SEARCH

SEARCH BY CITATION

Keywords:

  • Egr-1 promoter;
  • TRAIL;
  • gene therapy;
  • radiotherapy;
  • tumor;
  • apoptosis;
  • adenovirus

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and Methods
  5. RESULTS
  6. Discussion
  7. Acknowledgements
  8. References

The p53 tumor suppressor pathway is impaired in more than 90% of cervical cancers and cancer-derived cell lines as a result of infection by human papillomavirus (HPV). The HPV E6 oncoprotein forms complexes with p53 and promotes its degradation via ubiquitin-dependent mechanism. In our study, we attempted to improve the clinical outcomes of this combined therapy by modifying the p53-targeted adenovirus to become radiation-responsive. The antitumor adenovirus was constructed by inserting a radiation-responsive expression cassette composed of the promoter of early growth response-1 (Egr-1) and the proapoptotic protein TRAIL. We showed that the addition of adenovirus containing Egr-1/TRAIL significantly increased cell death and apoptosis caused by radiotherapy. In mice bearing xenograft tumors, intratumoral administration of the Egr-1/TRAIL adenovirus followed by radiation significantly reduced tumor growth and enhanced tumor survival. Our Egr-1/TRAIL adenoviral gene product may offer a novel “one-two punch” tumor therapy for cervical cancers not only by potentiating radiation treatment but also by preserving p53 defect-specific tumor killing of the oncolytic adenovirus.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and Methods
  5. RESULTS
  6. Discussion
  7. Acknowledgements
  8. References

Cervical cancer is the second most common malignancy affecting women worldwide.1 The prognosis is generally poor for patients with recurrent or locally advanced malignancies.2, 3 Currently, radiotherapy remains the primary therapy for those patients who are not candidates for surgery. Curative therapy often requires high doses of radiation that increase the risk of injury to normal tissues, leading to high morbidity and even mortality. Because side-effects caused by radiotherapy are usually dependent on the total radiation dosage, it would be desirble to develop new approaches that enhance sensitivity to radiation treatment.

A promising approach for improving radiosensitivity involves the use of radiation-inducible promoters to activate therapeutic gene expression confined to the restricted radiation field.4 Early growth response-1 (Egr-1), a zinc finger transcription factor,5, 6 functions as a transcriptional regulator by triggering de novo transcription in many types of cells in response to diverse external stimulation, including radiation.7, 8 The Egr-1 protein binds to a specific DNA sequence, CGCCCCCGC, in the presence of zinc ions9 and transactivates genes that mediate cell growth and angiogenesis. The Egr-1 promoter possesses six CArG boxes, which correspond to the radiation-inducible element.7 Therefore, the Egr-1 promoter could be used effectively in gene therapy combined with radiation for regulating the expression of tumor-sensitive genes within the targeted region.4, 10 The combination of gene therapy and radiation may enhance apoptosis inducibility and cytotoxicity.

Adenoviral drug H101, designed to target the mutated p53 in tumors, has been approved in China primarily for topical treatment of several malignancies,11 including cervical cancer. H101 is an E1B55K, E3-deleted serotype 5 adenovirus that specifically lyses tumor cells by targeting inactivated p53. Adenoviral replication requires the inactivation of p53 by the viral E1B55KD protein. In H101, both E1B55K and part of E3 are deleted to selectively infect and kill tumor cells through viral oncolysis, but the drug has no significant cytopathic effects on normal cells that contain wild type p53.12

Cervical neoplasia is etiologically associated with infection by human papilloma virus (HPV).13 More than 90% of cervical cancers contain HPV DNA, notably HPV type 16.14, 15 The HPV virus contains two genes, E6 and E7, which are capable of transforming normal cells into tumor cells. The E6 protein specifically interacts with P53, resulting in the rapid ubiquitin-dependent degradation of P53,16 whether p53 gene is mutated or not. The lack of functional p53 protein renders these cancer cells vulnerable to the oncolytic adenovirus therapy. Thus, adenoviral drugs designed to target the impaired p53 may be an ideal gene therapy for cervical cancers.

