SEARCH

SEARCH BY CITATION

Keywords:

  • tumor-associated macrophages;
  • tumor immunity;
  • p38-MAPK pathway;
  • MS4A family

Abstract

  1. Top of page
  2. Abstract
  3. Material and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Tumor-associated macrophages (TAMs) represent alternatively activated (M2) macrophages that support tumor growth. Previously, we have described a special LYVE-1+ M2 TAM subset in vitro and in vivo; gene profiling of this TAM subset identified MS4A8A as a novel TAM molecule expressed in vivo by TAM in mammary carcinoma and malignant melanoma. In vitro, Ms4a8a mRNA and MS4A8A protein expression was strongly induced in bone marrow-derived macrophages (BMDMs) by combining M2 mediators (IL-4, glucocorticoids) and tumor-conditioned media (TCM). Admixture of MS4A8A+ TCM/IL-4/GC-treated BMDM significantly enhanced the tumor growth rate of subcutaneously transplanted TS/A mammary carcinomas. Upon forced overexpression of MS4A8A, Raw 264.7 macrophage-like cells displayed a special gene signature. Admixture of these MS4A8A+ Raw 264.7 cells also significantly enhanced the tumor growth rate of subcutaneously transplanted mammary carcinomas. To identify the signaling pathways involved in synergistic induction of MS4A8A, the major signaling cascades with known functions in TAM were analyzed. Although inhibitors of NF-κB activation and of the MAPK JNK and ERK did not show relevant effects, the p38α/β MAPK inhibitor SB203580 strongly and highly significantly (p > 0.001) inhibited MS4A8A expression on mRNA and protein level. In addition, MS4A8A expression was restricted in M2 BMDM from mice with defective GC receptor (GR) dimerization indicating that classical GR gene regulation is mandatory for MS4A8A induction. In conclusion, expression of MS4A8A within the complex signal integration during macrophage immune responses may act to fine tune gene regulation. Furthermore, MS4A8A+ TAM may serve as a novel cellular target for selective cancer therapy.

Tumor-associated macrophages (TAMs) are a heterogeneous population of macrophages that represent a prominent component of stromal leukocytes in most malignant tumors. TAMs have been recognized as key regulators of the link between inflammation and cancer.1 TAMs support tumor growth and affect the clinical outcome of cancer patients.2–4

In most tumors analyzed, TAMs have been described to represent special subsets of alternatively activated (M2) macrophages.5 In contrast to classically activated (M1) macrophages that are proinflammatory macrophages with a high production of reactive nitrogen, oxygen intermediates, proinflammatory cytokines and a strong microbicidal and tumoricidal activity, M2 macrophages are induced by Th2 cytokines such as IL-4, IL-13 and IL-10 as well as by anti-inflammatory mediators such as glucocorticoids (GC).6–8 M2 macrophages are characterized by upregulation of endocytotic receptors such as stabilin-1, CD163 and macrophage mannose receptor and are responsible for termination of inflammatory reactions and for inducing healing processes supporting angiogenesis, immunosuppression and tissue repair.9–11 M2-like TAMs show altered NF-κB12 signaling and express a specific molecular repertoire, e.g., TNF-α, IL-1β, IL-6 and IL-10. Proof of principle has been presented that M2-like TAMs may be reprogramed into M1 macrophages as a novel therapeutic approach in cancer.13,14

MS4A8A is a member of the newly defined MS4A/CD20 family of proteins characterized by four transmembrane regions. This family comprises about 26 members in human and mouse.15 The functions of many MS4A family members are still a matter of debate, but most of them act as cell surface signaling molecules and intracellular adapter proteins.16 The most prominent family member is CD20, a well-known B-cell differentiation marker, that serves as a specific target in the treatment of malignant B-cell lymphomas.17

Using a mouse model of malignant melanoma, we have identified a special subset of TAM characterized by coexpression of stabilin-1 and the lymphatic endothelium-specific hyaluronan receptor LYVE-118 that may contribute to tumor lymphangiogenesis.18,19 LYVE-1 expression in TAM in vitro was selectively induced by stimulation of bone marrow-derived macrophages (BMDMs) by both the M2 mediators IL-4 and GC as well as tumor-conditioned media (TCM). Therefore, we sought to further characterize this M2-like TAM subset. Gene profiling of LYVE-1+ TAM identified MS4A8A as a novel TAM molecule. In vivo, MS4A8A+ TAMs were identified both in subcutaneous transplant tumors of murine mammary adenocarcinoma (TS/A) and of murine malignant melanoma (B16F1). In addition, MS4A8A+ TAMs were generated in vitro by stimulation with TS/A-derived TCM and GC/IL-4. MS4A8A+ TAMs represent true M2-like macrophages as demonstrated by strong upregulation of typical M2 markers such as arginase, and they enhanced tumor growth in subcutaneous transplant tumors in vivo. For the induction of MS4A8A+ macrophages by TCM and GC/IL-4 in vitro, synergistic activation of the p38MAPK pathway by TCM and of signaling by the GC receptor (GR) dimer was indispensable. Functionally, forced overexpression of MS4A8A in a macrophage cell line induced a special gene signature (Tcfec, Spink5, Sla and Sorl1) involved in immune regulation. Admixture of these MS4A8A+ Raw 264.7 cells (RAW264.7MS4A8A) also significantly enhanced the tumor growth rate of subcutaneously transplanted TS/A mammary carcinomas.

In conclusion, we describe a novel MS4A8A+ subset of M2-like TAM that promotes tumor growth and is induced by synergistic activation of p38 MAPK- and GR-dependent signaling pathways.

Material and Methods

  1. Top of page
  2. Abstract
  3. Material and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Mice

C57BL/6 and Balb/c, wild-type mice were purchased from Elevisier Janvier. GRdim mice are described elsewhere.20 All mice are housed under specific pathogen-free conditions at the animal facility Mannheim. Animal experimental protocols were approved by the animal ethics committee (Regierungspräsidium Karlsruhe, Az: 35-9185.81/G-115/07).

