventually be established as micrometastases in the dissected tissues, we analyzed the expression of the human specific β2-microglobulin and GFP (data not shown) as a marker for maintenance of the RUNX1 overexpression by RT-PCR (see “Material and methods”). Only the cDNA coding for these genes from the human tumor cells implanted in the host tissues, and not the homologous genes of murine origin, were amplified (see tumor and brain in Fig. 5a, as human positive and murine negative controls, respectively).

thumbnail image

Figure 5. Distant metastasis in the HEC1A-GFP-RUNX1 orthotopic model. Amplification of a 414bp fragment of the β2-microglobulin gene and 300 bp fragment of GAPDH gene. Tumor and brain were used as positive and negative controls, respectively. The percentage of animals positive for the presence of metastatic cells in the lungs is shown for the three different orthotopic models (a). H&E sections of lung metastases from orthotopically engrafted HEC1A-GFP-RUNX1 human endometrial cancer tissue. Tumor cells are present in the lung parenchyma and inside vessels (b, left panel, ×400 magnification). Sections of HEC1A-GFP-RUNX1 lung metastasis staining intense with anti-human Ki-67 antibody (c, upper right), which shows a nuclear staining pattern in tumor, whereas the host's lung parenchyma cells are negative. p53 positive staining in a group of intravascular tumor cells, positive in metastatic foci (c, upper left); the host's lung parenchyma cells are negative (H&E ×100). RUNX1 antibody (c, lower), which shows a nuclear staining pattern in the tumor (H&E ×200). [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

Download figure to PowerPoint

We analyzed the lung as the main receptor of metastasis in endometrial cancer at the experimental end point of 6 weeks, and the results of the RT-PCR detection of tumor cells are shown in Fig. 5. All mice orthotopically bearing tumors from the RUNX1 over-expressing HEC1A cells were considered positive for the presence of disseminated tumor cells in the lungs, whereas only two out of eight of the HEC1A mice and one out of eight of the HEC1A-GFP mice were found to be positive in the lungs. The brains and tumors were tested for the presence of disseminated tumor cells as negative tissues and positive β2-microglobulin controls, respectively (Fig. 5a).

These results were confirmed by immunohistochemistry. Tumors originating from the RUNX1 over-expressing HEC1A cells developed micrometastases to the lungs (Fig. 5b), whereas control mice showed normal lung histology (data not shown). Lung lesions caused by RUNX1 had histological and cytological features of the original tumor cells, including a solid growth pattern, moderately pale to clear cytoplasm, and oval nuclei and nucleoli (Fig. 5b). Similar to the histological results, immunohistochemistry with human-specific RUNX1, Ki-67 and p53 detected specific expression in the lung lesions. Ki-67 showed an intense positive staining in intravascular tumor cells (Fig. 5c). A positive staining of p53 was detected in a group of intravascular tumor cells and was positive in metastatic foci (Fig. 5c). IHC analyses confirmed weak expression of HER2/neu and ßcatenin in the metastases in the lungs (data not shown). Estrogen receptor α and progesterone receptor were not expressed in any of the metastases of the engrafted animals (data not shown).

Discussion

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. References

Subcutaneous tumor implantation has been a standard method for establishing animal models of human cancer.24 Although such models have helped to understand the nature of tumors and have lead to some therapeutic approaches to human cancer, many problems remain unsolved. One major problem is that tumors derived from patients and later implanted subcutaneously into an immunodeficient animal no longer behave as they once did in the human patient. Although a tumor can sometimes grow subcutaneously, it is often encapsulated and usually fails to metastasize either regionally or to distant sites.12 In our laboratory, we generated subcutaneous tumors by injection of the endometrial cancer cell line HEC1A. As shown in Fig. 1, subcutaneous tumors were indeed encapsulated and no dialogue with the environment could be expected. An alternative animal model system that can be potentially applicable for drug testing and gene-target validation, not only in endometriosis, but also in other various types of neoplastic disease, has been recently described.25 This animal model system involves the transplantation of relevant primary culture cells or cell lines beneath the kidney capsule of immunodeficient mice and has demonstrated the capacity for tissue regeneration and reconstruction.

