SEARCH

SEARCH BY CITATION

Keywords:

  • transforming growth factor-β2 signaling;
  • Smad2;
  • syndecan-2;
  • cell adhesion;
  • fibrosarcoma

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Experimental Procedures
  5. Results
  6. Discussion
  7. REFERENCES
  8. Supporting Information

Fibrosarcoma is a rare malignant tumor originating from fibroblasts. Transforming growth factor beta 2 (TGFβ2) has been established to regulate processes correlated to fibrosarcoma tumorigenesis. In this study, we investigated the possible participation of syndecan-2 (SDC-2), a cell membrane heparan sulfate (HS) proteoglycan on these TGFβ2 functions. Our results demonstrate that the inhibition of SDC-2 expression by short interfering RNA (siSDC2) abolished TGFβ2-dependent HT1080 cell adhesion (P ≤ 0.01). In parallel, the downregulation of SDC-2 significantly inhibited TGFβ2-induced Smad2 phosphorylation (P ≤ 0.01). The immunoflourescence signal of TGF receptor III as well as its protein expression was decreased in SDC-2-deficient cells. The enhancement of adhesion molecules integrin β1 (P ≤ 0.01) and focal adhesion kinase expression, induced by TGFβ2 treatment (P ≤ 0.001), was markedly inhibited in SDC-2-defficient cells (P ≤ 0.01). Conclusively, the obtained data suggest that SDC-2 modulates TGFβ2 transcriptional regulation via Smad signaling to facilitate fibrosarcoma cell adhesion. © 2013 IUBMB Life, 65(2)134–143, 2013


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Experimental Procedures
  5. Results
  6. Discussion
  7. REFERENCES
  8. Supporting Information

Transforming growth factor beta 2 (TGFβ2) is a member of the TGFβ superfamily, which holds a central position in the signaling networks that control cells' final fate (1). There are three mammalian TGFβ isoforms (TGFβ1, 2, and 3), with TGFβ1 being the most abundant in tissues. Specifically, TGFβ isoforms regulate a myriad of biological processes including cell proliferation, differentiation, adhesion, development, tissue repair, immunosuppression, and tumor suppression (1–3). The role of TGFβ signaling is ambivalent in oncogenesis as during tumor progression TGFβ can switch roles from tumor suppressor to potent tumor promoter (3). TGFβ factors initiate signaling by assembling receptor complexes of type I, II, and in some cases III (TGFRI, TGFRII, and TGFRIII or betaglycan) that activate Smad transcription factors (4). Upon binding to ligands, TGFRII transphosphorylates TGFRI propagating downstream signaling (4). The most well-characterized role for TGFRIII is that of a TGFβ superfamily coreceptor that directly binds ligands, including TGFβ 1, 2, and 3. In most cases, the ability of TGFRIII to present ligand increases their binding to their respective cognate type I and type II TGFβ superfamily receptors to enhance their signaling through the Smad proteins with specific roles in cancer progression (5). The ability of TGFRIII to present a ligand is particularly important for some TGFβ superfamily ligands, for example, TGFβ2 as this ligand cannot bind its cognate receptor, on its own (6). Some reports suggest, however, that overexpression of TGFRII can compensate the obligatory participation of betaglycan in the presentation of TGFβ2 (7). Betaglycan contains heparan sulfate (HS) or chondroitin sulfate chains whose contribution to TGFβ-related signaling is not completely understood, as its protein core was found to specifically bind TGFβ without participation of its glycosaminoglycan chains (5). Syndecan-2 (SDC-2) one of four mammalian members of a transmembrane HS-proteoglycan family is suggested to affect TGFβ1 activity in fibroblasts (8).

Fibrosarcomas are rare malignant tumors originating from fibroblasts. They are often characterized with abundant ECM deposition (9), which was shown in cell culture to have a high turnover (10, 11). TGFβ signaling is suggested to have a complex role in fibrosarcoma cells' tumor biology. Thus, when mouse fibrosarcoma cells were treated with antisense oligos specific for TGFβ1, their invasive and metastatic properties were significantly decreased (12). Along the same lines, TGFβ1 was reported to enhance platelet-aggregating ability as well as to induce the adhesive molecule, podoplanin expression in human fibrosarcoma HT1080 cells (13); whereas, TGFβ2 was demonstrated to regulate the pericellular matrix formation in HT1080 cells (14). Conversely, TGFβ1 was found to modulate the net balance of the matrix metalloproteinases (MMPs) / tissue inhibitors of matrix meatalloproteinases (TIMPs) systems in HT1080 cells in a manner inhibitory to their invasive and migratory abilities by augmenting TIMP-1 through extracellular signal-regulated kinases (ERK) 1/2 pathway and Sp1 transcription factor activity (15). Furthermore, invasion of 3T3-L1, mouse fibrosarcoma cells was found to be dependent on TGFβ regulation of specific genes expression (16). The above data demonstrate the versatility of TGFβ-regulated processes in fibrosarcoma tumorogenesis and highlight the importance of understanding the fine modulations of TGFβ-respective signaling pathways. In this study, we focused on the mechanisms of TGFβ2 action on fibrosarcoma cell adhesion. Our results clearly demonstrate that TGFβ2 regulates fibrosarcoma cell adhesion in a manner dependent on SDC-2 and through Smad-dependent downstream signaling.