Materials

The following reagents were used: IL-4, M-CSF (Peprotech) and dexamethasone (Sigma); rat anti-mouse CD68 (clone FA-11, Serotec), rat anti-mouse CD11b (clone M1/70, BD Bioscience), rat anti-mouse F4/80 (clone BM8, Acris) and rat isotype control IgG2a (BD Bioscience); rabbit anti-mouse LYVE-1-Biotin (Reliatech); goat anti-rabbit Cy2, Cy3, Alexa488, goat anti-rat Cy2, Cy3 (all Dianova) and Streptavidin-Alexa488 (Invitrogen). Goat anti-rabbit IgG-HRP and goat anti-rat IgG-HRP (Santa Cruz Biotechnology). Custom-made anti-MS4A8A serum was produced by immunizing rabbits with a synthetic peptide (252EPPNPIPSYSEVVQDSR268) representing the C-terminal part of MS4A8A (Peptide Speciality Laboratories). Antibody specificity was confirmed by immunohistochemistry and Western blot analysis of Ms4a8a-transfected versus mock-transfected Raw 264.7 clones.

Cells

B16F1 melanoma cells (ATCC TIB-71) and RAW264.7 macrophages (ATCC CRL-6323) were obtained from American Type Culture Collection. TS/A adenocarcinoma was a kind gift of Patrizia Nanni, University of Bologna. Authentication of cell lines was assured by regular morphology checks and growth curve analyses. BMDMs were generated as previously described18 and stimulated with TSA or B16F1 preconditioned medium, IL-4 (10 ng/ml), dexamethasone (5 × 107 M), TNF-α (10 ng/ml), IFN-γ (10 ng/ml), IL-1β (10 ng/ml) and IL-6 (10 ng/ml) for 3 days as needed. For the signaling pathway analysis, the following inhibitors were used: SB203580 (Sigma-Adrich) (10 μM) for p38-MAPK and NF-kB activation inhibitor (Calbiochem) (5 μM) for NF-kB.

Generation of Ms4a8a-transfected RAW264.7 macrophages

A recombinant Ms4a8a cDNA was amplified by PCR (primer: Ms4a8a-SpeI-fw 5′ATCGAATTCACTAGTAGCAAAGAGTTGGGAACCGGAGCAAGA3′ and Ms4a8a-NotI-rv: 5′ATATGCGGCCGCTAGAGCATCTTTAT3′) from Ms4a8a cDNA RZPDp981B0530D (IMAGE ID 905005), purified on agarose gel and subcloned after digestion with SpeI and NotI restriction enzymes into the expression vector pEF6/V5-His Topo (Invitrogen) according to the standard molecular biology protocols. After confirming sequence identity, we transfected RAW264.7 cells with Ms4a8a vector DNA using Lipofectamine 2000 (Invitrogen) transfection reagent. Transfectants were selected by resistance to blasticidin (Invitrogen). Raw264.7MS4A8A clones 2, 8 and 10 with recombinant Ms4a4a expression were propagated. As a negative control, a vector-transfected RAW264.7mock (clone C3) was selected under parallel culture conditions.

Tumor models

A total of 2 × 106 tumor cells (B16F1 or TS/A) were injected into 12-week-old female C57BL/6 and BALB/c mice subcutaneously into the right flank. After 14 days, animals were sacrificed, and the tumor samples were snap frozen in liquid nitrogen.

For the tumor-growth experiment, 12-week-old pathogen-free female BALB/c mice (Elsevier Janvier) were injected into the right flank with either 3 × 105 TS/A tumor cells together with 3 × 105 BMDM pretreated with control medium or 3 × 105 TS/A tumor cells together with 3 × 105 BMDM pretreated with TS/A dexamethsone/IL4-conditioned medium. The tumors were harvested after 18 days. Data represent the summary of two independent experiments (n = 3, n = 8).

For the tumor experiment involving the coinjection of TS/A and tansfected raw cells, a total of 105 TS/A tumor cells were coinjected either with RAW264.7MS4A8A or RAW264.7mock cells in the right mouse flank (n = 7). After 18 days, tumors were harvested, and the final tumor weight was assessed.

Immunohistochemistry

Cells grown on glass cover slips and cryostat sections were air-dried and acetone-fixed. Specimens were blocked with 5% FCS in PBS and incubated with the first antibody. The appropriate HRP-labeled secondary antibody was used. Pictures were taken with a Leica DCRE microscope, Leica DC500 camera and software system (Leica). Images were arranged using Adobe Photoshop 6.0 software.

Immunofluorescence

Acetone-fixed cryostat sections and cover slips were blocked with 3% BSA, incubated with the first antibody and after that with the appropriate secondary antibody. Specimens were analyzed with Leica TCS SP2 laser scanning spectral confocal microscope. Images were arranged using Adobe Photoshop 6.0 software.

Western blot analysis

Proteins were obtained by treating whole cells with RIPA-P buffer [150 mM NaCl, 15 NP40, 0.5% sodium desoxycholate, 0.1% SDS, 50 mM Tris/HCL (pH 8.0), 10 mM NaF, 1 mM Na3OV4 and 2 mM EDTA (all Sigma)] enriched with a protease inhibitor cocktail (Roche). Equal amounts of protein were carried on a 12% SDS polyacrylamide gel. After blotting onto nitrocellulose (Schleicher & Schüll), membranes were incubated overnight with the MS4A8A or β-actin antibody, respectively, followed by incubation with the secondary anti-rabbit HRP-labeled antibody. For signal detection, SuperSignal West Pico Chemiluminescent Substrate (Pierce) was used.

RT-PCR and qRT-PCR analysis

For RNA extraction, the RNeasy Mini kit (Qiagen) was used according to the manufacturer's instructions. For cDNA synthesis, 1 μg RNA was used for reverse transcription with RevertAid H Minus M-MuLV Reverse Transcriptase (Fermentas) using Oligo (dT)18 Primer following the manufacturer's instructions.