To develop an animal model that more closely mimics the clinics, we performed an orthotopic implantation of the subcutaneous tumors. In theory, tumors that develop orthotopically (from the Latin for “correct place”) will more closely resemble human tumors, because the nearby blood vessel system and supporting tissues will better mirror a tumor's microenvironment, realistically influencing its growth. Orthotopic implantation has been used to develop rodent models of metastatic human cancer.11, 26 In the first generation of these models, cell line suspensions or disaggregated tumor cells were injected into the organ of the mouse, which corresponded to the organ from which the human tumor was derived. This method allowed metastasis to occur in certain cases.27, 28 However, the cell line suspensions and disaggregated cells used for orthotopic implantation did not have the three-dimensional tissue structure of human tumor tissue. Lack of tissue architecture may lead to changes in the biological behavior of a tumor and could be the reason for greatly reduced metastatic rates, perhaps because of subsequent insufficient tumor angiogenesis after the implantation of a cell suspension. In this light, we have developed surgically orthotopic implant models, utilizing intact tissue, such as that obtained directly from surgery or from human tumors growing in nude mice. As shown for other models of human cancer in nude mice,29–33 we were able to demonstrate patient-like tumor behavior of the orthotopic endometrial cancer model in myometrial invasion and vascular dissemination, and the development of metastasis to clinically-relevant organs.

Moreover, the immunohistochemical characterization of the orthotopic model indicated that this model was correspondent to an advanced carcinoma with low levels of hormone receptors and high levels of Ki-67 and p53 markers. Regarding p53, mutations are considered late events of tumorigenesis, since they are predominantly found in poorly differentiated tumors. Four regions of the p53 gene were selected for analysis based on their high rate of evolutionary conservation: exon 5 and exon 6, exon 7 and exon 8. Direct sequencing of the corresponding PCR bands revealed an A-to-G change in nucleotide 15360 of the TP53 gene, which resulted in a substitution of glutamine for arginine (data not shown). Although we do not know whether this particular mutation compromises the functionality of the p53 protein, this could be a reason for the nuclear accumulation of p53. In this model, the high Ki-67 expression levels (>99% of the tumor cells) and the accumulation of p53 suggest an eventual uncontrolled cell division and, therefore, an accumulation of DNA damage and mutations associated with advanced carcinoma.

Our orthotopic model developed metastases to para-aortic nodes (PAN) in 75% of the cases, reinforcing the assumption that this model represents an advanced stage of endometrial cancer and demonstrating again the adequacy of this model system to the clinics. Likewise, distant metastasis in intraperitoneally injected models arose from the mechanical spread of the implanted tumor material, rather than a true metastasis. Tumors grown subcutaneously in nude mice rarely metastasize; so, both models do not reflect optimal conditions for preclinical screenings for antimetastatic and anti-angiogenic agents. In this study, we could also characterize a role for RUNX1 as an inducer of distant metastasis in endometrial cancer. The mammalian RUNX genes (RUNX1–3) are transcription factors that play essential, lineage-specific roles in development. A growing body of evidence implicates these genes as mutational targets in cancer, where, in different contexts, individual family members have been reported to act as tumor suppressors, dominant oncogenes, or mediators of metastasis. RUNX1 has been previously described as being up-regulated in endometrioid endometrial carcinoma and purposed to play a role in endometrial tumorigenesis.8 Here, in the context of this model, we describe the influence of the over-expression of RUNX1 as a candidate gene for invasion and metastasis.