In our study, we aimed to enhance combined gene therapy and radiation therapy by incorporating the Egr-1 promoter/TRAIL therapeutic cassette in the backbone of an E1B55K-/E3-deleted oncolytic adenovirus. TRAIL is a potent anti-cancer protein that causes little toxicity in normal tissues. In this adenoviral delivery system, the TRAIL gene is expressed from the Egr-1 promoter that augments transgene expression from radiation exposure without losing target specificity. This combined therapeutic approach permitted a reduced radiation dose and led to increased efficacy of the anti-tumor therapy.

Material and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and Methods
  5. RESULTS
  6. Discussion
  7. Acknowledgements
  8. References

Cell lines and cell culture

Human uterine cervical cancer cell line Hela-S3 that has impaired p53 activity was purchased from the American Type Culture Collection (ATCC, VA). Two p53-imparied cervical cancer cell lines (SiHa and C-33A) were kindly provided by Dr. Nicholas Denko (Stanford University Medical School). A normal fibroblast cell line WSF1 was cultured from human fetal skin in our lab.17 All cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal bovine serum, 1% glutamine and 1% antibiotics.

Human cervical keratinocytes were cultured in the lab. The growth medium for keratinocytes was composed of HAM F12 and DMEM (Gibco) 1:3 (v/v) supplemented with 20 pg/ml adenine, 5 pg/ml insulin, 0.5 pg/ml hydrocortisone, 0.1 nM choleratoxin, 10 ng/ml EGF, 5 pg/ml transferrin, 1.5 ng/ml triiodothyronine (Sigma St Louis, MO) and 10% fetal calf serum (FCS) (Invitrogen, CA).

Construction of vectors

The pcDNA3 plasmid (Invitrogen, Carlsbad, CA) was used as the basic vector to establish all downstream plasmid constructs. The Egr-1 promoter was cloned by amplifying a 500 bp PCR product from pBlue-Egr (previously cloned in our lab) using the following primers: 5′-GGAAGATCTCGCCGACCCGGAACCGCCATATAA-3′ and 5′-CGGGGTACCCAAGTTCTGCGCGCTGGGATCTCTC-3′. To construct the Egr-1 promoter/reporter vector (pcDNA3-Egr-GFP), the enhancer region of the cytomegalovirus gene promoter in pcDNA3-CMV-GFP was replaced with the Egr-1 promoter using the BglII and KpnI sites at the polylinker site. Luciferase cDNA was excised from pGL3-Basic (Promega, WI) and cloned as a KpnI/XbaI fragment into the corresponding sites in pcDNA3-CMV-GFP and pcDNA3-Egr-GFP to create pCMV-luc and pEgr-luc vectors. The TRAIL gene was excised from pcDNA3-TRAIL and cloned as a KpnI/XbaI fragment into the corresponding sites in pcDNA3-Egr-GFP to create the pcDNA3-Egr-TRAIL vector. The Egr-TRAIL from pcDNA3-Egr-TRAIL was cloned as a BglII/XbaI fragment into pGL3-Basic to create pGL3-Egr-TRAIL.

To construct a new antitumor adenovirus, the Egr-1 promoter was cloned into the pENTER12-TRAIL (Minghong Biotech, China) to generate pENTER12-Egr-TRAIL. The Egr-1/TRAIL cassette was then inserted into the E3-deleted region of the Ad5 vector pPE3-ccdB (Minghong Biotech, China) using Gateway LR Clonase (Invitrogen, CA). The resulting pPE3-Egr/TRAIL vector was used for packaging the oncolytic adenovirus as described.18 After packaging, the Egr-1/TRAIL expression cassette was incorporated in the E3- region of a H101-like oncolytic adenoviral backbone (Fig. 1a). An oncolytic control adenovirus (Ad-GFP) was constructed by inserting the pCMV-EGFP cassette in the viral backbone. A positive control adenovirus (Ad-CT) was also constructed that contained the pCMV-TRAIL cassette. Commercial oncolytic adenovirus H101, kindly provided by Sunway Biotech (Shanghai, P.R. China), was used as the positive control in the study.

thumbnail image

Figure 1. Construction and characterization of Ad-ET and viral DNA replication in Hela-S3 cells. (a) Schematic comparison of the radiation-inducible Egr-1/TRAIL oncolytic adenovirus, the wild type Ad5 and oncolytic adenovirus H101. In H101, deletion of E1B 55K and part of E3 (black box) allows it to be replicated only in tumor cells that have the inactivated p53. In Ad-ET, the radiation-responsive Egr-1/TRAIL therapeutic cassette is inserted into the deleted E3 to preserve the p53 defect-specific tumor killing. (b) Comparison of viral DNA replication in Hela-S3 cells infected with Ad-ET and H101. Viral DNA replication was determined by real-time PCR quantification of the adenoviral late Hexon gene. For comparison, the Hexon mRNA at 24 hr after H101 infection was arbitrarily set as 1, and GAPDH was used as the internal control in the calculation.