For RT-PCR, 1 μl cDNA was amplified with the DFS Taq DNA Polymerase (Bioron) in 11 μl final volume. PCR products were separated in a 1% agarose gel containing ethidium bromide.

For qRT-PCR, 1 μl cDNA was amplified using SyBRGreen PCR Master Mix (Applied Biosystems) under standard conditions with an MX3000P sequence detection system (Stratagene). All primers used are listed in Supporting Information Table 1.

Table 1. Gene profiling of LYVE-1+ TAM-like bone marrow-derived macrophages
inline image

Fluorescence-activated cell sorting

For fluorescence-activated cell sorting (FACS) analysis, 5 × 106 cells were washed with PBS, fixed with 4% paraformaldehyde at RT for 20 minutes, washed and resuspended in 100 μl PBS/1% BSA containing diluted antibody (1/100) or corresponding isotype control. After 45 min of incubation on ice, the cells were washed twice with 1% BSA/PBS and resuspended in 400 μl of the same buffer. For cell permeabilization, 0.5% saponin was added to the 1% BSA/PBS solution. Stained cells were analyzed with FACS-Calibur (BD Biosciences, Heidelberg, Germany). The results were evaluated with WinMDI software.

cDNA microarray analysis and statistical procedures

For microarray analysis, BMDMs were stimulated for 3 days with IL4/dexamethasone, B16F1 supernatant and B16F1 supernatant/dexamethasone/IL4. RAW264.7 cells were incubated for 30 hr with DMEM medium supplemented with 10% FCS, 100 IU penicillin, 100 μg/ml streptomycin, 1% pyruvic acid and 1% nonessential amino acids. Gene expression profiling was performed using mouse genome 430 2.0 DNA arrays (Affymetrix) according to the recommendations of the manufacturer. A Custom CDF Version 9 with Unigene-based gene definitions (RAW264.7 cell microarrays) and a Custom CDF Version 11 with Entrez-based gene definitions (BMDM microarrays) were used to annotate the arrays. Differential gene expression was analyzed based on log-linear mixed model ANOVA21 using a commercial software package SAS JMP7 Genomics, version 3.2, from SAS (SAS Institute). A false-positive rate of a = 0.05 with Holm correction (RAW264.7 cell microarrays) or Bonferroni correction (BMDM microarrays) was taken as the level of significance. Full data are deposited in the Gene Expression Omnibus database.

Statistical analysis

Sigma plot 11.0 software was used to perform one-way Anova. A p value < 0.05 was regarded as statistically significant. Error bars show SEM of each experiment. Experiments were performed at least in triplicate.

Results

  1. Top of page
  2. Abstract
  3. Material and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Gene profiling of LYVE-1+ TAM-like BMDM

Recently, we have identified a novel subtype of TAMs in situ in a mouse model for malignant melanoma by coexpression of macrophage marker proteins F4/80 and CD11b with LYVE-1.18In vitro, induction of LYVE-1 mRNA and protein expression in BMDM in culture was shown to strictly depend on combined stimulation with tumor-conditioned medium (TCM) in addition to the M2 mediators IL-4 and the GC dexamethasone.18 To further characterize this special subset of LYVE-1+ M2-TAM-like BMDM molecularly, we performed gene expression profiling using Affymetrix Mouse genome 430 2.0 DNA microarrays. Three groups of BMDM were compared, i.e. (i) BMDM stimulated by B16F1 melanoma-conditioned media (BMDMB16), (ii) BMDM stimulated by IL-4 and GC (BMDMIL4/GC) and (iii) BMDM stimulated by both B16F1 melanoma-conditioned media and IL-4 and GC (BMDMB16/IL4/GC). To detect genes that are upregulated in equal parts by the combined treatment of B16F1 melanoma-conditioned medium and IL4/GC, two two-sided comparisons were done (Table 1 and Supporting Information Fig. 1): (i) BMDMB16/IL4/GCversus BMDMIL4/GC (Table 1, A) and (ii) BMDMB16/IL4/GCversus BMDMB16 (Table 1, B). Genes were only included in the analysis when they were overexpressed in both comparisons by a fold change (FC) of ≥2. By calculating the ratio between the fold changes in B and A (RFC = FCB/FCA), the relative contribution of the two stimuli (B16-conditioned media versus IL-4/GC) to the induction of a given gene by the combined treatment may be estimated. Among the genes with a high RFC, i.e., genes induced preferentially by IL-4/GC, several well-known M2 marker genes were detected including RetnIa (Resistin-like alpha, fizz1) and Arg1 (Arginase1). The remaining genes with a moderate-to-low RFC-like Ms4a8a were analyzed by quantitative RT-PCR for strict dependence on the combined treatment by IL-4/GC plus B16F1-conditioned media. Ms4a8a, however, was, in addition to Lyve-1, the only gene coding for a yet uncharacterized transmembrane molecule with hypothetical receptor activity. MS4A8A belongs to the CD20/Ms4a protein family, several members of which have been shown to exert important functions in various immunological processes. To assess the contribution of MS4A8A as a novel regulatory molecule in context of TAM differentiation, we focused our study on this protein.

Figure 1. Identification of MS4A8A+ TAM in subcutaneously transplanted TS/A and B16F1 tumors. (a) Immunohistochemical staining of MS4A8A in B16F1 tumors subcutaneously grown in C57BL/6 (i and ii; bars, 50 μm) and (b) in TS/A tumors grown in Balb/c mice (i and ii; bars, 100 μm). (c) Representative immunofluorescent double stainings of subcutaneously grown TS/A tumor (bars, 9 μm; n = 5); images were acquired using confocal microscopy.