Experimental Procedures

  1. Top of page
  2. Abstract
  3. Introduction
  4. Experimental Procedures
  5. Results
  6. Discussion
  7. REFERENCES
  8. Supporting Information

Cell Culture

The human fibrosarcoma cell line HT1080 (17) was used in this study. Cells were cultured at 37 °C and humidity of 5% v/v CO2. The culture medium used was Dulbecco's Modified Eagle Medium (DMEM) (Biochrom, KG, Germany) supplemented with fetal bovine serum (FBS) 10% (v/v) (Gibco, CA). Prior to treatment with TGFβ2 (10 ng/ml; R&D Diagnostics, MN) during 48 h, cells were cultured in serum-free DMEM for 24 h. The specific treatment was chosen in accordance with previous studies showing transcriptional/functional response of HT1080 cells in this concentration range (13–15).

RNA Isolation and Real-Time PCR

The TRIzol method (Gibco) and the DyNAmo cDNA synthesis kit (Finnzymes, Vantaa, Finland) were used for mRNA extraction and cDNA synthesis, respectively. Primers were designed to be mRNA specific (SDC-2: F 5′ GGGAGCTGATGAGGATGTAG 3′, R 5′CACTGGATGGTTTGCGTTCT3′; GAPDH: F 5′ GGAAGGTGAAGGTCGGAGTCA 3′, R 5′ GTCATTGATGGCAACAATATCCACT 3′; integrin β1: F 5′ TCCCACTGGTCCAGACATTCC 3′ R 5′ CCATATCAGCAGTAATGCAAGGCCAATA 3′; focal adhesion kinase [FAK]: F 5′ GTGCTCTT GGTTCAAGCTGGAT 3′ R 5′ ACTTGAGTGAAGTCAGCAAGATGTGT 3′). QuantiTech SYBR Green master mix (Qiagen, CA) was used for the real-time polymerase chain reaction (PCR) reaction (20 μl reaction volume) and performed by an M3300P cycler. The quantity of each target was normalized against the quantity of glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Western Blotting

Cells were harvested using Radio Immunoprecipitation Assay Buffer (RIPA) solution. The samples were electrophoresed on 8% polyacrylamide Tris/Glycine gels and transferred to nitrocellulose membranes (10 mM (3-(cyclohexylamino)-1-propanesulfonic acid [CAPS]; linear formula: C6H11NH(CH2)3SO3H; C2632 by Sigma, St. Louis, MO), pH 11, containing 10% methanol). Membranes were blocked and incubated for 1 h at room temperature (RT) with primary antibodies (SantaCruz, CA; dilution 1:200), anti-pSmad (sc-101801), anti-Smad2, (sc-6200), anti-actin (sc-1616), anti-SDC-2 (sc-9492), anti-FAK (sc-557), anti-integrin β1 (sc-59829), anti-TGFβRI (sc-9048), anti-TGFβRII (sc-33929), anti-TGFβRIII (sc-74511), anti-SDC-2 (36-6200, Invitrogen, CA), anti-Δ-HS-antibody (F69-3G10, Seikagaku, Japan), and anti-pFAK (MAB1144, Millipore, MA). The immune complexes were detected after incubation with the appropriate peroxidase-conjugated secondary antibody (1:2,000) with the SuperSignalWest Pico Chemiluminescent substrate (Pierce, IL).

Transfection with siRNA

Short interfering RNA (siRNA) specific for SDC-2 (18) and a scrambled siRNA as a negative control (Invitrogen) were used as previously described (19). The optimal siRNA concentration (100 nM) and duration of transfection (48 h) were chosen after pilot experiments (data not shown). In short, the cells (6 × 104/well) were placed on a 24-well plate for 24 h. To provide for optimal transfection, siRNA (100 nM; Invitrogen) and Lipofectamine 2000 (1 μl; Invitrogen) were first diluted separately in 50 μl Opti-MEM I Reduced Serum Medium (Invitrogen). After a 5-min incubation period, 50 μl diluted Lipofectamine 2000 was mixed with 50 μl diluted siRNA per well on 24-well plates and were left for 20 min at RT to allow siRNA–liposome complexes to form. The lipofectamine and siRNA mix was added to the cell, and the plate was shaken gently. Transfection was allowed to take place during a 6 h period when the medium was replaced with fresh serum-free medium containing antibiotics, and treatments were performed for further 48 h. At this time point, the cells were harvested and used for RNA and protein extraction as well as for the adherence assay. All transfection experiments were repeated at least three times and performed in triplicates.