Download figure to PowerPoint

Adenoviral production and infection

Adenoviruses were commercially packaged and purified by Minghong Biotech (Shanghai, China) in 293 cells by cotransfecting pPE3-Egr/TRAIL DNA and shuttle vector PXC20-deltaE1b55KDda (Minghong Biotech, China). Adenovirus from a single plaque was identified by PCR amplification and sequenced to confirm the proper incorporation of the Egr-1/TRAIL cassette. Virus titers were determined by tissue culture infectious dose 50 (TCID50) assays. Titers determined by TCID50 assay were used in subsequent experiments. Cervical cancer cells were infected with purified adenovirus as previously described.19 The transduction efficiency of adenovirus vectors was detected under fluorescent microscopy in Hela-S3 cells with a reporter adenovirus (Minghong Biotech, China), which is an E1-/E3-deleted replication-defective adenovirus containing the pCMV-EGFP cassette.

Luciferase assay

The pEGR-luc vector was transfected into Hela-S3 cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Transfected cells were lysed with reporter lysis buffer and assayed for luciferase activity in a Lumat LB9501 luminometer with luciferase assay reagent (Promega, Madison, WI). To correct for transfection efficiency, the β-galactosidase gene driven by the pSV40 promoter (pSVβ-Gal) was cotransfected in each experiment and the cotransfected β-Gal activity was used to calibrate the actual luciferase unit as previously described.20

Radiation (RAD) therapy

For in vitro studies, cells were irradiated at a dose rate of 2.5 Gy/min using a linear accelerator (ELEKTA Precise Treatment System, Elekta Co., UK). Samples were collected at different time intervals after the irradiation exposure. For in vivo studies, mice were restricted in a special capsule. Gross tumor volume was delineated accurately by CT (HiSpeed NX/i, GE), and CT-localized tumors were irradiated using an X-ray source (5 Gy × 3 = 15 Gy) from the Precise Treatment System (Elekta Co., UK); doses of 40–60 Gy are commonly used in cervical cancer radiotherapy.21

Cell growth inhibition

Cell growth was analyzed by quantitatively measuring cell viability using the CCK-8 assay (Cell Counting Kit-8; Dojindo Laboratories, Japan). Cells were plated in 96-well microtiter plates and infected with Ad-GFP, Ad-ET, or Ad-CT adenovirus at 100 MOI. After 24 hr incubation, cells were irradiated with an electron beam of 12 Gy or different doses of radiation (2–16 Gy). Cell growth and viability were assayed 72 hr after incubation with CCK-8 kit, and absorbance was measured at 450 nm against a reference wavelength of 630 nm in MRX microplate reader (Dynatech Laboratories, VA). Each experiment was performed in quadruplicate and repeated at least twice.

Apoptosis assay

Hela-S3 cells (2 × 105) were plated into 24-well plates and were then treated with Ad-GFP or Ad-ET adenovirus at 100 MOI. After 24 hr of exposure to Ad-GFP or Ad-ET, the cells were irradiated with 12 Gy of radiation. Two days after treatment, cells were harvested and resuspended in 100 μl of binding buffer (Pharmingen, San Diego, CA). Apoptotic and total cells were stained by Annexin V-fluorescein isothiocyanate (FITC or PE) and propidium iodine, respectively, after the protocol of Pharmingen Apoptosis Detection Kit (BD Biosicences, CA) and analyzed using the Becton Dickinson FACScan flow cytometer along with the CellQuest program (Becton Dickinson). Ten thousand events were acquired for each analysis.