Download figure to PowerPoint

thumbnail image

Identification of MS4A8A+ TAM in murine subcutaneous transplant models of malignant melanoma and mammary carcinoma

To show expression of MS4A8A protein and to verify the presence of MS4A8A+ TAM in vivo, a rabbit polyclonal antibody against a specific MS4A8A peptide was generated and used to stain subcutaneous transplant tumors of the B16F1 malignant melanoma cell line in C57BL/6 mice. As a second subcutaneous transplant tumor model, we used the murine mammary adenocarcinoma cell line TS/A, a tumor heavily infiltrated by TAM.22 In B16 melanoma, MS4A8A staining was restricted to macrophages in the periphery of the tumor (Fig. 1a, i) with only few macrophages in the center of the tumor (Fig. 1a, ii). In the TS/A tumor, MS4A8A+ macrophages were identified both at the periphery (Fig. 1b, i) and in the center of the tumor (Fig. 1b, ii). Upon immunofluorescent analysis, coexpression of MS4A8A with CD11b, F4/80 and stabilin-1 was seen in TS/A mammary carcinoma identifying MS4A8A+ cells as a subset of stabilin-1+ TAM (Fig. 1c).

To test, whether Ms4a8a expression is limited to TAM, expression in brain, liver, lung and spleen was analyzed. Although macrophages of liver, spleen (Supporting Information Figs. 2d–2g) and brain (data not shown) showed no Ms4a8a expression, a subpopulation of CD68+ lung macrophages clearly stained positive for Ms4a8a (Supporting Information Figs. 2a–2c).

Figure 2. Synergistic induction of Ms4a8a mRNA and protein in BMDM by tumor-conditioned media and IL-4/glucocorticoids. (a) Expression analysis of Ms4a8a mRNA (n = 3) and (b) protein by qRT-PCR and Western blot of BMDM stimulated as indicated (n = 3). (cf) MS4A8A-positive BMDMs express typical markers of M2 differentiation and accelerate tumor growth. qRT-PCR expression analysis of Arg1 (c), Cd163 (d) and Mmr (e) of BMDM treated as indicated are shown (n = 3). Values were normalized to an internal β-actin control and are given as the fold induction over BMDM grown with control medium set at 1. (f) The tumor weight of 18-day-old TS/A tumors coinjected with TCM/IL-4/GC-stimulated and control BMDM is shown (n = 11).

Download figure to PowerPoint

thumbnail image

Synergistic induction of MS4A8A in BMDM by tumor-conditioned media and M2 mediators

To confirm the selective expression pattern of MS4A8A in BMDM stimulated by IL-4/GC in combination with TCM as found in the microarray analysis, we studied the expression of MS4A8A in BMDM by Western blot and qRT-PCR analysis. In addition to B16F1 melanoma-conditioned media, we included media conditioned by the mammary adenocarcinoma cell line TS/A in all further experiments as subcutaneously transplanted TS/A tumors showed a strong infiltration by MS4A8A+ TAM (see above). Combined treatment of BMDM by TCM of TS/A as well as of B16F1 cells together with IL-4/GC strongly increased Ms4a8a mRNA expression upon qRT-PCR analysis with the highest induction of Ms4a8a mRNA found in the TS/A/IL-4/GC group (Fig. 2a). Western blot analysis of protein extracts from BMDM stimulated by the same mediators showed a weak protein band of 26 kDa in BMDMB16/IL4/GC and quite a strong MS4A8A protein band in BMDMTS/A/IL4/GC confirming the data obtained by qRT-PCR (Fig. 2b).

MS4A8A+ BMDMs are M2-like macrophages and enhance tumor growth in vivo

To test whether MS4A8A+ BMDMs induced by the combined stimulation with TCM and M2 mediators are bona fide M2 macrophages, M2 marker genes such as Arginase1, scavenger receptor cysteine-rich (Cd163) and macrophage mannose receptor (Mmr) were analyzed in various macrophage populations including the prototype M2 BMDM population induced by IL-4 and GC. Among these macrophage populations, MS4A8A+ BMDMs induced by combined activation with TS/A-derived TCM and M2 mediators showed extremely high expression levels for all three marker genes that were much higher than those induced by the combination of IL-4 with GC (Figs. 2c–2e). Expression levels of the M2 marker genes in BMDM stimulated by B16F1-derived TCM in combination with IL4/GC equaled those induced by the combination of IL-4 with GC alone. To test weather Ms4a8a expression was solely restricted to M2 TAM, BMDMs were stimulated with various M1 and M2 cytokines. Ms4a8a expression was thereby only induced by dexamethasone, dexamethasone/IL4 and, most strongly, by TS/A+dexamethasone/IL4 (Supporting Information Fig. 3). In line with their preferential M2 differentiation, admixture of MS4A8A+ BMDM generated in vitro by stimulation with TS/A-derived TCM and M2 mediators significantly enhanced the tumor growth rate of subcutaneously transplanted TS/A mammary carcinomas in vivo when compared to control BMDM (Fig. 2f).

Figure 3. MS4A8A expression in BMDMTCM/dexamethasone/IL4 is induced by the synergistic activation of the p38 MAPK pathway and the GR pathway. (a) Ms4a8a mRNA expression levels of BMDM stimulated as indicated and treated with 5 μM NF-kB activation inhibitor or with DMSO. (b) Immunohistochemical stainings of MS4A8A of BMDM stimulated as indicated and treated with 5 μM NF-kB activation inhibitor or with DMSO. (c, d) BMDMs were treated with either SB203580 inhibitor or DMSO and stimulated as indicated. Ms4a8a mRNA and MS4A8A protein expression of BMDM was assessed by (c) qRT-PCR (n = 4) and (d) Western blot.

