ADAM15 to α5β1 integrin switch in colon carcinoma cells: A late event in cancer progression associated with tumor dedifferentiation and poor prognosis

Authors


Abstract

ADAM15, a member of the A Disintegrin And Metalloproteinase (ADAM) family, is a membrane protein containing an adhesion domain that binds to α5β1 integrin through a unique RGD domain. ADAM15, expressed by human normal colonocytes, is involved in epithelial wound healing and tissue remodeling in inflammatory bowel disease. The aims of our study were (i) to analyze ADAM15 expression in a series of colon carcinomas and paired normal mucosa and (ii) to integrate the spatial relationship of ADAM15 with its binding partners α5β1 integrin, a mesenchymal marker, as well as with other adhesion molecules, α3β1 integrin and E-cadherin. A series of 94 colon carcinomas of the non other specified category were graded according to the World Health Organization classification. Immunohistochemistry was performed on frozen tissue sections using antibodies directed to ADAM15, α5β1 and α3β1 integrins, and E-cadherin. ADAM15 was quantified at the mRNA level. Finally, promoter methylation of ADAM15 was examined as well as the microsatellite instability status (MSS/MSI). Thirty-six percent of colorectal carcinomas displayed a reduced expression of ADAM15 in cancer cells, confirmed at the mRNA level in most cases, without promoter methylation. ADAM15 down-regulation was associated with histologically poorly differentiated carcinomas. In addition, it was associated with the acquisition of α5β1 by cancer cells and down-regulation of α3β1 integrin and E-cadherin. Finally this profile that includes characteristic of epithelial to mesenchymal transition is a late progression event of colon cancer with a poor prognosis.

The A Disintegrin And Metalloproteinase (ADAMs) are multifunctional, membrane-bound cell surface glycoproteins, comprising more than 30 different members sharing structural similarities. They contain pro, metalloproteinase, disintegrin, cysteine-rich, EGF-like, transmembrane and cytoplasmic domains.1, 2 The catalytic metalloproteinase domain is known to mediate extracellular matrix protein degradation and ectodomain shedding of growth factors, growth factor receptors, and adhesion molecules.3 The disintegrin domain is involved in the binding to integrins, a family of heterodimeric membrane glycoproteins that play a role in cell adhesion, migration and signal transduction.4 The presence of these functional domains suggests multiple functional roles for the ADAMs in a variety of normal and pathophysiological conditions, including cancer progression.5, 6 There is increasing evidence that some ADAMs, including ADAM15, are differentially expressed in tumors7–10 and may therefore play a role in the biology of malignant cells.

ADAM15, also known as metargidin, is unique among the human ADAM family as it is the only known ADAM to contain an arginine-glycine-aspartic acid (RGD) peptide in the disintegrin domain, which binds to αvβ3 and α5β1 in an RGD-dependent manner.11, 12 Interestingly the mouse homolog of ADAM15 lacks the RGD domain. Therefore this model is not suitable for translating mechanistic studies of ADAM15 interactions with integrins. Like the disintegrin domain, the region rich in cysteine residues is also involved in adhesion. ADAM15, expressed by intestinal epithelial cells, plays a major role in intestinal inflammation including epithelial wound healing13, 14 and mucosal remodeling in inflammatory bowel disease.15 Based on the previous demonstration that ADAM15 controls adhesion and motility of colonocytes, we hypothesized that it could play a role in colon cancer morphogenesis. In fact, colon carcinoma has been long considered as a morphologically homogeneous entity encompassing moderately to well differentiated gland-forming adenocarcinomas. However, recent studies based on both morphology and genetics have revealed the heterogeneity of colon carcinoma and have established a parallel between some histologically poorly differentiated carcinomas and a specific oncogenesis.16–18

The present work describes ADAM15 expression in a series of colon adenocarcinomas, using complementary methods. In addition, it integrates its spatial relationship with its binding partners α5β1 integrin and other two major adhesion molecules α3β1 integrin and E-cadherin. Here, we show an ADAM15 to α5β1 integrin switch in colon carcinoma cells in relation with histological dedifferentiation and epithelial to mesenchymal transition.