Cell Adherence Assay

The used adhesion assay was performed as previously described (19, 20). Briefly, 5,000 cells/well were seeded onto the fibronectin (FN)-coated 96-well plates for 30 min. Prior to the adhesion assay, HT1080 cells were cultured and treated as described in Cell Culture section. The number of adherent cells was measured using the CyQUANT fluorometric assay (Molecular Probes, Invitrogen, CA) according to the manufacturer's instructions. Fluorescence was measured in a Fluorometer (BioTek, Vermont) using the 480/520 nm excitation and emission filters. For converting sample fluorescence values into cell numbers, a reference standard curve was created, using serial dilutions of sample with known cell number. All adhesion experiments were repeated at least three times and performed in triplicates.

Immunofluorescence

HT1080 cells were seeded on round coverslips placed in 24-well plates whereupon; the treatments were added for 48 h at 37 °C and 5% CO2. Briefly, as described in detail (19), the cells were fixed, permeabilized before the addition of primary anti-TGFRI antibody (sc9048, SantaCruz), primary anti-TGFRII antibody (sc33929, SantaCruz), primary anti-TGFRIII antibody (sc75411), SantaCruz), for 1 h at RT. The coverslips were incubated for 1 h, in the dark at RT, with anti-goat Alexa Fluor 488 (Invitrogen). TO-PRO-3 diluted 1:1,000 in deionized H2O was applied for 10 min to stain nuclei. Actin filaments were detected using fluorescent phalloidin (Molecular Probes) diluted 1:100 in PBS for 40 min. The coverslips were then placed onto slides using glycerol as a mountant and visualized using confocal microscopy, as previously described (19, 20).

Statistical Analysis

The statistical significance was evaluated by Student's t-test or one-way ANOVA with Tukeys post-test, using GraphPad Prism (version 4.0) software.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Experimental Procedures
  5. Results
  6. Discussion
  7. REFERENCES
  8. Supporting Information

SDC-2 is Essential for TGFβ2-Induced Adherence to FN

HT1080, poorly differentiated and highly metastatic human fibrosarcoma cell line (17), was treated with TGFβ2, endogenously expressed by these cells (14), for 48 h and their adhesive ability was estimated by a specific adhesion assay. As shown in Fig. 1A, TGFβ2 specifically upregulates the FN-dependent adhesion of fibrosarcoma cells (P ≤ 0.01). Transfection of HT1080 cells with SDC-2 siRNA (siSDC2) during 48 h resulted in up to 95% inhibition of SDC-2 mRNA expression (P ≤ 0.001) and a significant twofold decrease (P ≤ 0.01) in SDC-2 protein expression, relative to cells treated with the control siScr (Figs. 1B–1D). In control experiments where cell lysates were treated with heparitinase (0.001 unit/ml; Seikagaku, Tokyo, Japan) to digest HS chains and consecutively probed with an antibody specific for SDC-2 protein core, it was shown that HT1080 cell SDC-2 protein is partially glycosylated (Supporting Information Figs. 1A–1C). Importantly, SDC-2-deficient cells did not respond to TGFβ2 stimulation when adhering on FN as compared to control siScr (P ≤ 0.01; Fig. 1A). SDC-2 did not affect the basal ability of HT1080 to adhere which correlates well with a previous report (21) and appears to be a characteristic of tumor cells as SDC-2 promotes integrin-mediated adhesion of fibroblasts (22, 23) These data suggest that SDC-2 is a direct mediator of TGFβ2-dependent fibrosarcoma cell adhesion.

thumbnail image

Figure 1. (A) Effect of SDC-2 on TGFβ2-dependent fibrosarcoma cell adhesion. HT1080 SDC-2 (siSDC2) transfected cells and scramble (siScr) transfected cells were treated with TGFβ2 (10 ng/ml) for 48 h before harvesting and reseeding for 30 min on 96-well plates coated with FN. The number of attached cells was determined using fluorometric CyQUANT Assay Kit (Molecular Probes). (B) Transfection with siRNA. Inhibition of SDC2 mRNA expression of HT1080 cells was verified by real-time PCR as compared to siScr and 0% controls. (C) Western blotting for SDC2 protein expression inhibition compared to siScr and 0% controls. Representative blot of dimeric SDC2 protein (∼50 kDa) and SDC2 protein core (∼22 kDa) is presented. (D) SDC2 protein bands were densitometrically analyzed and adjusted against actin. The results represent the average of three separate experiments in triplicate. Means ± SEM plotted; statistical significance: **P ≤ 0.01; ***P ≤ 0.001 among control and respective treatments.