The rhd mediates protein-protein interactions with a variety of partners, including CBFβ and members of the Ets transcription factor family.20, 34 However, CBF/AML proteins are relatively weak transcriptional activators in isolation, and they potently enhance transcription rates in cooperation with several transcription factors (e.g., Ets-1, cMyb, CCAAT/enhancer protein) via cooperative DNA binding or interactions with coactivators.35 Interestingly, we have previously described the Ets family member ERM/ETV5, specifically upregulated in endometrial cancer associated with an initial switch to myometrial infiltration, acting through MMP-2 gelatinolytic activity to confer invasive capabilities.6, 7, 36 Further work must be performed to fully characterize the mechanisms underlying the promotion of distant metastasis by RUNX1 modulation.

It must be pointed out that the poor survival rate of patients with early endometrial cancer has been related to the extra-pelvic spread of the cancer and is significantly higher in more advanced stages.37 Therefore, further advances in controlling local and distant metastatic disease are needed. These models could be used to gain further insight into and to develop new therapeutic treatments for human endometrial cancer and lymph-node and lung metastasis, in particular. Effective therapies will need to target not only the tumor (the seed), but also its microenvironment (the soil). Therefore, orthotopic models will be necessary research tools, since they better reproduce the microenvironment needed to study these tumors and their metastasis.12 An example has been recently published for a combination of antivascular therapy with docetaxel in endometrial cancer.27

Collectively, in nude mice these orthotopically implanted tumors could be good candidates for the simulation of treatment for primary tumors, clinical progression and the metastasis of endometrial cancer. Translated to the clinics, these models would be equivalent to an advanced undifferentiated carcinoma with node affectation and distant metastasis. These patients would be candidates for adjuvant therapy, not efficient until today; thus, our model would actually be suitable for the design and evaluation of experimental therapies. It must be mentioned that not only the adequacy of these models to the clinics in appropriate tumor environment, myometrial invasion procedure, angiogenesis or tumor cell dissemination make it a good preclinical model system. The reproducibility of the model, the high rates of tumor uptake and the timing for tumor progression, as well as the appearance of node and distant metastasis also account for experimental therapeutic assays. Finally, we also present evidence of the utility of these models for the evaluation of how the process of metastasis is influenced by gene-expression. This will ideally improve the clinical treatment of endometrial cancer by pharmaceuticals, since invasion and metastasis are the major causes of death from cancer.38