Western blot analysis

After the treatment of Ad-ET and radiation, the upregulated TRAIL and caspase proteins were quantitated by western blotting using the method as previously described.19 Antibodies against the following were used: TRAIL (Santa Cruz Biotechnologies, CA), Caspase 3, 8 and GAPDH (Cell Signaling Technology, Danvers, MA).

Tumor xenograft model in nude mice

Tumor xenografts were established by subcutaneous injection of 5 × 106 Hela-S3 cells into the right flank of 4–6 week-old female athymic nude mice. Average tumor volume was measured by the formula: volume = length × width2 × 0.5. The Ad-ET plus RAD group received intratumoral injections of Ad-ET adenovirus at 1 × 108 plaque forming units on days 1, 2, 3 and X-ray irradiation with 5 Gy on days 2, 3, 4. The control group mice received three injections of PBS only; the remaining groups (Ad-GFP+RAD, Ad-GFP) received the same treatment schedule as delineated above. The tumor size was measured by vernier calipers every 3 days. Animal experiments were performed in accordance with institutional guidelines for animal care by Shanghai Jiao Tong University.

In a separate study to examine the survival, tumor death was recorded in each group. In some cases, animals were euthanized in accordance with our animal protocol when animals were morbid (the tumor size reached >1000 mm3 or >10% of body weight). In the later case, the death was recorded as the date of euthanizing.

Real-time PCR

After infection with Ad-ET or H101 (MOI 100), Hela-S3 cells were harvested at 24, 48 and 72 hr for the measurement of in vitro adenovirus replication. Primers used for amplifying Hexon were ATGATGCCGCAGTGGTCTTA (sense) and GTCAAAGTACGTGGAAGCCAT (antisense). To detect TRAIL expression in vivo, some mice were sacrificed on the second day after the last RAD. Total RNA was extracted using Trizol reagent (Invitrogen). First-strand cDNA was synthesized with RNA reverse transcriptase as described.22, 23 Quantitative real-time RT-PCR amplification was performed using QuantiTect SYBR green (Qiagen, Valencia, CA) as previously described.24 Primers for amplifying TRAIL and GAPDH mRNA were as follows: TRAIL sense: GAGCTGAAGCAGATGCAGGAC and TRAIL antisense: TGACGGAGTTGCCACTTGACT, GAPDH sense: CATCAAGAAGGTGGTGAAGCAGG and GAPDH antisense: AGCGTCAAAGGTGGAGGAGTGG. The CT (threshold cycle) value of TRAIL was quantitated by Q-PCR in triplicate using an ABI Prism 7900 HT sequence detector (AB Applied Biosciences, CA) following the manufacturer's protocol and was normalized over the CT of the GAPDH control.

Immunohistochemical staining

To immunohistochemically stain TRAIL protein and adenoviral fiber protein, tumor and neighboring tissue samples were fixed in 10% formalin and embedded in paraffin for staining. Tumor or tissue sections were incubated at 4°C overnight with a goat antihuman TRAIL antibody (Santa Cruz Biotechnologies, Santa Cruz, CA) or a mouse antiadenovirus fiber antibody (Abcam, Boston, MA) at a dilution of 1:50. Sections were rinsed in PBS-T (0.05% Triton X-100 in PBS), followed by the addition of biotinylated donkey antigoat or goat antimouse secondary antibody at a 1:500 dilution for 1 hr at room temperature. Slides were subsequently incubated with streptavidin-horseradish peroxidase (BD Biosciences) and diaminobenzidine substrate to develop the colorimetric reaction.

TUNEL assay

To stain apoptotic cells, tumor samples were fixed with 10% formaldehyde and paraffin-embedded sections were prepared. These sections were stained using the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end-labeling (TUNEL) technique (In Situ Cell Death Detection Kit, POD, Roche, Germany) and were then counterstained with hematoxylin to quantitate the apoptosis rate.

Statistical analysis

All experiments were performed in triplicate, and the data were expressed as mean ± SD. The comparative Ct method was applied in the quantitative real-time RT-PCR assay according to the delta-delta Ct method. The data were analyzed with Student's t-test or by one-way analysis of variance, and results were considered statistically significant at p ≤ 0.05.