Download figure to PowerPoint

SDC-2 Affects TGFβ2 Downstream Smad Activation

Smad2 is a major TGFβ downstream pathway restricted effector (4). Therefore, in continuation, we examined the role of SDC-2 on basal and TGFβ2-dependent Smad2 phosphorylation levels by treating siSDC2-transfected HT1080 cells with TGFβ2 (10 ng/ml) for 24 h. As shown in Fig. 2, the expected TGFβ2-dependent upregulation of Smad2 phosphorylation levels was inhibited in SDC-2-deficient cells (P ≤ 0.05), demonstrating that SDC-2 participates in TGFβ2 pathway restricted signaling in fibrosarcoma cells. It is of note that Smad2 protein expression was not affected by any of the treatments (Fig. 2).

thumbnail image

Figure 2. Effect of SDC-2 on TGFβ2-dependent Smad activation. (A) HT1080 siSDC2 transfected cells, siScr transfected cells, siSDC2 transfected cells treated with TGFβ2 (10 ng/ml), siScr transfected cells treated with TGFβ2 (10 ng/ml) and TGFβ2 (10 ng/ml) were harvested and equal amounts of cell extract protein blotted against phosphorylated Smad2 (pSmad2) and total Smad2 using specific antibodies. Representative blots are presented. (B) Specific pSmad2 and Smad2 protein bands were densitometrically analyzed and adjusted against actin. The results represent the average of three separate experiments. Means ± SEM plotted; statistical significance: *P ≤ 0.05 among control and respective treatments.

Download figure to PowerPoint

The Effect of SDC-2 on TGFRI, II, and III Expression/Distribution

TGFβ factors initiate signaling by assembling receptor complexes of type I, II and in some cases III (4). Since, betaglycans' role in presenting TGFβ2 to respective receptors and in consecutive downstream signaling is suggested to be obligatory (6), we examined the effect of SDC-2 downregulation on TGFRI, II, and III expression/distribution in fibrosarcoma cells. Real-time PCR demonstrated that downregulation of SDC-2 did not significantly affect TGFRI, II, and III expression (data not shown). Western blotting, however, showed a significant decrease in TGFRIII protein expression (P ≤ 0.01) in SDC-2-deficient cells; whereas, TGFRI and II protein expressions were not altered (Fig. 3). These data were supported by immunoflourescence studies demonstrating that downregulation of SDC-2 decreased the total specific TGFRIII signal and facilitated its cytoplasmic distribution (Fig. 4). No changes in the intensities of TGFRI and II signals were observed (Fig. 4). Next, we examined possible effects of SDC-2 on fibrosarcoma cell actin cytoskeletal arrangement. Rhodamine-conjugated phaloidin staining was used for F-actin detection. Confocal miscroscopy demonstrated that SDC-2-deficient cells had altered actin cytoskeleton organization with more disorganized actin stress fibers (Fig. 5). These alterations, however, were not correlated to changes in these cells' basal adhesion as presented above and as previously demonstrated (21). In control experiments, SDC-2-deficient cells were shown to have upregulated (P ≤ 0.05) SDC-4 expression levels (Supporting Information Fig. 2), which is well correlated to their mutually compensatory functional roles (24). In view of the fact that SDC-4 also functions as an adhesion molecule, these data could partly account for the observed insensitivity of HT1080 cells' adhesion ability to changes in SDC-2 expression (24). Conclusively, therefore, these results suggest that SDC-2 regulates bioavilability of TGFRIII in HT1080 cells.

thumbnail image

Figure 3. Effect of SDC-2 on TGFRI, II, and III expression. HT1080 just media control (0%), siSDC2 transfected cells, and siScr transfected cells were harvested and equal amounts of cell extract protein blotted against: (A) TGFRI, (B) TGFRII, and (C) TGFRIII using specific antibodies. Representative blots are presented and all specific protein bands were densitometrically analyzed and adjusted against actin. The results represent the average of three separate experiments. Means ± SEM plotted; statistical significance: **P ≤ 0.01 compared to controls.