Material and Methods

Tumor samples

Samples from 94 patients with primary colon carcinoma treated at the Department of Surgery (Centre Hospitalier Universitaire of Nantes) were snap frozen in the Biobank, then included in the study. There were 62 men and 32 women with a mean age of 67.1 (range 26–87). Fifty-four tumors originated in the right colon, 40 in the left colon. None of the patients underwent radiotherapy or chemotherapy before surgery.

The World Health Organization (WHO) Classification of tumors was used to classify the tumors.19 Our study included adenocarcinomas of Non Other Specified type, usually gland-forming carcinomas and classified as well, moderately or poorly differentiated adenocarcinomas, without mucinous differentiation. The grade was based on the percentage of the gland-like structures as follows: well differentiated (grade 1) lesions exhibited glandular structures in >95% of the tumor; moderately differentiated (grade 2) lesions had 95–50% glands; poorly differentiated (grade 3) adenocarcinomas had 5–50% glands and undifferentiated (grade 4) carcinomas had <5% glands.19

For the 94 patients studied, snap frozen tumor samples and paired normal colonic tissue taken at distance from the tumor (10 cm), were available, collected by the Biobank of Institut Régional du Cancer Nantes-Atlantique, according to the guidelines of the French Ethics Committee for Research on human tissues.

Microsatelitte instability (MSI) status

The MSI-H status was determined in 94 colon carcinomas by PCR, by amplifying the five mononucleotide markers BAT25, BAT26, NR21, NR22 and NR24, designed and validated previously.20 Briefly, the 5 mononucleotide repeats were co-amplified in a single pentaplex PCR reaction. The pentaplex PCR was performed under the following conditions: denaturation at 94°C for 2 min, 35 cycles of denaturation at 94°C for 30 sec, annealing at 57°C for 60 sec, and extension at 72°C for 60 sec. This was followed by an extension step at 72°C for 30 min. PCR products were analysed on an ABI PRISM 3100 capillary automated DNA sequencer. Genscan software (Genotyper 2.1; Applera France) was used to calculate the size of each fluorescent PCR product.

Lesions were characterized as MSI-H if they manifested instability at 2 or more loci, or microsatellite stable (MSS) if showing no instability at any loci.

To study the expression of the Mismatch Repair Proteins (MMR), tissue microarrays (TMA) were constructed. Areas representative of the main architecture of the 94 colon carcinomas were selected from hematoxylin and eosin stained sections. Four tissue cores (1mm in diameter) were obtained from each specimen, 3 from the tumor and 1 from non neoplastic tissue. Each TMA contained one core of normal placenta which served both as a control and as a regulating mark. Three μm thick sections were stained using a standard three-step streptavidin-biotine-peroxidase complex method with 3,3-diaminobenzidine as chromogen (ChemMate Streptavidin Peroxidase Kit, Dako). The following antibodies were used in fixed and deparaffinised tissue sections: hMLH1 (G168-15, BD Biosciences, Erembodegem, Belgium), hMSH2 (D06571-8, Oncogene, Cambridge, MA) and MSH6. All antibodies required antigen retrieval in a boiling citrate buffer. Lesions showing nuclear immunostaining for hMSH1, hMSH2 or hMSH6, whatever the intensity and the percentage of epithelial neoplastic nuclei stained, were considered as expressing MMR proteins.

Immunohistochemical studies

Serial sections from frozen tissue blocks were cut and stained with the primary antibodies using a three-step immunoperoxidase technique, as described by Mason and Sammons.21 Four micrometer-thick sections were dried overnight at room temperature and fixed for 10 min in acetone. After rehydratation in TBS, tissue sections were sequentially incubated for 30 min. The primary antibodies used were directed to ADAM15 extracellular domain (polyclonal, dilution 1:50, R&D system, Minneapolis, MN), α5β1 integrin (monoclonal, clone P1D6, dilution 1:50, Dako), α3β1 integrin (monoclonal, clone P1B5, dilution 1:100, Dako) and E-cadherin extracellular domain (monoclonal, clone NCH-38, dilution 1:100, Dako). The chromogen used was 3,3′-diaminobenzidine tetrahydrochloride, and tissue sections were counterstained with hematoxylin. Appropriate negative controls (omission of the primary antibody) were used throughout.

An immunolocalisation of ADAM15, α5β1 integrin, α3β1 integrin and E-cadherin expression was performed, as well as a semiquantitative evaluation comparing the expression of cancer cells with that of the paired normal colonic epithelium. Both the number of positive cells in the tumor, as well as cytoplasmic staining intensity, were taken into account. When at least 70% of cancer cells exhibited a very low staining or scored negative, the tumor was considered as down-regulated for the selected markers.