RESULTS

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and Methods
  5. RESULTS
  6. Discussion
  7. Acknowledgements
  8. References

Adenoviral replication in Ad-ET infected tumor cells

The new antitumor adenovirus containing the Egr-1/TRAIL cassette was constructed on the basis of the backbone of the p53-specific oncolytic adenovirus (Fig. 1a). We first tested whether the apoptosis induced by TRAIL would interfere with viral replication and thereby reduce the therapeutic effect of the oncolytic adenovirus. Hela-S3 cells were infected with Ad-ET or H101. Viral DNA replication was determined by real-time PCR for the adenoviral late gene hexon. Ad-ET treatment for 48 hr increased hexon mRNA by more than two fold as compared with H101 (Fig. 1b). Thus, TRAIL actually enhances DNA synthesis of the oncolytic adenovirus, although the specific mechanism is not clear.

Cytotoxicity of Hela-S3 tumor cells by the combined treatment of the Egr-1/TRAIL adenovirus and radiotherapy

We then determined the appropriate radiation dose that activated the Egr-1 promoter in vitro using the luciferase reporter system. Hela-S3 cells were transfected with luciferase reporter vectors (pEGR-luc or pCMV-luc) and were then irradiated. Radio-inducible promoter activity in pEGR-luc transduced cells was standardized as relative light units over the positive control pCMV-luc transduced Hela-S3 cells. As seen from Figure 2a, radiation at 12 Gy gave the strongest luciferase activity.

thumbnail image

Figure 2. Egr-1 promoter activity and growth inhibition in Hela-S3 cells. (a) Radiation-inducible Egr-1 promoter activity. Hela-S3 cells were transduced with pcDNA3-CMV-luc or pcDNA3-EGR-luc and irradiated using an Elekta linear accelerator. To select the optimal radiation dose for Egr-1 promoter, the luciferase activity in pcDNA3-EGR-luc transduced cells was converted to relative light units by standardizing using the positive control pcDNA3-CMV-luc transduced Hela-S3 cells. Values are means of the ratio of (pcDNA3-EGR-luc-pcDNA3-CMV-luc)/pcDNA3-CMV-luc. Bars: standard deviation. (b) Radiation dose-dependent cell killing after treatment of adenovirus. (c) Hela-S3 Cell inhibition by the combined therapy. Cell viability was standardized using PBS-treated control cells with their viability set at 100. **p < 0.01 as compared to the nonradiated Ad-ET group. RAD: radiation; Ad-ET: pEgr-1/TRAIL; Ad-CT: pCMV/TRAIL.

Download figure to PowerPoint

We further treated Hela-S3 cells with adenovirus Ad-ET or Ad-GFP and radiation and measured cell survival. In agreement with the luciferase assay, we found that the best cell killing was achieved with radiation dose >12 Gy (Fig. 2b).

We were interested in examining whether Ad-ET treatment would significantly enhance the antitumor effects of radiotherapy in tumor cells. For this purpose, we intended to select appropriate doses of oncolytic adenovirus that would not cause significant cell death when administered alone. We tested various MOIs (10, 20, 50, 100, 150 and 200) in combination with 12 Gy of radiation in Hela-S3 cells and found that MOI >100 had similar cell growth inhibition (data not shown). Thus, MOI 100 was selected for all studies to reduce the toxicity to normal cells. Cervical cancer Hela-S3 cells with impaired p53 activity were infected with adenoviruses at MOI 100 and were then treated with radiation. As seen from Figure 2c, Hela-S3 cells exhibited a moderate reduction in cell survival when treated with either adenovirus or radiation (RAD) alone, including H101. However, a significant inhibition of cell growth was noticed in tumor cells that received treatment with Ad-ET plus radiation, indicating anticancer augmentation of the Ad-ET combined therapy. The extent of cell inhibition by Ad-ET/radiation was comparable to that by positive control Ad-CT, in which TRAIL is driven by the most potent CMV promoter.

Growth inhibition in cells with varied p53 activity

We further examined growth inhibition in cells that have varied p53 activity. Like Hela-S3, SiHa cells have impaired p53 activity as the result of the expression of the HPV E6 oncoprotein.16 C-33A is a p53-mutated cervical tumor cell line. In contrast, normal human fibroblast WSF1 and cervical keratinocytes each contain a normal p53 gene.