Download figure to PowerPoint

thumbnail image

Figure 4. Effect of SDC-2 on TGFRI, II, and III distribution. HT1080 siSDC2 transfected cells, siScr transfected cells, and cells just cultured in media were seeded onto round coverslips, fixed, permeabilized, and then stained using specific anti TGFRI (Bi–Di), anti TGFRII (Bii–Dii), and anti TGFRIII (Biii–Diii) antibody. The nuclei were stained using TO-PRO-3. The signals against TGFRI, II, III, and TO-PRO-3 were superimposed. (Ai, Aii, and Aiii) Negative controls; (Bi, Bii, and Biii) cells in media; (Ci, Cii, and Ciii) siScr transfected cells; (Di, Dii, and Diii) siSDC2 transfected cells. Slides were analyzed by confocal microscopy and pictures were taken using ×63 magnification. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Download figure to PowerPoint

thumbnail image

Figure 5. Effect of SDC-2 on actin polymerization. HT1080 cells (A) cultured in media, (B) siScr transfected, and (C) siSDC2 transfected were seeded onto round coverslips, fixed, permeabilized, and then stained using phaloidin to visualize actin filaments. The nuclei were stained using TO-PRO 3. The signals against actin filaments and TO-PRO-3 were superimposed. Slides were analyzed by confocal microscopy and pictures were taken using ×63 magnification. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Download figure to PowerPoint

SDC-2 Modulates TGFβ2 Downstream Transcriptional Regulation of Integrin β1 and FAK

Integrins, and particularly β1, have been demonstrated to be fibrosarcoma cell membrane receptors participating in adhesion onto the FN substrate (25). HT1080 cells treated with TGF-β2 were found to have increased β1 integrin protein (Figs. 6A and 6B) (P ≤ 0.05) as well as mRNA expression (P ≤ 0.001) (Fig. 6C). Conversely, SDC-2-deficient cells treated with TGF-β2 had lower expression of β1 integrin both at protein (P ≤ 0.01) and mRNA level (P ≤ 0.01) as compared to control siScr cells (Figs. 6A–6C). Recently, TGF-β1 was reported to mediate FAK gene transcription via stimulatory and inhibitory Smad binding elements in an epithelial cell model (26). FAK, a major adhesion molecule, is closely correlated to integrin signaling (27, 28). In this study, TGF-β2 treatment strongly stimulated FAK mRNA (P ≤ 0.001; Fig. 7D) levels followed by increased FAK protein expression (P ≤ 0.05) in fibrosarcoma cells (Figs. 7A and 7B). SDC-2 downregulation did not affect basal FAK transcriptional levels but inhibited TGF-β2-dependent FAK transcriptional (P ≤ 0.05) and translational regulation (P ≤ 0.05) as well as FAK phosphorylation at Tyr 397 site (P ≤ 0.01) (Fig. 7). These results demonstrate that SDC-2 modulates TGFβ2-dependent regulation of β1 integrin and FAK expression through the modulation of TGF-β-Smad transcription axis in HT1080 fibrosarcoma cells.

thumbnail image

Figure 6. Effect of SDC-2 on TGFβ2-dependent integrin β1 expression. (A) siSDC2 and scramble siScr transfected HT1080 cells were treated with TGFβ2 (10 ng/ml) for 24 h, harvested and equal amounts of cell extract protein blotted against integrin β1 specific antibody. Representative blots are presented. (B) Specific integrin β1 protein bands were densitometrically analyzed and adjusted against actin. (C) Expression of integrin β1 was quantified by real-time PCR. The results represent the average of three separate experiments in triplicate. Means ± SEM plotted; statistical significance *P ≤ 0.05; **P ≤ 0.01; ***P ≤ 0.001 among control and respective treatments.

Download figure to PowerPoint

thumbnail image

Figure 7. Effect of SDC-2 on TGFβ2-dependent FAK expression. (A) siSDC2 and scramble siScr transfected HT1080 cells were treated with TGFβ2 (10 ng/ml) for 24 h, harvested and equal amounts of cell extract protein blotted against phosphorylated FAK (pFAK) and total FAK using specific antibodies. Representative blots are presented. (B) Specific FAK protein bands were densitometrically analyzed and adjusted against actin. (C) Specific pFAK protein bands were densitometrically analyzed and adjusted against FAK and actin. (D) Expression of FAK was quantified by real-time PCR. The results represent the average of three separate experiments. Means ± SEM plotted; statistical significance *P ≤ 0.05; **P ≤ 0.01; ***P ≤ 0.001 among control and respective treatments.

