SEARCH

SEARCH BY CITATION

Keywords:

  • Up4A;
  • gastric smooth muscle;
  • contraction

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. REFERENCES

Extracellular nucleotides uridine-5′-triphosphate (UTP) and adenosine-5′-triphosphate (ATP) induce contraction of gastric smooth muscle (SM). The dinucleotide uridine adenosine tetraphosphate (Up4A), an endothelium-derived contraction factor, induces vascular SM contraction. Its effect on gastric SM contractions, however, is unknown. We addressed the hypothesis that Up4A induces gastric SM contraction via a mechanism that may differ between circular and longitudinal muscle (CM and LM, respectively). CM and LM were isolated from rat gastric fundus for the measurement of isometric tension. Up4A induced transient contractile responses in both CM and LM, which were similar to those induced by ATP and UTP. Up4A failed to induce contraction of either LM or CM in the absence of extracellular Ca2+ or in the presence of nimodipine, an inhibitor of voltage-gated Ca2+ channels. P2X1, 2, 4, 5 and 7 and P2Y1, 2, 4 and 6 receptor expression was detected in gastric SM by reverse transcription-polymerase chain reaction. IP5I (a P2X receptor antagonist) and α,β-methylene-ATP (a P2X receptor agonist) had no effect on Up4A-induced contractions of either LM or CM, and α,β-methylene-ATP alone failed to induce a contractile response in either tissue. Suramin (a P2Y receptor antagonist), on the other hand, significantly inhibited Up4A-induced contraction of CM, but not LM. Up4A-induced contraction of CM, but not LM, was also inhibited by pretreatment with Y-27632, an inhibitor of Rho-associated kinase. We conclude that Up4A induces extracellular Ca2+-dependent contractions of rat gastric LM and CM, and Up4A-induced contraction of CM is mediated by suramin-sensitive P2Y receptors and subsequent activation of the Rho-associated kinase pathway. © 2013 IUBMB Life, 65(7):623–632, 2013.


Abbreviations
α,β-Me-ATP

α,β-methylene-ATP

Ach

acetylcholine

CM

circular muscle

LM

longitudinal muscle

ROCK

Rho-associated kinase

RT-PCR

reverse transcription-polymerase chain reaction

SM

smooth muscle

TTX

tetrodotoxin

Up4A

uridine adenosine tetraphosphate

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. REFERENCES

The extracellular nucleotide adenosine-5′-triphosphate (ATP), a nonadrenergic, noncholinergic transmitter in the autonomic nervous system, has both contractile and relaxant effects on gastric smooth muscle (SM), likely reflecting the activation of distinct purinergic receptors. For example, when added to circular SM strips of the rat stomach at resting tension, ATP induced transient contraction [1]. On the other hand, ATP induced partial and transient relaxation of longitudinal gastric SM strips precontracted with serotonin [2] and of circular SM strips precontracted with acetylcholine (Ach) [1, 3]. Intravenous application of ATP stimulated relaxation of the antrum and proximal duodenum of anesthetized Sprague–Dawley rats, which was inhibited by the P2Y purinoceptor antagonist suramin [4]. The ATP-induced relaxation of Ach-contracted rat gastric circular muscle (CM) was also inhibited by suramin [3]. It was also reported that the P2X receptor agonist α,β-methylene-ATP (α,β-Me-ATP) induced relaxation of antral CM of the guinea-pig stomach [5].

In rat fundus longitudinal muscle (LM) tissues, exogenous application of ATP (1–30 μM) induced biphasic responses with concentration-dependent relaxation and subsequent contractions, and suramin (200 μM) significantly reduced the relaxation and abolished the contractile response to ATP [6]. In addition, uridine-5′-triphosphate (UTP) induced suramin-sensitive contraction of rat proximal gastric CM tissue [1]. P2 purinoceptors are expressed in SM of the gastrointestinal tract [7, 8] and activation of these receptors by ATP or UTP increases cytosolic Ca2+ concentration in isolated myocytes from the rat gastrointestinal tract, which is abolished by depletion of intracellular Ca2+ stores with thapsigargin [9].

More recently, the dinucleotide uridine adenosine tetraphosphate (Up4A) was discovered as a novel endothelium-derived contraction factor [10, 11]. Up4A induces pulmonary arterial SM contraction through activation of suramin-sensitive P2Y receptors [12]. Up4A-induced SM contraction was also reported in rat aortic SM [13, 14] and human airway SM [15]. Furthermore, elevated concentrations of Up4A were detected in juvenile hypertensive patients [16]. These observations suggest that Up4A may act on SM tissues in addition to blood vessels.