Double immunofluorescence followed by confocal microscopy was performed on 8 μm, acetone-fixed, frozen sections of colon carcinoma or normal colon, as previously reported.15 Sections were incubated for 1 hr with a mixture of the primary antibodies α5β1 (mouse, 1:20) and ADAM15 (goat, 1:50), and then for 30 min with a mixture of alexa fluor 488-conjugated chicken antimouse and alexa fluor 568-conjugated rabbit antigoat antibodies (1:500, Molecular Probes). Nuclear staining was performed with TOPRO-3 (1 μM, Molecular Probes). Imaging was performed on a Leica TCS-SP confocal microscope, using the TCS-NT software.

RNA extraction and real-time RT-PCR analysis

Total RNA was extracted from 26 carcinomas and from the paired normal colonic mucosa, using TRIZOL reagent (Invitrogen, Cergy Pontoise, France) and the Fast Prep cell disrupter (Qbiogen, Illkirch, France). Reverse transcription was performed as previously described.15 ADAM15 and β-actin mRNA were quantified using commercially available kits (TaqMan Gene Expression Assays, Applied Biosystems), as previously described.15 As several isoforms of ADAM15 exist resulting from alternative splicing that target specifically the intracellular domain,22 we chose the ADAM15 primers in the conserved extracellular domain.

Assessment of ADAM15 promoter methylation

In silico characterization of ADAM15 promoter, using software CpG island searcher,23 available online at http.//cpgis lands.usc.edu., identified a CpG island in ADAM15 promoter. To perform the methylation test on the ADAM15 promoter, a bisulfite ubiquinone treatment was performed, using the Qiampminikit, on DNA extracted from 17 cases of carcinoma and normal paired tissue including 14 carcinomas with a reduced expression of ADAM15 by immunohistochemistry and three carcinomas with a similar ADAM15 expression in cancer cells and normal mucosa. This treatment modifies all the unmethylated cytosine into uracile (which is the equivalent of thymidine), whereas the methylated cytosine is unchanged. These DNA modifications allowed us to distinguish unmethylated from methylated alleles. Then a duplex PCR was carried out for each DNA with two kinds of primers located in CpG island: one set specific for the sequence of an unmethylated promoter (NM.ADAM15.F: AACAACAACAACACTACCTACACA, NM.ADAM15.R : TGGTTTGATTGGTTTGGG, 273pb) and another set specific for the sequence of a methylated promoter (M.ADAM15.F : TTCGAGTTTTACGTGTGTC, M.ADAM15.R : CGTAAACAATATCGTCGTTAC, 151pb). These primers were designed on cytosine-rich region of the ADAM15 promoter in order to obtain different sizes of PCR products, which could be visualized together on a 6% polyacrylamide gel. The cycling process was 94°C 10 min, then 94°C 30 sec, 57°C 30 sec, 72°C 1 min for 40 cycles and finally 72°C 10 min and stepstoring at 15°C. A normal positive DNA control was obtained using a CpG methyl transferase kit (M.SssI from New England Biolabs®) according to the manufacturer's recommendations. This reaction allowed to partially methylate the DNA to obtain two amplifications products, methylated and unmethylated copies.

Statistical analyses

Chi-square test or Fisher exact test were used to test the associations between ADAM15, α5β1 integrin, α3β1 integrin and E-cadherin expression (Table 1). We also tested the associations between ADAM15, α5β1 integrin, α3β1 integrin and E-cadherin expression and the following clinico-pathological characteristics of the tumors: location of the tumor, tumor differentiation or grade, MSS/MSI status and lymph node or visceral metastases. Kaplan–Meier estimation and log-rank test were used to illustrate differences in specific cancer-mortality according to the ADAM15 expression. In the survival analysis, the starting point for the survival time was the date of surgery. Recurrence-free survival considered locoregional and distant metastasis or colon cancer specific death as the primary event, whereas contralateral events were excluded. All statistical tests were two-sided and a p-value of 0.05 was considered statistically significant.