Download figure to PowerPoint

thumbnail image

Synergistic induction of MS4A8A expression in BMDM by TCM and M2 mediators is mainly mediated by p38 MAPK and GR signaling

To identify the signaling pathway involved in synergistic induction of MS4A8A in BMDM by combined stimulation with TS/A-derived TCM and IL-4 and GC, the major signaling cascades with known functions in TAM such as the NF-κB pathway, the mitogen-activated protein kinase (MAPK) pathway and the glucocorticoid receptor (GR) action were analyzed. Upon inhibition of NF-κB activation by the NF-κB activation inhibitor, Ms4a8a mRNA and protein expression induced by TCM and IL-4/GC was slightly, but significantly reduced (Figs. 3a and 3b). Although inhibitors of the MAPK JNK and ERK did not show any effects (data not shown), the p38α/β MAPK inhibitor SB203580 strongly and highly significantly (p > 0.001) inhibited Ms4a8a mRNA and protein expression induced by TCM and M2 mediators in BMDM (Figs. 3c and 3d). In addition, induction of Ms4a8a mRNA expression by TCM in combination with M2 mediators was strongly inhibited in M2 BMDM from mice with defective GR dimerization indicating that GC activation is mandatory for Ms4a8a induction (Fig. 3e).

MS4A8A induces a special activation program in RAW264.7 macrophages and enhances tumor growth when coinjected with TS/A breast cancer cells

To identify MS4A8A-associated functions in macrophages, Ms4a8a-transfected Raw264.7 macrophage-like cell clones (Raw264.7MS4A8A) were generated. The Ms4a8a expression level of the clones was assessed by RT-PCR (Fig. 4a) and FACS-analysis (Fig. 4b), and highly MS4A8A+ clone 8 was selected for further analysis. For the identification of target genes, Raw264.7MS4A8A was compared with Raw264.7mock upon gene expression profiling using Affymetrix Mouse genome 430 2.0 DNA microarrays. The MS4A8A-dependent target gene signature comprised six genes including the IL-4-inducible macrophage transcription factor Tcfec,23 the atopy-associated serine protease inhibitor Spink5,24 the GC-inducible immunosuppressive src-like adaptor Sla,25 the scavenger receptor Sorl1, the chemokine Cxcl16 and the serine/threonine kinase Dapk1 (Table 2). By using qRT-PCR analysis, Sla, Sorl1, Spink5 and Tcfec were shown to be significantly upregulated in Raw264.7MS4A8A (Figs. 4c–4f). Among these molecules, Sorl1 reached the highest expression level with a 200-fold higher induction when compared to the control clone (Fig. 4d).

Figure 4. MS4A8A induces as special gene signature in RAW264.7 macrophages. (a) Ms4a8a mRNA expression in nontransfected (i), mock-transfected (clone C3) (ii) and Ms4a8a-transfected (clone 8) (iii) Raw 264.7 cells assessed by RT-PCR. (b) The MS4A8A protein expression level in transfected Raw264.7 cells was assessed by FACS-analysis. (cf) mRNA expression levels for (c) Sla, (d) Sorl1, (e) Spink5, (f) Tcfec and (h) Mmp9 were quantified by qRT-PCR. All qRT-PCR values are given as fold induction over mock-transfected Raw264.7 cells set as 1 (n = 4). (g) The tumor weight of 18-day-old TS/A tumors coinjected with Raw264.7MS4A8A or Raw264.7mock is shown (n = 7).

Download figure to PowerPoint

thumbnail image
Table 2. Gene profiling of Ms4a8a-transfected RAW264.7 macrophages
inline image

To test whether Raw264.7MS4A8A influences tumor growth, a total of 105 TS/A tumor cells were coinjected either with 105 Raw264.7MS4A8A or with 105 Raw264.7mock in the right mouse flank (n = 7). After 18 days, tumors were harvested, and the final tumor weight was assessed. TS/A tumors coinjected with Raw264.7MS4A8A reached a higher tumor end weight, which was statistically significant compared to TS/A tumors coinjected with Raw264.7mock (Fig. 4g).

As these tumor growth enhancing effects of Ms4a8a were striking, we tested whether other functional changes associated with known TAM functions occurred in Raw264.7MS4A8A. We analyzed the expression of Cxcl1, Cxcl2, Ccl17, Ccl24, Vegf-a, Vegf-c, Vegf-d, IL10, Tnf-α and Mmp9 in Raw264.7MS4A8A compared to Raw264.7mock by qRT-PCR (n = 3). None of the aforementioned genes was differentially regulated (data not shown) except Mmp9, which was threefold highly expressed in Raw264.7MS4A8A compared to control (Fig. 4h).

Discussion

  1. Top of page
  2. Abstract
  3. Material and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Alternatively activated (M2) macrophages play a major role in tissue homeostasis and remodeling as well as in tumor growth and tumor immune escape. TAMs represent specialized M2 macrophages whose differentiation may deviate from the common M2 activation pathways.12, 26 In our study, we analyzed a special LYVE-1+ TAM subset by gene expression profiling and identified MS4A8A as a novel surface M2-TAM molecule, which induces a specific gene signature when overexpressed in Raw 264.7 cells. MS4A8A is a member of the MS4A/CD20 family of proteins characterized by four transmembrane regions flanked by N- and C-termini protruding into the cytoplasm and an extended extracellular loop structure spanning between transmembrane regions three and four.27 To date, the family comprises 26 members in mouse and man15, 28 of which CD20 (MS4A1), HTm4 (MS4A3) and FcεRIβ (MS4A2) are the most prominent ones. For CD20 or hematopoietic cell-specific protein (HTm4), the expression pattern is restricted to hematopoietic lineages, but others as MS4A12 can also be found in epithelial cells as in colonic epithelial cells.29–31 Although the function of many MS4A family members remains elusive, many data support a role in cell differentiation and in immune regulation. CD20, for example, plays a central role in the generation of T cell-independent antibody responses.32 As CD20 is present on the majority of B-cell lymphomas, a therapeutic antibody has been created, which is successfully used in the therapy of non-Hodgkin lymphomas.