Download figure to PowerPoint

The Effect of TGFβ2 on SDC-2 Expression

Real-time PCR as well as Western blotting revealed that TGFβ2 upregulated (P ≤ 0.05) SDC-2 expression at both the mRNA and protein levels (Fig. 8). These data suggests that a positive feedback mechanism between TGFβ2 signaling and SDC-2 expression exists in HT1080 cells.

thumbnail image

Figure 8. Effect of TGFβ2 on SDC-2 expression. (A) HT1080 cells treated with TGFβ2 (10 ng/ml) for 24 h were harvested and mRNA extracted. Expression of SDC2 was quantified by using real-time PCR. (B) HT1080 cells treated with TGFβ2 (10 ng/ml) for 48 h were harvested and equal amounts of cell extract protein blotted against SDC-2 using a specific antibody. Representative blot of dimeric SDC2 protein (∼50 kDa) and SDC2 protein core (∼22 kDa) is presented (C) SDC-2 protein bands were densitometrically analyzed and adjusted against actin. The results represent the average of three separate experiments. Means ± SEM plotted; statistical significance *P ≤ 0.05 among control and respective treatments.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Experimental Procedures
  5. Results
  6. Discussion
  7. REFERENCES
  8. Supporting Information

TGFβ signaling pathways participate in fibrosarcoma tumorigenesis (12–16). In this study, TGFβ2 was found to strongly enhance the ability of the highly malignant HT1080 cells to adhere on the FN substrate; function immediately associated to fibrosarcoma cell invasion (29). The transmembrane heparan sulfate proteoglycan (HSPG), SDC-2 was earlier suggested to be a possible coreceptor for TGFβ1 in renal fibroblasts (8), facilitating the prosclerotic activity of TGF-beta1 after unilateral nephrectomy (30). In this study, SDC-2 was shown to be a direct mediator of TGFβ2-dependent fibrosarcoma cell adhesion. Interestingly, when we examined the role of SDC-2 on the activation of Smad 2, the main TGFβ downstream mediator, SDC-2 was found to facilitate its phosphorylation. SDC-2 is indicated to take part in the TGF-receptor complex, as it coprecipitates with TGFRIII and GIPC (a PDZ domain-containing protein) (8, 31). Moreover, when overexpressed in fibroblasts, this HSPG is suggested to modulate their respective TGFRI, II, and III cell surface expression; specifically stimulating TGFRI and II and decreasing TGFRIII membrane presentation (8). Since, HT1080 fibrosarcoma cells already express relatively high amounts of SDC-2 (21), we opted for a downregulation strategy. Interestingly, immunoflourescence revealed a markedly decreased TGFRIII protein signal in SDC-2-deficient cells which was corroborated by decreased protein expression. These changes in protein expression were not followed by alterations in SDC-2 mRNA levels. Furthermore, SDC-2-deficient cells had less organized actin stress fibers, previously correlated to TGFR membrane presentation (32). Total levels of cell membrane receptors are regulated by multiple processes including synthesis, cleavage, internalization, and turnover. Indeed, a high level of complexity in the regulation of TGFRIII expression is indicated, and as TGFRIII can bind to several classes of TGF β superfamily ligands, it is not surprising that the functional impact of this receptor appears to be both context- and cell-type dependent (5, 8). Therefore, SDC-2 is suggested to modulate TGFRIII membrane presentation in fibrosarcoma cells. Previously, the presence of TGFRIII on the cell surface among other was shown to increase the binding of the TGFβs to their type II receptors and to increase ligand efficacy in biological assays (6, 33). This effect is most pronounced for TGFβ2, which binds poorly to the TGFRII in the absence of TGFRIII (6, 33). Therefore, it appears that SDC-2 promotes ligand–receptor complex formation which finally results in more efficient Smad2 activation and downstream signaling in fibrosarcoma cells. Moreover in this study, SDC-2 was demonstrated to regulate TGF-dependent transcription of FAK and integrin β1, two gene products mutually strongly correlated to fibrosarcoma cells' ability to adhere onto FN (26, 34). Namely, during FAK activation, integrin β1 cytoplasmic domain can interact with its' FERM domain which is associated with a conformational change of FAK allowing rapid autophosphorylation of Y397 and activation of signaling pathways correlated among other to adhesion (as reviewed in ref. 28). This transcription regulatory role of SDC-2 correlates well with recent evidence postulating the involvement of SDC-2 in fibrosarcoma tumorigenesis. Thus, SDC-2 was shown to regulate the tumorigenic activities of HT1080 fibrosarcoma cells including migration, invasion, and apoptotic activity through a FAK-dependent mechanism (21). Furthermore, SDC-2 was required for FN-extracellular matrix deposition by these cells (35). It is worthwhile to note that in this study we show an upregulation of SDC-2 expression by TGFβ2 suggestive of a feedback positive circuit powered by TGFβ2.

Based on the above, we show a SDC-2/TGFβ2/Smad2 transcriptional axis and postulate that SDC-2 is a key mediator of TGFβ2-dependent fibrosarcoma cells' functions with possible therapeutical implications.