In this study, we addressed the possibility that Up4A may induce contraction of gastric SM. As gastric CM and LM display differential contractile responses to the same agonist [17], we set out to examine the contractile responses to Up4A of rat gastric CM and LM preparations and to compare the pharmacological properties of the responses in the CM and LM.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. REFERENCES

Materials

ATP and UTP were obtained from Thermo Scientific (Massachusetts, United States). Nimodipine, α,β-Me-ATP, suramin, diinosine pentaphosphate (IP5I) and Y-27632 were purchased from Sigma Chemical (Steinheim, Germany). Up4A was purchased from Biolog Life Science Institute (Bremen, Germany).

Tissue Bioassay

Male Wistar rats (6–8 weeks old, 300–330 g) were purchased from the Laboratory Animal Center of the Academy of Military Medical Sciences of China. All animal studies were approved by and performed according to the Guidelines for the Care and Use of Laboratory Animals in Nankai University (A5521-01), which strictly conforms to the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health (NIH Publication No. 85-23, revised 1996). Gastric LM and CM preparations were obtained as described previously [17, 18]. Briefly, rats were sacrificed by celiac injection of 20% urethane (2.4 mg/g). The stomach was opened along the lesser curvature, and all overlying mucosa was carefully removed. CM and LM strips were cut into 3 × 10 mm pieces. The strips were incubated in plastic chambers in which one end of the tissue was vertically attached to the force transducers of a tension recording system and the other end to a mount point in the tissue chamber. Each plastic chamber contained 4 mL of Krebs–Henseleit buffer of the following composition (mM): NaCl (118), KCl (4.7), CaCl2 (2.5), MgCl2 (1.2), NaHCO3 (25), KH2PO4 (1.2), and D-glucose (10) in distilled deionized water. The buffer was maintained at 37 °C and gassed with 95% O2 and 5% CO2. An initial resting tension of 20 mN was applied to each tissue during a 1-h equilibration period. To assess the responsiveness, tissues were first exposed to 50 mM of KCl. To construct the concentration–response curves for ATP, UTP and Up4A, contractile responses were expressed as a percentage of the contractile response to 50 mM KCl (% KCl).

Reverse Transcription-Polymerase Chain Reaction Analysis

Reverse transcription-polymerase chain reaction (RT-PCR) analysis was used to detect the expression of P2X and P2Y receptor mRNAs in rat gastric SM. Total RNA was extracted with the TRIzol Reagent (Takara Biotechnology, Dalian, China) according to the recommendations of the manufacturer. First-strand cDNA was prepared according to the manufacturer' instructions using M-MLV Reverse Transcriptase and random primers (Promega, Beijing, China). In brief, 2 μL of RT product was used for specific amplification of primers for P2X and P2Y subtypes including P2X1, P2X2, P2X3, P2X4, P2X5, P2X6, P2X7, P2Y1, P2Y2, P2Y4 and P2Y6. PCR was carried out using primers (Table 1) and conditions described previously [15, 19]. A PCR product of SM-specific α-actin was used as an internal control as described previously [20]. Total RNA was extracted from one rat gastric SM strip for each reaction and each RT-PCR experiment was repeated at least three times.

Table 1. List of primer sequences
GeneSequence (5′–3′)Expected product (bp)
P2X1FW: GAAAGCCCAAGGTATTCG455
 RV: AGTTGAAGCCTGGAGACA 
P2X2FW: TCACAGGCCATCTACTTGAG357
 RV: GAATCAGAGTGCAACCCCAA 
P2X3FW: CAGTGGCCTGGTCACTGGCGA440
 RV: TGGCGTTCTGGGTATTAAGATCGG 
P2X4FW: CAGAGCACCTGTCCAGAGATTC372
 RV: CACGATTGTGCCAAGACG 
P2X5FW: ATGGCGAGTGTTCTGAGGAC347
 RV: TGCCCAGCGGACAATAGAC 
P2X6FW: GCTGTGCCCAGGAAACC395
 RV: GAGGCTGCCCACCAGTAAT 
P2X7FW: CCTGGCTACAACTTCAGATAC311
 RV: ACGATGGGCTCACACTTC 
P2Y1FW: TGGCGTGGTGTACCCTCTCAAGT558
 RV: CGGGACAGTCTCCTTCTGAATGTA 
P2Y2FW: CTGCCAGGCACCCGTGCTCTACTT337
 RV: CTGAGGTCAAGTGATCGGAAGGAG 
P2Y4FW: CACCGATACCTGGGTATCTGCCAC377
 RV: CAGACAGCAAAGACAGTCAGCACC 
P2Y6FW: CAGTGGCCTGGTCACTGGCGA458
 RV: TGGCGTTCTGGGTATTAAGATCGG 
α-ActinFW: CGTGGGCCGCCCTAGGCACCA243
 RV: TTGGCCTTAGGGTTCAGGGGG 