A new antibody against murine MS4A8A allowed us to identify MS4A8A+ TAM in vivo in the stroma of murine mammary carcinoma TS/A and murine melanoma B16F1 indicating a role in TAM biology. To study MS4A8A effects in macrophages, we used gene expression profiling using stably transfected RAW264.7 macrophages. MS4A8A overexpression in Raw264.7 cells induced a special gene signature comprising the transcription factor TCFEC, the protease inhibitor SPINK5, the trafficking receptor SORL1 and the adaptor protein SLA. These genes have previously been associated with M2 differentiation, T helper cell skewing, endocytotic processes or regulation of TCR expression. The transcription factor Tcfec, for example, has been described to be induced by Th2 cytokines such as IL-4.23 Mutations and polymorphisms of the protease inhibitor SPINK5 are associated with Netherton syndrome and atopy characterized by a dysregulated Th2 response and elevated IgE levels indicating a T-cell regulatory function.24, 33

SORL1 is a novel sorting receptor that regulates trafficking and processing of the amyloid precursor protein (APP).34 Blocking APP in metastatic malignant melanoma impairs the proliferation of melanoma cells and leads to their terminal differentiation.35 The adaptor protein SLA has been reported to suppress T-cell responses by downregulating TCR signaling. Although SLA has not been analyzed in macrophages, it may be assumed that it exerts a similar immunosuppressive function in these cells.25, 36 In summary, these data provide evidence for the influence of MS4A8A on the transcriptome of macrophages.

To analyze whether MS4A8A expression in macrophages directly influences tumor growth, we coinjected Raw264.7MS4A8A or Raw264.7mock with TS/A cells in the right murine flank. After 18 days, TS/A/Raw264.7MS4A8A tumors reached a significantly higher tumor weight when compared to the controls. As the enhanced tumor growth mediated by Raw264.7MS4A8A may not fully be explained by gene regulatory activities of Ms4a8a, we assume that Ms4a8a may mediate some of its effects by direct cell–cell contact. As an association with the MHC class II complex has been described for some MS4 family members,37 a regulatory function of MS4A8a in the antigen presentation process seems plausible, but needs further clarification.

As MS4A8A lacks signaling sequences in its intracytoplasmic domain downstream effects require more indirect pathways. It has been shown recently that other MS4A family members are capable of transmitting cellular signals by binding to regulatory proteins; for example, MS4A4B is able to cluster with the GC-inducible costimulatory molecule GITR in supramolecular complexes in the plasma membrane in cis lowering the threshold for GITR activation in regulatory T-cells.38 Similarly, MS4A8A could cluster with as yet unidentified surface receptors in cis to alter their activation threshold or signaling behavior, especially in GC-treated macrophages.

To study the regulatory mechanism of MS4A8A expression in macrophages, we tested a BMDM in vitro model. Here, MS4A8A itself required a synergistic induction by M2 mediators IL-4 and GC in combination with TCM. To disclose the upstream pathways required for MS4A8A expression, major signaling cascades with dominant functions in TAM were analyzed by using specific inhibitors. Interestingly, TCM preferentially exerted its effects on MS4A8A expression in combination with M2 mediators via activation of the p38 MAPK pathway. In addition, TCM signaling in combination with M2 mediators was inhibited by impairment of GR dimerization.

The p38MAPK pathway in general is activated by oxidative stress but also following inflammatory cytokine stimulation (IL-1β or TNF-α39). All these factors could be involved in Ms4a8a induction in a tumor setting. In addition, there are some publications indicating a direct role of p38MAPK in NF-kB activation.40 Such an interaction would best explain how SB203580 as well as the NF-kB activation inhibitor can prevent Ms4a8a induction by TCM in combination with M2 mediators.

The Ms4a8a promoter contains several AP1 sites (not shown) that may be the downstream target sites for p38 signaling; in addition, the Ms4a8a promoter also contains several GC response elements (not shown). Interestingly, p38 MAPK and GR signaling have been shown to be interconnected in a feedforward circuitry involving induction of MAPK kinase 3, an upstream kinase phosphorylating p38 by GC and activating phosphorylation of the GR at serine 211 by p38.41 Nevertheless, the identification of the requirements for the synergy between p38 and GC signaling in activating Ms4a8a expression in macrophages still awaits definite clarification.

Taken together, we have identified MS4A8A as a novel protein expressed by a special subset of M2 macrophages induced in vitro by synergistic activation of the p38 MAPK and GR signaling pathways. This synergistic signaling pathway may play an important role in supporting tumor growth. MS4A8A+ macrophages occur as a novel TAM subpopulation in vivo and enhance the growth of subcutaneous transplant tumors. MS4A8A may act as immunological integration molecule for p38MAPK and GC signaling, which leads to activation of a special gene expression program. Proof for a synergy between p38MAPK and GC signaling pathways in macrophage activation as presented here will enable us to better understand the multitude of macrophage immune responses during tumor growth and metastasis and may open new avenues to improved therapeutic strategies targeting macrophages.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Material and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

The authors thank Prof. Nanni for sending TS/A tumor cell line. This work was supported in part by grants of Deutsche Forschungsgemeinschaft, project B12 to S.G. and J.K. and project B1 to S.G.