REFERENCES

  1. Top of page
  2. Abstract
  3. Introduction
  4. Experimental Procedures
  5. Results
  6. Discussion
  7. REFERENCES
  8. Supporting Information
  • 1
    Massague, J., Blain, S. W., and Lo, R. S. ( 2000) TGFbeta signaling in growth control, cancer, and heritable disorders. Cell 103, 295309.
  • 2
    Whitman, M. ( 1998) Smads and early developmental signaling by the TGFbeta superfamily. Genes Dev. 12, 24452462.
  • 3
    Inman, G. J. ( 2011) Switching TGF beta from a tumor suppressor to a tumor promoter. Curr. Opin. Genet. Dev. 21, 9399.
  • 4
    Massague, J. ( 1998) TGF-beta signal transduction. Annu. Rev. Biochem. 67, 753791.
  • 5
    Bilandzic, M. and Stenvers, K. L. ( 2011) Betaglycan: a multifunctional accessory. Mol. Cell. Endocrinol. 339, 180189.
  • 6
    Lopez-Casillas, F., Wrana, J. L., and Massague, J. ( 1993) Betaglycan presents ligand to the TGF beta signaling receptor. Cell 73, 14351444.
  • 7
    Del Re, E., Babitt, J. L., Pirani, A., Schneyer, A. L., and Lin, H. Y. ( 2004) In the absence of type III receptor, the transforming growth factor (TGF)-beta type II-B receptor requires the type I receptor to bind TGF-beta2. J. Biol. Chem. 279, 2276522772.
  • 8
    Chen, L., Klass, C., and Woods, A. ( 2004) Syndecan-2 regulates transforming growth factor-beta signalling. J. Biol. Chem. 279, 1571515718.
  • 9
    Willems, S. M., Wiweger, M., van Roggen, J. F., and Hogendoorn, P. C. ( 2010) Running GAGs: myxoid matrix in tumor pathology revisited: what's in it for the pathologist? Virchows Arch. 456, 181192.
  • 10
    Berdiaki, A., Nikitovic, D., Tsatsakis, A., Katonis, P., Karamanos, N. K., et al. ( 2009) bFGF induces changes in hyaluronan synthase and hyaluronidase isoform expression and modulates the migration capacity of fibrosarcoma cells. Biochim. Biophys. Acta 1790, 12581265.
  • 11
    Fthenou, E., Zong, F., Zafiropoulos, A., Dobra, K., Hjerpe, A., et al. ( 2009) Chondroitin sulfate A regulates fibrosarcoma cell adhesion, motility and migration through JNK and tyrosine kinase signaling pathways. In Vivo 23, 6976.
  • 12
    Spearman, M., Taylor, W. R., Greenberg, A. H., and Wright, J. A. ( 1994) Antisense oligodeoxyribonucleotide inhibition of TGF-beta 1 gene expression and alterations in the growth and malignant properties of mouse fibrosarcoma cells. Gene 149, 2529.
  • 13
    Suzuki, H., Kato, Y., Kaneko, M. K., Okita, Y., Narimatsu, H., et al. ( 2008) Induction of podoplanin by transforming growth factor-beta in human fibrosarcoma. FEBS Lett. 582, 341345.
  • 14
    Berdiaki, A., Zafiropoulos, A., Fthenou, E., Katonis, P., Tsatsakis, A., et al. ( 2008) Regulation of hyaluronan and versican deposition by growth factors in fibrosarcoma cell lines. Biochim. Biophys. Acta 1780, 194202.
  • 15
    Kwak, H. J., Park, M. J., Cho, H., Park, C. M., Moon, S. I., et al. ( 2006) Transforming growth factor-beta1 induces tissue inhibitor of metalloproteinase-1 expression via activation of extracellular signal-regulated kinase and Sp1 in human fibrosarcoma cells. Mol. Cancer Res. 4, 209220.
  • 16
    Sokol, J. P. and Schiemann, W. P. ( 2004) Cystatin C antagonizes transforming growth factor beta signaling in normal and cancer cells. Mol. Cancer Res. 2, 183195.
  • 17
    Rasheed, S., Nelson-Rees, W. A., Toth, E. M., Arnstein, P., and Gardner, M. B. ( 1974) Characterization of a newly derived human sarcoma cell line (HT-1080). Cancer 33, 10271033.
  • 18
    Orosco, A., Fromigue, O., Bazille, C., Entz-Werle, N., Levillain, P., et al. ( 2007) Syndecan-2 affects the basal and chemotherapy-induced apoptosis in osteosarcoma. Cancer Res. 67, 37083715.
  • 19
    Kouvidi, K., Berdiaki, A., Nikitovic, D., Katonis, P., Afratis, N., et al. ( 2011) Role of receptor for hyaluronic acid-mediated motility (RHAMM) in low molecular weight hyaluronan (LMWHA)-mediated fibrosarcoma cell adhesion J. Biol. Chem. 286, 3850938520.
  • 20