Table 1. Immunohistochemical evaluation of ADAM15, α5β1, α3β1, and E-cadherin expression by cancer cells
inline image

Results

ADAM15 down-regulation in colon carcinomas

ADAM15 immunostaining in normal colonic mucosa

ADAM15 was expressed by all colonic epithelial cells lining the crypt and the surface. It was mainly localized at the basolateral membrane of epithelial cells and also in the cytoplasm. In addition, ADAM15 was expressed by pericryptic myofibroblasts and by the endothelial cells of mucosal capillaries (Fig. 1a).

Figure 1.

Immunohistochemical status of ADAM15 and α5β1, α3β1 integrins and E-cadherin in colon carcinomas and paired normal colonic mucosa. (a–d) In normal colon, epithelial cells strongly expressed ADAM15 (a), α3β1 integrin (c) and E-cadherin (d) but not α5β1 integrin (b). Endothelial cells (*) and smooth muscle cells (arrowhead) of the muscularis mucosae expressed ADAM15, α5β1 and α3β1 integrins. (e) In colon carcinoma, most tumor cells displayed a loss of ADAM15 expression (arrows), compared to paired normal colon (a). Note ADAM15 expression by endothelial cells (*) (positive internal control). (f) Acquisition of α5β1 integrin expression by tumor cells (arrow). (g) Reduced expression of α3β1 integrin by tumor cells (arrow), compared to paired normal epithelium (c). (h) Loss of E-cadherin expression by tumor cells (arrow), compared to paired normal epithelium (d) (ah Original magnification x 400).

ADAM15 immunostaining in colon carcinomas

In the 94 cases of carcinoma, ADAM15 immunostaining was compared to paired normal colonic mucosa using a semiquantitative evaluation (see materials and methods). ADAM15 was down-regulated in cancer cells compared to paired normal epithelial cells in 22 cases (22/94, 23%) (Fig. 1e), including nine cases (9/94, 10%) showing a complete loss of ADAM15 expression. In 72 cases (72/94, 77%), the intensity of ADAM15 staining was homogeneous and similar to that of the paired normal epithelium. In most cases, endothelial cells of the stromal reaction strongly expressed ADAM15. Finally, ADAM15-positive pericryptic myofibroblasts surrounding cancer lobules were maintained in three cases.

ADAM15 down-regulation was associated with poorly differentiated colon carcinomas

The association between the immunohistochemical pattern of ADAM15 expression and histological differentiation of carcinomas was then assessed. Six grade 1 adenocarcinomas (6/25, 24%), 11 grade 2 adenocarcinomas (11/63, 17%) and 5 grade 3 adenocarcinomas (5/6, 83%) showed a down-regulation of ADAM15 expression. ADAM15 down-regulation in cancer cells was significantly associated with high grade (Fisher exact test; p = 0.002).

Assessment of MSI status of colon carcinomas

The microsatellite status, stable (MSS) or instable (MSI), was available for 93 colon carcinomas. Seventy eight carcinomas were MSS, among which 18 displayed down-regulated ADAM15 expression (23%). Fifteen carcinomas were MSI, among which four displayed down-regulated ADAM15 expression (27%). There was no statistical difference between ADAM15 down-regulation and the MSS or MSI status.

Assessment of ADAM15 mRNA levels in colon carcinomas

We then assessed the ADAM15 mRNA levels in 26 cases including 16 cases showing a reduced expression of ADAM15 in tumor cells by immunohistochemistry, and 10 cases with a maintained ADAM15 expression. Quantitative RT-PCR was performed after RNA extraction of tumor and paired normal colonic mucosa. Eleven out of 26 cases (42%) showed a lower ADAM15 mRNA level in the tumor than in the paired normal mucosa (T < N) (Fig. 2). In four out of 26 cases (15%), ADAM15 mRNA level was similar in the tumor and the paired normal mucosa (T = N). In 11 out of 26 cases (42%), ADAM15 mRNA level was higher in the tumor than in the paired normal mucosa (T > N) (Fig. 2). Interestingly, among the 11/26 cases showing ADAM15 down-regulation at the mRNA level (T < N group), nine cases (9/11, 82%) also displayed a down-regulated ADAM15 immunostaining in cancer cells. In the T = N group, two cases (50%) displayed down-regulated ADAM15 expression in cancer cells by immunohistochemistry. In the T > N group, 5 cases (5/11, 45%) displayed down-regulated ADAM15 expression in cancer cells by immunohistochemistry (Fig. 2).