References

  1. Top of page
  2. Abstract
  3. Material and methods
  4. Results
  5. Discussion
  6. References
  • 1
    Creasman WT,Morrow CP,Bundy BN,Homesley HD,Graham JE,Heller PB. Surgical pathologic spread patterns of endometrial cancer. A Gynecologic Oncology Group Study. Cancer 1987; 60: 203541.
  • 2
    Vardi JR,Tadros GH,Anselmo MT,Rafla SD. The value of exploratory laparotomy in patients with endometrial carcinoma according to the new International Federation of Gynecology and Obstetrics staging. Obstet Gynecol 1992; 80: 2048.
  • 3
    Ballon SC,Berman ML,Donaldson RC,Growdon WA,Lagasse LD. Pulmonary metastases of endometrial carcinoma. Gynecol Oncol 1979; 7: 5665.
  • 4
    Bouros D,Papadakis K,Siafakas N,Fuller AF,Jr. Natural history of patients with pulmonary metastases from uterine cancer. Cancer 1996; 78: 4417.
  • 5
    Doll A,Abal M,Rigau M,Monge M,Gonzalez M,Demajo S,Colas E,Llaurado M,Alazzouzi H,Planaguma J,Lohmann MA,Garcia J, et al. Novel molecular profiles of endometrial cancer-new light through old windows. J Steroid Biochem Mol Biol 2008; 108: 2219.
  • 6
    Abal M,Llaurado M,Doll A,Monge M,Colas E,Gonzalez M,Rigau M,Alazzouzi H,Demajo S,Castellvi J,Garcia A,Ramon yCajal S, et al. Molecular determinants of invasion in endometrial cancer. Clin Transl Oncol 2007; 9: 2727.
  • 7
    Monge M,Colas E,Doll A,Gonzalez M,Gil-Moreno A,Planaguma J,Quiles M,Arbos MA,Garcia A,Castellvi J,Llaurado M,Rigau M, et al. ERM/ETV5 up-regulation plays a role during myometrial infiltration through matrix metalloproteinase-2 activation in endometrial cancer. Cancer Res 2007; 67: 67539.
  • 8
    Planaguma J,Diaz-Fuertes M,Gil-Moreno A,Abal M,Monge M,Garcia A,Baro T,Thomson TM,Xercavins J,Alameda F,Reventos J. A differential gene expression profile reveals overexpression of RUNX1/AML1 in invasive endometrioid carcinoma. Cancer Res 2004; 64: 884653.
  • 9
    Vollmer G. Endometrial cancer: experimental models useful for studies on molecular aspects of endometrial cancer and carcinogenesis. Endocr Relat Cancer 2003; 10: 2342.
  • 10
    Sordat B,Wang WR. Human colorectal tumor xenografts in nudemice: expression of malignancy. Behring Inst Mitt 1984: 291300.
  • 11
    Fidler IJ,Naito S,Pathak S. Orthotopic implantation is essential for the selection, growth and metastasis of human renal cell cancer in nude mice [corrected]. Cancer Metastasis Rev 1990; 9: 14965.
  • 12
    Fidler IJ. Critical factors in the biology of human cancer metastasis: twenty-eighth G.H.A. Clowes memorial award lecture. Cancer Res 1990; 50: 61308.
  • 13
    Hoffman RM. Orthotopic metastatic (MetaMouse) models for discovery and development of novel chemotherapy. Methods Mol Med 2005; 111: 297322.
  • 14
    Fu XY,Besterman JM,Monosov A,Hoffman RM. Models of human metastatic colon cancer in nude mice orthotopically constructed by using histologically intact patient specimens. Proc Natl Acad Sci USA 1991; 88: 93459.
  • 15
    Hoffman RM. Orthotopic metastatic mouse models for anticancer drug discovery and evaluation: a bridge to the clinic. Invest New Drugs 1999; 17: 34359.
  • 16
    Sun FX,Sasson AR,Jiang P,An Z,Gamagami R,Li L,Moossa AR,Hoffman RM. An ultra-metastatic model of human colon cancer in nude mice. Clin Exp Metastasis 1999; 17: 418.
  • 17
    Levanon D,Negreanu V,Bernstein Y,Bar-Am I,Avivi L,Groner Y. AML1, AML2, and AML3, the human members of the runt domain gene-family: cDNA structure, expression, and chromosomal localization. Genomics 1994; 23: 42532.
  • 18
    Meyers S,Lenny N,Hiebert SW. The t(8;21) fusion protein interferes with AML-1B-dependent transcriptional activation. Mol Cell Biol 1995; 15: 197482.
  • 19
    Blyth K,Cameron ER,Neil JC. The RUNX genes: gain or loss of function in cancer. Nat Rev Cancer 2005; 5: 37687.
  • 20
    Melnikova IN,Crute BE,Wang S,Speck NA. Sequence specificity of the core-binding factor. J Virol 1993; 67: 240811.