References

  1. Top of page
  2. Abstract
  3. Material and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information
  • 1
    Sica A, Allavena P, Mantovani A. Cancer related inflammation: the macrophage connection. Cancer Lett 2008; 267: 20415.
  • 2
    Tsutsui S, Yasuda K, Suzuki K, Tahara K, Higashi H, Era S. Macrophage infiltration and its prognostic implications in breast cancer: the relationship with VEGF expression and microvessel density. Oncol Rep 2005; 14: 42531.
  • 3
    Canioni D, Salles G, Mounier N, Brousse N, Keuppens M, Morchhauser F, Lamy T, Sonet A, Rousselet MC, Foussard C, Xerri L. High numbers of tumor-associated macrophages have an adverse prognostic value that can be circumvented by rituximab in patients with follicular lymphoma enrolled onto the GELA-GOELAMS FL-2000 trial. J Clin Oncol 2008; 26: 4406.
  • 4
    Steidl C, Lee T, Shah SP, Farinha P, Han G, Nayar T, Delaney A, Jones SJ, Iqbal J, Weisenburger DD, Bast MA, Rosenwald A, et al. Tumor-associated macrophages and survival in classic Hodgkin's lymphoma. N Engl J Med 362: 87585.
  • 5
    Mantovani A, Sozzani S, Locati M, Allavena P, Sica A. Macrophage polarization: tumor-associated macrophages as a paradigm for polarized M2 mononuclear phagocytes. Trends Immunol 2002; 23: 54955.
  • 6
    Goerdt S, Politz O, Schledzewski K, Birk R, Gratchev A, Guillot P, Hakiy N, Klemke CD, Dippel E, Kodelja V, Orfanos CE. Alternative versus classical activation of macrophages. Pathobiology 1999; 67: 2226.
  • 7
    Goerdt S, Orfanos CE. Other functions, other genes: alternative activation of antigen-presenting cells. Immunity 1999; 10: 13742.
  • 8
    Sica A, Larghi P, Mancino A, Rubino L, Porta C, Totaro MG, Rimoldi M, Biswas SK, Allavena P, Mantovani A. Macrophage polarization in tumour progression. Semin Cancer Biol 2008; 18: 34955.
  • 9
    Stein M, Keshav S, Harris N, Gordon S. Interleukin 4 potently enhances murine macrophage mannose receptor activity: a marker of alternative immunologic macrophage activation. J Exp Med 1992; 176: 28792.
  • 10
    Goerdt S, Bhardwaj R, Sorg C. Inducible expression of MS-1 high-molecular-weight protein by endothelial cells of continuous origin and by dendritic cells/macrophages in vivo and in vitro. Am J Pathol 1993; 142: 140922.
  • 11
    Kzhyshkowska J, Gratchev A, Schmuttermaier C, Brundiers H, Krusell L, Mamidi S, Zhang J, Workman G, Sage EH, Anderle C, Sedlmayr P, Goerdt S. Alternatively activated macrophages regulate extracellular levels of the hormone placental lactogen via receptor-mediated uptake and transcytosis. J Immunol 2008; 180: 302837.
  • 12
    Biswas SK, Gangi L, Paul S, Schioppa T, Saccani A, Sironi M, Bottazzi B, Doni A, Vincenzo B, Pasqualini F, Vago L, Nebuloni M, et al. A distinct and unique transcriptional program expressed by tumor-associated macrophages (defective NF-kappaB and enhanced IRF-3/STAT1 activation). Blood 2006; 107: 211222.
  • 13
    Hagemann T, Lawrence T, McNeish I, Charles KA, Kulbe H, Thompson RG, Robinson SC, Balkwill FR. “Re-educating” tumor-associated macrophages by targeting NF-kappaB. J Exp Med 2008; 205: 12618.
  • 14
    Jassar AS, Suzuki E, Kapoor V, Sun J, Silverberg MB, Cheung L, Burdick MD, Strieter RM, Ching LM, Kaiser LR, Albelda SM. Activation of tumor-associated macrophages by the vascular disrupting agent 5,6-dimethylxanthenone-4-acetic acid induces an effective CD8+ T-cell-mediated antitumor immune response in murine models of lung cancer and mesothelioma. Cancer Res 2005; 65: 1175261.
  • 15
    Ishibashi K, Suzuki M, Sasaki S, Imai M. Identification of a new multigene four-transmembrane family (MS4A) related to CD20, HTm4 and beta subunit of the high-affinity IgE receptor. Gene 2001; 264: 8793.
  • 16
    Kutok JL, Yang X, Folkerth R, Adra CN. Characterization of the expression of HTm4 (MS4A3), a cell cycle regulator, in human peripheral blood cells and normal and malignant tissues. J Cell Mol Med, in press.
  • 17
    Berinstein NL, Grillo-Lopez AJ, White CA, Bence-Bruckler I, Maloney D, Czuczman M, Green D, Rosenberg J, McLaughlin P, Shen D. Association of serum Rituximab (IDEC-C2B8) concentration and anti-tumor response in the treatment of recurrent low-grade or follicular non-Hodgkin's lymphoma. Ann Oncol 1998; 9: 9951001.
  • 18
    Schledzewski K, Falkowski M, Moldenhauer G, Metharom P, Kzhyshkowska J, Ganss R, Demory A, Falkowska-Hansen B, Kurzen H, Ugurel S, Geginat G, Arnold B, et al. Lymphatic endothelium-specific hyaluronan receptor LYVE-1 is expressed by stabilin-1+, F4/80+, CD11b+ macrophages in malignant tumours and wound healing tissue in vivo and in bone marrow cultures in vitro: implications for the assessment of lymphangiogenesis. J Pathol 2006; 209: 6777.
  • 19
    Maruyama K, Ii M, Cursiefen C, Jackson DG, Keino H, Tomita M, Van Rooijen N, Takenaka H, D'Amore PA, Stein-Streilein J, Losordo DW, Streilein JW. Inflammation-induced lymphangiogenesis in the cornea arises from CD11b-positive macrophages. J Clin Invest 2005; 115: 236372.
  • 20
    Reichardt HM, Kaestner KH, Tuckermann J, Kretz O, Wessely O, Bock R, Gass P, Schmid W, Herrlich P, Angel P, Schutz G. DNA binding of the glucocorticoid receptor is not essential for survival. Cell 1998; 93: 53141.
  • 21