Statistical Analysis

Data were expressed as mean ± S.E.M.. Differences were evaluated by Student' t-test for comparison of two groups, and by ANOVA for comparisons involving three or more groups. P < 0.05 was considered statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. REFERENCES

Up4A Induces Transient Contractile Responses in Rat Gastric CM and LM

We first examined whether Up4A induces contractile responses in gastric SM tissues. As described in our previous studies [17, 18], SM strips were isolated from the rat gastric fundus. LM and CM contractions were measured following cutting of the tissue in a longitudinal or circular direction, respectively. As shown in Figs. 1A and 1B, addition of Up4A to the organ bath induced transient contractions of both LM and CM tissues, which relaxed to basal levels of tension within 4–5 min. When tension had returned to baseline, a second addition of Up4A (20 μM) stimulus induced similar contractile responses of both LM and CM (Fig. 1C), suggesting that the transient nature of the Up4A-induced contractions is owing to rapid degradation of the agonist rather than receptor desensitization. Up4A-induced contractions were not attenuated by pretreatment with the neurotoxin tetrodotoxin (TTX, 5 μM, data not shown). The contractile responses of LM and CM to Up4A were similar to those induced by ATP and UTP (Figs. 1A and 1B). The concentration–response curves showed that the rank order of efficacy (Emax) in LM preparations was Up4A > UTP > ATP (Fig. 1D) and in CM preparations was UTP > Up4A > ATP (Fig. 1E). Estimated EC50 values of Up4A, UTP and ATP were, respectively, ∼5, 5 and 12 μM in LM, and 0.3, 0.5 and 5 μM in CM.

image

Figure 1. Contractile responses induced by Up4A, ATP and UTP in rat gastric LM and CM preparations. Rat gastric LM (A) and CM (B) tissues were treated with Up4A, ATP and UTP at the concentrations indicated and the contractile responses recorded. (C) Up4A was applied twice to LM (left panel) and CM (right panel). (A–C) Open triangles (upward) indicate addition of Up4A. Filled triangles (upward) indicate addition of ATP or UTP. Filled triangles (downward) indicate washout of the agonist. (D and E) Concentration–response relationships normalized to the prior contractile response to KCl (50 mM) in the same tissues (LM in D and CM in E). Each data point represents the mean ± S.E.M. (Up4A, n = 5; ATP, n = 3; UTP, n = 5). The tissue strips were derived from three different animals.

Download figure to PowerPoint

Up4A-Induced Contractions Require Influx of Extracellular Ca2+ via Voltage-Gated Ca2+ Channels

We next examined the extracellular Ca2+ dependence of Up4A-induced contractile responses of LM and CM preparations. As shown in Figs. 2A and 2B, Up4A failed to induce a contractile response in either LM or CM tissues in the presence of EGTA (absence of Ca2+), indicating a requirement for extracellular Ca2+ influx for Up4A-induced contraction. Following replacement of extracellular Ca2+, the contractile responses to Up4A were restored. Pretreatment with nimodipine (1 μM), an inhibitor of voltage-gated Ca2+ channels, completely inhibited the contractile responses to Up4A in both LM and CM tissues. The inhibition of Up4A responses by nimodipine appeared irreversible as Up4A responses were not restored following washout of nimodipine for up to 3 h (Figs. 2C and 2D). It is noteworthy, however, that nimodipine did not significantly reduce the contractile responses to Ach (1 μM) of either LM or CM tissues, suggesting that Ach-induced contractions, unlike those induced by Up4A, are not dependent on activation of voltage-gated Ca2+ channels.