    Chalkiadaki, G., Nikitovic, D., Berdiaki, A., Katonis, P., Karamanos, N. K., et al. ( 2011) Heparin plays a key regulatory role via a p53/FAK-dependent signaling in melanoma cell adhesion and migration. IUBMB Life 63, 109119.
  • 21
    Park, H., Han, I., Kwon, H. J., and Oh, E. S. ( 2005) Focal adhesion kinase regulates syndecan-2-mediated tumorigenic activity of HT1080 fibrosarcoma cells. Cancer Res. 65, 98999905.
  • 22
    Whiteford, J. R., Behrends, V., Kirby, H., Kusche-Gullberg, M., Muramatsu, T., et al. ( 2007) Syndecans promote integrin-mediated adhesion of mesenchymal cells in two distinct pathways. Exp. Cell. Res. 313, 39023913.
  • 23
    Whiteford, J. R., Xian, X., Chaussade, C., Vanhaesebroeck, B., Nourshargh, S., et al. ( 2011) Syndecan-2 is a novel ligand for the protein tyrosine phosphatase receptor CD148. Mol. Biol. Cell. 22, 36093624.
  • 24
    Oh, E. S. and Couchman, J. R. ( 2004) Syndecans-2 and -4; close cousins, but not identical twins. Mol. Cells 17, 181187.
  • 25
    Kähäri, V. M., Peltonen, J., Chen, Y. Q., and Uitto, J. ( 1991) Differential modulation of basement membrane gene expression in human fibrosarcoma HT-1080 cells by transforming growth factor-beta 1. Enhanced type IV collagen and fibronectin gene expression correlates with altered culture phenotype of the cells. Lab. Invest. 64, 807818.
  • 26
    Walsh, M. F., Ampasala, D. R., Rishi, A. K., and Basson, M. D. ( 2009) TGF-beta1 modulates focal adhesion kinase expression in rat intestinal epithelial IEC-6 cells via stimulatory and inhibitory Smad binding elements. Biochim. Biophys. Acta 1789, 8898.
  • 27
    Hauck, C. R., Hsia, D. A., and Schlaepfer, D. D. ( 2002) The focal adhesion kinase—a regulator of cell migration and invasion. IUBMB Life 53, 115119.
  • 28
    Guan, J. L. ( 2010) Integrin signaling through FAK in the regulation of mammary stem cells and breast cancer. IUBMB Life 62, 268276.
  • 29
    Hu, M., Pollock, R. E., and Nicolson, G. L. ( 1997) Purification and characterization of human lung fibroblast motility-stimulating factor for human soft tissue sarcoma cells: identification as an NH2-terminal fragment of human fibronectin. Cancer Res. 57, 35773584.
  • 30
    Cevikbas, F., Schaefer, L., Uhlig, P., Robenek, H., Theilmeier, G., et al. ( 2008) Unilateral nephrectomy leads to up-regulation of syndecan-2- and TGF-beta-mediated glomerulosclerosis in syndecan-4 deficient male mice. Matrix Biol. 27, 4252.
  • 31
    Blobe, G. C., Liu, X., Fang, S. J., How, T., and Lodish, H. F. ( 2001) A novel mechanism for regulating transforming growth factor beta (TGF-beta) signaling. Functional modulation of type III TGF-beta receptor expression through interaction with the PDZ domain protein, GIPC. J. Biol. Chem. 276, 3960839617.
  • 32
    Kusano, Y., Oguri, K., Nagayasu, Y., Munesue, S., Ishihara, M., et al. ( 2000) Participation of syndecan 2 in the induction of stress fiber formation in cooperation with integrin alpha5beta1: structural characteristics of heparan sulfate chains with avidity to COOH-terminal heparin-binding domain of fibronectin. Exp. Cell. Res. 256, 434444.
  • 33
    López-Casillas, F., Payne, H. M., Andres, J. L., and Massagué, J. ( 1994) Betaglycan can act as a dual modulator of TGF-beta access to signaling receptors: mapping of ligand binding and GAG attachment sites. J. Cell. Biol. 124, 557568.
  • 34
    Tsutsumi, K., Kasaoka, T., Park, H. M., Nishiyama, H., Nakajima, M., et al. ( 2008) Tumor growth inhibition by synthetic and expressed siRNA targeting focal adhesion kinase. Int. J. Oncol. 33, 215224.
  • 35
    Galante, L. L. and Schwarzbauer, J. E. ( 2007) Requirements for sulfate transport and the diastrophic dysplasia sulfate transporter in fibronectin matrix assembly. J. Cell. Biol. 179, 9991009.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Experimental Procedures
  5. Results
  6. Discussion
  7. REFERENCES
  8. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
IUB_1112_sm_SuppFig1.tif133KSupporting Information Figure 1.
IUB_1112_sm_SuppFig2.tif68KSupporting Information Figure 2.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.