We found that both WSF1 cells and cervical keratinocytes did not significantly respond to combination Ad-ET and radiation therapy (Figs. 3a, 3b). In contrast, the cervical cancer cell lines C-33A and SiHa showed a remarkable inhibition following the combined therapy. This was especially true in C-33A cervical cancer cells, where the combined therapy significantly killed nearly all tumor cells.

thumbnail image

Figure 3. Growth inhibition of the combined therapy on human cell lines with varied p53 activity. Bars: standard deviation. **p < 0.01 as compared to the nonradiated Ad-ET group.

Download figure to PowerPoint

Enhanced apoptosis by combined Ad-ET and radiotherapy

We further examined cell apoptosis in Hela-S3 cells following the combined gene and radiation therapy. As seen in Figure 4a, irradiation alone induced apoptosis in 9% of Hela-S3 cells as compared to 4.6% of PBS-treated cells. Infection of Hela-S3 cells with Ad-GFP and Ad-ET at MOI 100 induced cell apoptosis at rates of 2.5% and 9.4%, respectively. However, the degree of apoptosis more than quadrupled (41.3%, p < 0.01) when Ad-ET and radiation (RAD) were administered together (Figure 4b). These data suggest that Ad-ET greatly sensitizes cells to radiation by enhancing Hela-S3 cell apoptosis.

thumbnail image

Figure 4. Apoptosis induction and activation of the apoptotic signal transduction pathway by the combination of Ad-ET and radiotherapy in vitro. (a) Apoptosis as measured by flow cytometric analysis after combined treatment of TRAIL gene therapy and radiotherapy. Note: apoptosis in the Ad-GFP groups was quantitated by Annexin-PE to avoid overlapping fluorescence. (b) Apoptotic rates in treatment groups as quantitated from (a). Each bar represents the mean ± SD. **p < 0.01, compared to apoptotic percentage of the Ad-ET group. (c) Western blot analysis of TRAIL, caspase-8 and caspase-3 in Hela-S3 cells. GAPDH was used as an internal control. Each product band was scanned, standardized over GAPDH and expressed as fold increase using PBS as 1.

Download figure to PowerPoint

Activation of the apoptotic signal transduction pathway in Hela-S3 cells

To further elucidate the apoptotic signal transduction pathway used by Ad-ET and radiotherapy, we evaluated the activation of TRAIL, caspase-8 and caspase-3 in transfected cells. As expected, treatment with Ad-ET mono-therapy resulted in some cleavage of caspase-8 and caspase-3 (lane 5, Fig. 4c). Ad-ET plus radiation not only markedly enhanced TRAIL and caspase expression but also activated the cleavage of caspase-8 and caspase-3 (lane 6, Fig. 4c). These results suggest that apoptosis is produced by the combination of TRAIL therapy and radiation.

Combined treatment of Ad-ET and radiation inhibits tumor growth in vivo and prolongs mouse survival

We then examined whether intratumoral administration of the Egr-1/TRAIL adenovirus was able to potentiate the therapeutic efficacy of irradiation in xenograft tumors. Although SiHa and C-33A cell lines showed the best response to the Ad-ET/RAD therapy (Fig. 3), we used Hela-S3 cells for the tumor study as our previous work showed that this tumor cell line responded well to dual therapy of p53-targeted oncolytic adenovirus H101 and Bcl2 RNAi.19 Recently, we also showed that a synthetic Bcl2 microRNA synergized with gene therapy in this cell line.25

Hela-S3 tumor xenografts were established in 4–6 week-old female athymic nude mice. After 2 weeks, animals received an intratumoral injection of Ad-ET adenovirus and/or irradiation. After the entry into the study, the control mice that received PBS demonstrated a robust growth of tumors. Mono-therapies showed a slight shrinkage of tumors. However, the combination of Ad-ET and radiation significantly inhibited tumor growth as compared to PBS control, mono-therapies (radiation, Ad-ET, Ad-GFP) and Ad-GFP plus radiation (p <0.05). At the end of study, Ad-ET/RAD produced a significant tumor inhibition (Fig. 5a).

thumbnail image

Figure 5. Antitumor activity of the Ad-ET combined with radiotherapy in Hela-S3 xenograft models. (a) Average volume of subcutaneous tumors after receiving various treatments. Values represent the means ± SD for eight animals per group. **p < 0.01, compared to tumor volume of the Ad-ET group. (b) Percentage of animal survival analyzed by the Kaplan-Meier method.