Figure 2.

ADAM15 mRNA levels in colon carcinomas. For quantitative RT-PCR analysis of ADAM15, total RNA was extracted from 26 carcinomas and their paired normal colonic mucosa (see material and methods). We included 16 cases showing a reduced ADAM15 expression in tumor cells by immunohistochemistry and 10 cases with a maintained expression of ADAM15 (*). ADAM15 mRNA levels were normalized relative to β-actin levels (see materials and methods). For each case, results are expressed as the Tumor/Normal (T/N) ratio.

Assessment of ADAM15 promoter methylation

Using bioinformatics, we identified a CpG island in ADAM15 promoter -1155 pb to +426 relative to the transcription start site of NM_;207197, a finding in line with a recent report.23 This CpG island is 1582 bp in length with an ObsCpG.ExpCpG of 0.775 and a CG percentage of 67.4 % according to CpGplot obtained with CpG-island-extraction algorithm.24, 25 This CpG island encompasses the first exon of ADAM15. This predicted CpG island contains a critical transcription-supporting element described previously as regulatory sequence of ADAM15 transcription.23

Seventeen cases of carcinoma and normal paired tissue were examined, including 14 carcinomas with a reduced expression of ADAM15 by immunohistochemistry and three carcinomas with a similar ADAM15 expression in cancer cells and normal mucosa. Methylation of the ADAM15 promoter assessed by Methylation Specific Polymerase Chain Reaction (MSP PCR) was never observed in the 17 cases studied (Fig. 3, showing three representative cases).

Figure 3.

Analysis of ADAM15 promoter methylation in colon carcinomas. Products of the duplex PCR on DNA extracted from tumor (lanes 4, 6, 8) and paired normal tissue (lanes 5, 7, 9) of three patients showing an ADAM15 down-regulated expression by immunohistochemistry. Lane 1: DNA ladder VI Roche® (MW); Lane 2: methylated/unmethylated positive control. Lane 3: unmethylated positive control.

Association of ADAM15 down-regulation in colon carcinomas with altered expression of adhesion molecules

ADAM15 down-regulation is associated with ectopic expression of α5β1 integrin by colon cancer cells

As previously described,15 the α5β1 integrin, ligand of ADAM15, was absent from normal epithelial cells. It was expressed by pericryptic myofibroblasts, endothelial cells of mucosal capillaries and smooth muscle cells of the muscularis mucosae (Fig. 1b).

The α5β1 integrin was expressed by a fraction of neoplastic epithelial cells in 18 colon carcinomas (18/94, 19%) (Fig. 1f). It was a cytoplasmic and membranous staining. Among these 18 carcinomas, ADAM15 was down-regulated in nine cases. The association between the ADAM15 down-regulation in cancer cells and ectopic expression of α5β1 integrin was statistically significant (χ2 test, p = 0.003).

The ectopic expression of α5β1 integrin was observed in 2 grade 1 adenocarcinomas (2/25, 8%), 14 grade 2 adenocarcinomas (14/63, 22%) and in 2 grade 3 adenocarcinomas (2/6, 33%).

Finally, double immunofluorescence staining followed by confocal microscopy supported the concept of an ADAM15 to α5β1 integrin switch in a fraction of cancer cells (Fig. 4).

Figure 4.

Demonstration of the ADAM15 to the α5β1 integrin switch in colon carcinoma cells. Double immunostaining of α5β1 (green) and ADAM15 (red) was performed on frozen sections of normal colon (upper panel) and adenocarcinoma (lower panel), and examined by confocal microscopy, as described in materials and methods. Nuclei appear in blue. In normal colon, epithelial cells, which express ADAM15 at their basolateral membranes, do not express α5β1. In a carcinoma with a down-regulated ADAM15 expression, some ADAM15-negative tumor cells express α5β1 (dotted circles). α5β1 is also strongly expressed by myofibroblasts (arrowheads) and endothelial cells (*) of the normal colonic mucosa, and by endothelial cells of the tumor desmoplastic reaction (*). The area corresponding to the fluorescent staining, stained with hematein eosin, shows carcinoma cells and a vascular channel in the stroma (*) (Original magnification × 400).