  • 21
    Gergen JP,Butler BA. Isolation of the Drosophila segmentation gene runt and analysis of its expression during embryogenesis. Genes Dev 1988; 2: 117993.
  • 22
    Meyers S,Downing JR,Hiebert SW. Identification of AML-1 and the (8;21) translocation protein (AML-1/ETO) as sequence-specific DNA-binding proteins: the runt homology domain is required for DNA binding and protein-protein interactions. Mol Cell Biol 1993; 13: 633645.
  • 23
    Planaguma J,Gonzalez M,Doll A,Monge M,Gil-Moreno A,Baro T,Garcia A,Xercavins J,Alameda F,Abal M,Reventos J. The up-regulation profiles of p21WAF1/CIP1 and RUNX1/AML1 correlate with myometrial infiltration in endometrioid endometrial carcinoma. Hum Pathol 2006; 37: 10507.
  • 24
    Fidler IJ. Rationale and methods for the use of nude mice to study the biology and therapy of human cancer metastasis. Cancer Metastasis Rev 1986; 5: 2949.
  • 25
    Masuda H,Maruyama T,Hiratsu E,Yamane J,Iwanami A,Nagashima T,Ono M,Miyoshi H,Okano HJ,Ito M,Tamaoki N,Nomura T, et al. Noninvasive and real-time assessment of reconstructed functional human endometrium in NOD/SCID/gamma c(null) immunodeficient mice. Proc Natl Acad Sci USA. 2007; 104: 192530.
  • 26
    Manzotti C,Audisio RA,Pratesi G. Importance of orthotopic implantation for human tumors as model systems: relevance to metastasis and invasion. Clin Exp Metastasis 1993; 11: 514.
  • 27
    Kamat AA,Merritt WM,Coffey D,Lin YG,Patel PR,Broaddus R,Nugent E,Han LY,Landen CN,Jr.Spannuth WA,Lu C,Coleman RL, et al. Clinical and biological significance of vascular endothelial growth factor in endometrial cancer. Clin Cancer Res 2007; 13: 748795.
  • 28
    Giavazzi R,Jessup JM,Campbell DE,Walker SM,Fidler IJ. Experimental nude mouse model of human colorectal cancer liver metastases. J Natl Cancer Inst 1986; 77: 13038.
  • 29
    Fu X,Guadagni F,Hoffman RM. A metastatic nude-mouse model of human pancreatic cancer constructed orthotopically with histologically intact patient specimens. Proc Natl Acad Sci USA 1992; 89: 56459.
  • 30
    Fu X,Hoffman RM. Human ovarian carcinoma metastatic models constructed in nude mice by orthotopic transplantation of histologically-intact patient specimens. Anticancer Res 1993; 13: 2836.
  • 31
    Fu XY,Theodorescu D,Kerbel RS,Hoffman RM. Extensive multi-organ metastasis following orthotopic onplantation of histologically-intact human bladder carcinoma tissue in nude mice. Int J Cancer 1991; 49: 9389.
  • 32
    Wang X,Fu X,Hoffman RM. A patient-like metastasizing model of human lung adenocarcinoma constructed via thoracotomy in nude mice. Anticancer Res 1992; 12: 1399401.
  • 33
    Furukawa T,Fu X,Kubota T,Watanabe M,Kitajima M,Hoffman RM. Nude mouse metastatic models of human stomach cancer constructed using orthotopic implantation of histologically intact tissue. Cancer Res 1993; 53: 12048.
  • 34
    Wotton D,Ghysdael J,Wang S,Speck NA,Owen MJ. Cooperative binding of Ets-1 and core binding factor to DNA. Mol Cell Biol 1994; 14: 84050.
  • 35
    Westendorf JJ,Hiebert SW. Mammalian runt-domain proteins and their roles in hematopoiesis, osteogenesis, and leukemia. J Cell Biochem 1999;( Suppl 32–33): 518.
  • 36
    Planaguma J,Abal M,Gil-Moreno A,Diaz-Fuertes M,Monge M,Garcia A,Baro T,Xercavins J,Reventos J,Alameda F. Up-regulation of ERM/ETV5 correlates with the degree of myometrial infiltration in endometrioid endometrial carcinoma. J Pathol 2005; 207: 4229.
  • 37
    Hirahatake K,Hareyama H,Sakuragi N,Nishiya M,Makinoda S,Fujimoto S. A clinical and pathologic study on para-aortic lymph node metastasis in endometrial carcinoma. J Surg Oncol 1997; 65: 827.
  • 38
    Abal M,Fsihi H,Bras-Goncalves R,Doll A,Boye K,Janssen KP,Alameda F,Reventos J,Louvard D,Magdelenat H,Poupon MF,Robine S. Heterogeneous metastasis efficiency of isogenic orthotopic colon cancer xenografts reveals distinctive gene expression profiles. Tumour Biol 2007; 28: 13950.