    Hsieh WP, Chu TM, Wolfinger RD, Gibson G. Mixed-model reanalysis of primate data suggests tissue and species biases in oligonucleotide-based gene expression profiles. Genetics 2003; 165: 74757.
  • 22
    Guiducci C, Di Carlo E, Parenza M, Hitt M, Giovarelli M, Musiani P, Colombo MP. Intralesional injection of adenovirus encoding CC chemokine ligand 16 inhibits mammary tumor growth and prevents metastatic-induced death after surgical removal of the treated primary tumor. J Immunol 2004; 172: 402636.
  • 23
    Rehli M, Sulzbacher S, Pape S, Ravasi T, Wells CA, Heinz S, Sollner L, El Chartouni C, Krause SW, Steingrimsson E, Hume DA, Andreesen R. Transcription factor Tfec contributes to the IL-4-inducible expression of a small group of genes in mouse macrophages including the granulocyte colony-stimulating factor receptor. J Immunol 2005; 174: 711122.
  • 24
    Moffatt MF. SPINK5: a gene for atopic dermatitis and asthma. Clin Exp Allergy 2004; 34: 3257.
  • 25
    Hiragun T, Peng Z, Beaven MA. Cutting edge: dexamethasone negatively regulates Syk in mast cells by up-regulating SRC-like adaptor protein. J Immunol 2006; 177: 204750.
  • 26
    Biswas SK, Sica A, Lewis CE. Plasticity of macrophage function during tumor progression: regulation by distinct molecular mechanisms. J Immunol 2008; 180: 201117.
  • 27
    Adra CN, Lelias JM, Kobayashi H, Kaghad M, Morrison P, Rowley JD, Lim B. Cloning of the cDNA for a hematopoietic cell-specific protein related to CD20 and the beta subunit of the high-affinity IgE receptor: evidence for a family of proteins with four membrane-spanning regions. Proc Natl Acad Sci USA 1994; 91: 1017882.
  • 28
    Liang Y, Tedder TF. Identification of a CD20-, FcepsilonRIbeta-, and HTm4-related gene family: sixteen new MS4A family members expressed in human and mouse. Genomics 2001; 72: 11927.
  • 29
    Donato JL, Ko J, Kutok JL, Cheng T, Shirakawa T, Mao XQ, Beach D, Scadden DT, Sayegh MH, Adra CN. Human HTm4 is a hematopoietic cell cycle regulator. J Clin Invest 2002; 109: 518.
  • 30
    Stashenko P, Nadler LM, Hardy R, Schlossman SF. Characterization of a human B lymphocyte-specific antigen. J Immunol 1980; 125: 167885.
  • 31
    Koslowski M, Sahin U, Dhaene K, Huber C, Tureci O. MS4A12 is a colon-selective store-operated calcium channel promoting malignant cell processes. Cancer Res 2008; 68: 345866.
  • 32
    Kuijpers TW, Bende RJ, Baars PA, Grummels A, Derks IA, Dolman KM, Beaumont T, Tedder TF, van Noesel CJ, Eldering E, van Lier RA. CD20 deficiency in humans results in impaired T cell-independent antibody responses. J Clin Invest 20: 21422.
  • 33
    Chavanas S, Garner C, Bodemer C, Ali M, Teillac DH, Wilkinson J, Bonafe JL, Paradisi M, Kelsell DP, Ansai S, Mitsuhashi Y, Larregue M, et al. Localization of the Netherton syndrome gene to chromosome 5q32, by linkage analysis and homozygosity mapping. Am J Hum Genet 2000; 66: 91421.
  • 34
    Spoelgen R, von Arnim CA, Thomas AV, Peltan ID, Koker M, Deng A, Irizarry MC, Andersen OM, Willnow TE, Hyman BT. Interaction of the cytosolic domains of sorLA/LR11 with the amyloid precursor protein (APP) and beta-secretase beta-site APP-cleaving enzyme. J Neurosci 2006; 26: 41828.
  • 35
    Botelho MG, Wang X, Arndt-Jovin DJ, Becker D, Jovin TM. Induction of terminal differentiation in melanoma cells on downregulation of beta-amyloid precursor protein. J Invest Dermatol 130: 140010.
  • 36
    Sosinowski T, Pandey A, Dixit VM, Weiss A. Src-like adaptor protein (SLAP) is a negative regulator of T cell receptor signaling. J Exp Med 2000; 191: 46374.
  • 37
    Szollosi J, Horejsi V, Bene L, Angelisova P, Damjanovich S. Supramolecular complexes of MHC class I, MHC class II, CD20, and tetraspan molecules (CD53, CD81, and CD82) at the surface of a B cell line JY. J Immunol 1996; 157: 293946.
  • 38
    Howie D, Nolan KF, Daley S, Butterfield E, Adams E, Garcia-Rueda H, Thompson C, Saunders NJ, Cobbold SP, Tone Y, Tone M, Waldmann H. MS4A4B is a GITR-associated membrane adapter, expressed by regulatory T cells, which modulates T cell activation. J Immunol 2009; 183: 4197204.
  • 39
    Kumar S, Boehm J, Lee JC. p38 MAP kinases: key signalling molecules as therapeutic targets for inflammatory diseases. Nat Rev Drug Discov 2003; 2: 71726.
  • 40
    Goebeler M, Gillitzer R, Kilian K, Utzel K, Brocker EB, Rapp UR, Ludwig S. Multiple signaling pathways regulate NF-kappaB-dependent transcription of the monocyte chemoattractant protein-1 gene in primary endothelial cells. Blood 2001; 97: 4655.
  • 41
    Miller AL, Webb MS, Copik AJ, Wang Y, Johnson BH, Kumar R, Thompson EB. p38 Mitogen-activated protein kinase (MAPK) is a key mediator in glucocorticoid-induced apoptosis of lymphoid cells: correlation between p38 MAPK activation and site-specific phosphorylation of the human glucocorticoid receptor at serine 211. Mol Endocrinol 2005; 19: 156983.

Supporting Information

  1. Top of page
  2. Abstract
  3. Material and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
IJC_25657_sm_suppfig1.tif755KSupporting Figure1
IJC_25657_sm_suppfig2.tif9350KSupporting Figure2
IJC_25657_sm_suppfig3.tif732KSupporting Figure3
IJC_25657_sm_supptable1.doc44KSupporting Table1

Please note: Wiley-Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.