Concomitant down-regulation of ADAM15 and α3β1 integrin in colon cancer cells

As previously described,26 the α3β1 integrin was expressed by all normal colonic epithelial cells lining the crypt and the surface, mainly at the basolateral membrane. It was also expressed by endothelial cells of mucosal capillaries and smooth muscle cells of the muscularis mucosae (Fig. 1c).

The α3β1 integrin was down-regulated in the epithelial cells in 11 carcinomas (11/94, 12%) (Fig. 1g). Among these 11 tumors, ADAM15 was down-regulated in all cases. The concomitant down-regulation of ADAM15 and α3β1 integrin in cancer cells was statistically significant (χ2 test, p < 0.0001).

The down-regulation of α3β1 integrin expression was observed in 1 grade 1 adenocarcinoma (1/25, 4%), 6 grade 2 adenocarcinomas (6/63, 10%) and in 4 grade 3 adenocarcinomas (4/6, 67%).

Concomitant down-regulation of ADAM15 and E-cadherin in colon cancer cells

As previously described,27 E-cadherin was expressed by all normal colonic epithelial cells lining the crypt and the surface (Fig. 1d).

E-cadherin was down-regulated in epithelial cells in 12 carcinomas (12/94, 13%) (Fig. 1h). Among these 12 cases, ADAM15 was down-regulated in 8 cases. The concomitant down-regulation of ADAM15 and E-cadherin in cancer cells was statistically significant (χ2 test, p < 0.0001).

The down-regulation of E-cadherin was observed in 8 grade 2 adenocarcinomas (8/63, 13%) and in 4 grade 3 adenocarcinomas (4/6, 67%). It was never observed in grade 1 adenocarcinomas.

Interestingly, E-cadherin down-regulation in cancer cells was associated with reduced expression of α3β1 integrin (χ2 test, p < 0.0001).

Down-regulation of ADAM15 expression was associated with advanced tumors

Of 94 CRCs, clinicopathologic information was available from all cases. No significant differences were observed for location of the tumors among any of the subgroups. The study cohort included 49 colon cancers with lymph nodes metastases and 45 colon cancers without ganglion metastasis. Tumors in the down-regulation of ADAM15 expression subset were more frequently associated with lymph node metastases than tumors with normal ADAM15 expression (χ2 test: p = 0.08). The study cohort contained 6 stage I, 29 stage II, 35 stage III and 24 stage IV colon carcinomas. Among these four subsets of colon carcinomas, stage IV tumors i.e. associated with visceral metastases were significantly associated with down regulation of ADAM 15 expression (p = 0.05). During follow up of 85 patients who where eligible for survival analysis, there were 22 deaths attributed to colorectal cancer. Cancer specific-mortality was higher in patients with tumors showing a down regulation of ADAM15 compared to patients with tumors showing a normal expression of ADAM15. During the follow up period, 10 of 20 (50 %) patients died of cancer in ADAM 15 down regulation group (median of overall survival = 26.8 months) whereas 12 of 65 (18.5 %) patients died of cancer in ADAM15 normal group. The down regulation of ADAM15 in epithelial neoplastic cells of colon adenocarcinomas not other specified was statistically associated with a shorter overall survival (log rank test; p = 0.03) (Fig. 5).

Figure 5.

Overall survival of 85 patients eligible for this estimation according to the presence or absence of ADAM15 down regulation in their colon adenocarcinoma (log rank test: p = 0.03). Nine patients were excluded from our study because of absence of follow-up (two patients) or death from a contralateral event (seven patients).

Discussion

Our study is the first to assess ADAM15 expression in a series of colon carcinomas, using both immunohistochemistry and mRNA quantitative methods. We observed a reduced expression of ADAM15 associated with a loss of differentiation in a subset of colon carcinomas. At the molecular level, this loss of ADAM15 expression was associated with a specific molecular pattern, combining the reduced expression of adhesion molecules (i.e., E-cadherin and α3β1 integrin) and the acquisition of α5β1 integrin by neoplastic cells.