Download figure to PowerPoint

The long-term therapeutic effect of the combined treatment was examined by measuring animal survival in a separate animal study. Again, there was a significant prolongation of survival associated with the combination of Ad-ET and radiation (Fig. 5b). By 145 days after treatment, 62.5% of the animals in the Ad-ET/RAD group were alive and relatively healthy. In contrast, all of the animals in PBS control group, mono-therapy groups (radiation, Ad-ET and Ad-GFP) and Ad-GFP/RAD group had died. At the end of the study, we examined the metastatic tumors and found that none of the animals in the Ad-ET/RAD group had metastases to axillary lymph nodes. In contrast, all other groups had some metastatic tumors in axillary lymph nodes. These findings demonstrate that the combination of Ad-ET and radiation produced markedly improved antitumor outcomes in vivo. We did not observe significant treatment-related toxicities that affected the body weight of the mice or their general behavior.

TRAIL expression and apoptotic cells in tumors

To better understand the mechanism underlying the enhanced antitumor activity, we measured the expression of radio-inducible TRAIL and apoptosis in tumors. TRAIL mRNA transcripts were very low in the groups treated with PBS, Ad-GFP, radiation and Ad-GFP/RAD. There was a low baseline expression of the TRAIL RNA in Ad-ET animals. However, TRAIL expression in the Ad-ET/RAD group was significantly induced by radiation as compared to that in the Ad-ET group (p < 0.01) (Fig. 6a).

thumbnail image

Figure 6. Enhanced TRAIL expression and apoptosis in vivo by the combined Ad-ET and radiotherapy. (a) TRAIL expression determined by real-time RT-PCR quantification. For comparison, the mRNA expression in PBS group was arbitrarily set as 1, and GAPDH was used as the internal control in the calculation. **p < 0.01: compared to TRAIL mRNA expression of the Ad-ET group. (b) TRAIL expression as measured by immunohistochemical staining (upper panel) and cell apoptosis by TUNEL assay (lower panel) in tumors after receiving the last treatment. Original magnification: ×400. (c) Detection of adenoviral replication in nontargeted organs. The spread of adenovirus type 5 particles was determined by immunohistochemical detection using antiadenoviral fiber antibody. Original magnification: ×200.

Download figure to PowerPoint

TRAIL proteins were also measured by immunohistochemical staining in a selection of tumor samples collected on day 6 after treatment (upper panel, Fig. 6b). Again, TRAIL protein was observed at low levels in the pathological sections derived from animals treated with Ad-ET or radiation (RAD) alone. However, in the pathological section treated by Ad-ET/RAD, TRAIL protein expression markedly increased.

In agreement with TRAIL expression, TUNEL assay revealed large numbers of apoptotic cells in tumors treated with Ad-ET/RAD (lower panel, Fig. 6b). In animals that received monotherapies, apoptotic cells were sparsely distributed in the section. Thus, the efficacy of tumor therapy was closely related to the enhanced apoptosis induced by the combined Ad-ET and radiotherapy.

We also used immunohistochemistry to detect adenoviral fiber protein in nontargeted organs. As seen in Figure 6c, no adenovirus particles were detected in muscle, uterus, kidney, heart, liver and lung. The data suggest that Ad-ET replication is locally restricted in p53-impaired tumors and will not replicate in normal tissues that have normal p53 activity.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and Methods
  5. RESULTS
  6. Discussion
  7. Acknowledgements
  8. References

We initiated a series of studies designed to enhance the efficacy of tumor gene therapy. Oncolytic adenovirus H101, which has been clinically approved in China to treat malignancies, specifically lyses tumor cells by targeting the inactivated p53 in tumors. Viral E1B55K, encoding a 55 kDa protein (E1B 55K) that binds and inactivates p53 in infected cells, is essential to virus replication. In H101 oncolytic adenovirus, both E1B55K and part of E3 regions are deleted, so that the virus selectively infects and kills tumor cells through viral oncolysis.12 In the absence of E1B55K, H101 is incapable of lysing normal cells that carry wild type p53. Cervical cancers can be treated with an oncolytic adenovirus as the function of p53 is often impaired as a result of ubiquitin-dependent degradation of P53 by HPV E6 oncoprotein.16