This is the first demonstration of ADAM15 down-regulation in colon carcinoma cells. To our knowledge, there is only one recent report of ADAM15 down-regulation in cancer, dealing with melanoma metastases.28 Our demonstration was based on two methods, immunohistochemistry and mRNA quantitative analysis. As antibodies used were directed to ADAM15 extracellular epitopes and integrins, we decided to perform the immunohistochemistry on frozen sections. ADAM15 being an ubiquitous protein, the immunohistological study allowed to focus on variations of its expression in epithelial cells, both normal and cancerous. Immunohistochemistry showed ADAM15 down-regulation in 23% of colon adenocarcinomas of Not Other Specified type (WHO), this result being confirmed by RNA quantification. In a minority of cases, however, ADAM15 reduced expression as determined by immunohistochemistry was associated with an up-regulation at the mRNA level, which can be accounted for by an abundant stromal reaction, including myofibroblasts, within the tumor. As several reports mention an up-regulation in different types of carcinomas, including gastric, breast and prostatic carcinomas,7–10 it is suggested that the role of ADAM15 in cancer progression is tissue-specific.

As (i) promoter methylation is known to regulate the expression of some ADAMs29 and (ii) our in silico study, as well as a recent report,23 have shown a CpG site of methylation in the ADAM15 promoter, we were prompted to examine the attractive hypothesis that reduced expression of ADAM15 was due to promoter methylation. Our results clearly showed that promoter methylation was not involved in reduced ADAM15 expression. Moreover, no association was found between ADAM15 expression and MSS/MSI status. Further studies are needed to find out the mechanisms of this down-regulation.

ADAM15 down-regulation in colon carcinomas could confer migratory properties to cancer cells. This is in line with the recent demonstration that in Caco-2 cell line ADAM15 over-expression blocks wound healing.13, 14 In addition, we were prompted to examine in depth the context of ADAM15 down-regulation in colon carcinomas of Not Other Specified type (WHO). Interestingly, we observed a significant association of ADAM15 reduced expression with histologically poorly differentiated carcinomas.

α5β1 is an integrin present on mesenchymal cells in adult tissue that binds to ADAM15 expressed by epithelial cells via its RGD domain.12 This binding has been recently shown to mediate tissue remodeling in inflammatory bowel diseases15 and in wound healing.13, 14 Interestingly, our finding of acquisition of this mesenchymal marker by epithelial tumor cells raises the issue of its role in cancer biology. In fact, α5β1 is known to confer migratory properties30 as well as resistance to apoptosis.31 Interestingly, its over-expression in colon cancer cell lines was associated with a high tumorigenicity.32 Finally, α5β1 expression was recently shown to be involved in the biological effects of carcinoembryonic antigen (CEA).33 Both α5β1 integrin and CEA are expressed specifically in embryonic colonic epithelium, disappear during adult life and are re-expressed in colon cancer cells.34

Together, our findings of an association of ADAM15 down-regulation with histologically poorly differentiated carcinoma, and acquisition of a mesenchymal marker by cancer cells, strongly suggested the involvement of an epithelial to mesenchymal transition in cancer morphogenesis. To explore this issue we examined the expression of two adhesion molecules, i.e., E-cadherin and α3β1 integrin, known to be down-regulated during epithelial to mesenchymal transition.35 In fact, E-cadherin is normally involved in intercellular adhesion of epithelial cells, and α3β1 integrin is involved in epithelial cell adhesion to the extracellular matrix.36 Our demonstration of a down-regulation of both adhesion molecules together with ADAM15 reduced expression and α5β1 acquisition by colon cancer cells is consistent with a new model of colon cancer morphogenesis: this model of neoplastic development involves the loss of adhesion molecules, the acquisition of migratory properties and resistance to apoptosis. Interestingly, the genetic manipulation of ADAM15 expression level in the human colon cancer cell line Caco-2 has led to the concept that ADAM15 downregulation influences positively cell migration.13 These properties are shared by tumor cells at the invasion front of some colon cancers, referred to as tumor budding,37–39 and by histologically poorly differentiated colon carcinomas as illustrated by this article. Interestingly, these newly described mechanisms of cancer morphogenesis could be targeted by specific biotherapies.38, 40

Finally, parallel with the acquisition of characteristics of transition of epithelial to mesenchyma, we found that ADAM15 down-regulation was a late event in colon cancer progression, associated with metastases and shorter overall survival. In conclusion, based on ADAM15 determination by immunohistochemistry, we were able to define among the colon adenocarcinomas of Non Other Specified type a subset of carcinomas that could justify a more aggressive and / or a targeted therapy.

Acknowledgements

The authors thank C. Deleine and G. Landeau-Trottier for expert technical assistance, and the “Photologie” Department for their help.

Ancillary