In an attempt to improve H101 antitumor efficacy, we previously demonstrated that H101 therapy was potentiated by concomitant use of a siRNA that targets Bcl2, a gene which is over-expressed in many malignant tissues. Using this combination therapy in mice bearing a human tumor xenograph, we showed that all treated animals survived and that some animals were tumor-free after this therapy.19

In clinical applications, p53-based therapeutic strategies are often combined with conventional cancer therapies to minimize development of therapy resistance. In this proof-of-concept study, we incorporated a radio-inducible promoter of Egr-1 and TRAIL into the backbone of an E1, E3-deleted adenovirus. Using the human uterine cervix-derived cancer cell line Hela-S3 as a model, we showed that this combined therapy significantly increased cell death (Fig. 3) and apoptosis (Fig. 4) caused by radiotherapy in vitro. In the xenograft model, intratumoral injection of the Egr-1/TRAIL adenovirus plus radiation significantly reduced tumor growth (Fig. 5a) and markedly prolonged survival when compared to radiation therapy alone (Fig. 5b).

Several mechanisms may account for the observed enhanced therapeutic effects of the combined TRAIL and radiation therapy. TRAIL and radiation activate distinct apoptotic pathways. By binding to its cell surface receptors, TRAIL activates caspase-8 and subsequently caspase-3 through the Fas-associated death domain adapter complex, resulting in activation of a cascade of caspase-mediated apoptosis.26, 27 In contrast, radiation directly damages DNA and triggers apoptosis via the mitochondrial release of cytochrome c.28–30 Thus, it is possible that the combined therapy of TRAIL with radiation may potentially deliver greater apoptotic signals in cancer by activating both mitochondrial-dependent and mitochondrial-independent pathways.

Alternatively, ionizing radiation may improve viral transfection/transduction efficiency and transgene expression,31–33 although the specific mechanisms are still unclear. In a recent study to demonstrate the increased efficacy of simultaneously targeting two genetic abnormalities in a given tumor,19 we showed that RNAi knockdown of Bcl2 increased amplification and spread of oncolytic adenovirus in tumors. Recently, Yoon et al.34 demonstrated that the chemotherapeutic drug cisplatin significantly enhanced the number of adenovirus particles in tumor tissues. Similarly, Abou El Hassan et al.35 showed that paclitaxel increased viral gene expression in infected tumors. A similar mechanism may underlie the enhanced viral replication observed in our study. It is possible that lysis of tumor cells by radiation may release more viral progeny that can infect nearby tumor cells, allowing spread of adenoviral infection. Thus, enhanced adenovirus oncolysis may partially explain the increased antitumor efficacy in our combined therapeutic approach.

In summary, our results provide important preclinical data for the future design of multimodality clinical testing using oncolytic adenoviral drugs combined with radiotherapy. The combination of the Egr-1/TRAIL adenovirus and radiotherapy may be a feasible and effective therapy, particularly for radiation-resistant cancers. In our system, the Egr-1/TRAIL can be regulated by ionizing radiation in a temporal, spatial and dose-dependent manner. Controlling therapeutic TRAIL expression ensures a high level of specificity and safety in this treatment plan.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and Methods
  5. RESULTS
  6. Discussion
  7. Acknowledgements
  8. References

H.W. was supported by Fellowship from China Scholarship Council. This work was supported by The National Key Program for Basic Research of China (2010CB529902, 2010CB834201), The Science and Technology Commission of Shanghai (10JC1409100) to G.Q; The National Natural Science Foundation of China (10979034, 10935009), The Shanghai Leading Academic Discipline Project (S30205), The Innovation Program of Shanghai Municipal Education Commission (09ZZ110) to S.G; and NIH grant (1R43 CA103553-01) and Department of Defense Grant (W81XWH-04-1-0597) to J.H., and the Medical Research Service of the Department of Veterans Affairs.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and Methods
  5. RESULTS
  6. Discussion
  7. Acknowledgements
  8. References