image

Figure 2. Effects of removal of extracellular Ca2+ and blockade of voltage-gated Ca2+ channels on Up4A-induced contractile responses. Contractile responses to Up4A (5 μM) were first recorded in gastric LM (A) and CM (B) tissues, followed by incubation in Ca2+-free Krebs–Henseleit buffer containing EGTA (0.2 mM) for 30 min. The contractile responses to Up4A (5 μM) were then measured again. After replenishing the buffer with 2.5 mM of CaCl2, the contractile responses to Up4A were re-examined. Nimodipine (1 μM) was added to other LM (C, E) and CM (D, F) tissues for 30 min after responses to Up4A or Ach (1 μM) were first measured, and the contractile responses to Up4A or Ach recorded in the continued presence of nimodipine. After washing nimodipine from the tissue bath, Up4A-induced contractile responses were re-examined. The traces are representative of at least three independent experiments. Filled triangles (downward) indicate washout of the agonist.

Download figure to PowerPoint

Suramin-Sensitive P2Y Receptors are Involved in Up4A-Induced Contractions in CM, but not LM, Preparations

We performed RT-PCR using the specific primers listed in Table 1 to examine the expression of P2X and P2Y receptors in gastric muscle as described previously [15]. Whole fundus was used for this purpose. As shown in Fig. 3, the expression of P2X4, 5 and 7, and P2Y1, 2, 4 and 6 was clearly detected. Low expression levels of P2X1 and 2 were also noted, but no PCR signal for P2X3 or P2X6 was observed (Fig. 3). All PCR fragments were sequenced to confirm their identities (data not shown).

image

Figure 3. Purinoceptor mRNA expression in rat gastric fundus. The expression of P2X and P2Y purinergic receptors in gastric SM was examined using RT-PCR. Representative agarose gels showing PCR signals for P2X (upper) and P2Y (lower) receptor subtypes as indicated.

Download figure to PowerPoint

The RT-PCR results, therefore, revealed the presence of both P2X and P2Y receptors in rat gastric SM. Using pharmacological approaches, we assessed which receptors are potentially involved in Up4A-induced contractions of LM and CM. To evaluate the involvement of P2X receptors, the tissues were pretreated with the nonspecific P2X receptor antagonist IP5I. As shown in Figs. 4A–4C, pretreatment with IP5I (10 μM) had no effect on Up4A-induced contraction of either LM or CM preparations. We next examined whether activation of P2X receptors induces contraction of LM and CM tissues using α,β-Me-ATP, a P2X receptor agonist, which also induces P2X receptor desensitization. Addition of α,β-Me-ATP (10 μM) failed to induce a contractile response in either LM or CM tissues (Figs. 4D–4F). Note that the continued presence of α,β-Me-ATP at 10 μM did not affect subsequent contractile responses to Up4A of either LM or CM tissues (Figs. 4D–4F). However, treatment with α,β-Me-ATP did induce contraction of rat aorta (positive control) with or without endothelium (Figs. 4G and 4H, respectively).

image

Figure 4. Effects of IP5I and α,β-Me-ATP on Up4A-induced contractions of LM and CM preparations. Contractile responses to Up4A (5 μM) were first recorded in rat gastric LM (A, D) and CM (B, E) preparations. LM (A) and CM (B) tissues were then pretreated with 10 μM IP5I for 30 min, followed by re-examination of the contractile response to Up4A in the continued presence of diinosine pentaphosphate. (C) Cumulative results showing the effects of IP5I on Up4A-induced contractions normalized to the prior contractile response to 50 mM of KCl in the same tissue (n = 3). (D and E) Tissues were pretreated with α,β-Me-ATP (10 μM), and then exposed to Up4A. (F) Cumulative results showing the contractile responses of LM and CM to Up4A (5 μM) alone and following pretreatment with α,β-Me-ATP (10 μM) (n = 3). (G and H) Rat aortic rings with (G) or without endothelium (H) were treated with phenylephrine (PE, 1 μM) and Ach (1 μM). After washing, tissues were treated with α,β-Me-ATP (10 μM). The traces are representative of at least three independent experiments with tissue from different animals. Filled triangles (downward) indicate washout of the agonist.

Download figure to PowerPoint

Thereafter, we examined the inhibitory effects of suramin, a nonspecific P2Y receptor antagonist, on Up4A-induced contractions of LM and CM tissues. As shown in Figs. 5A and 5C, pretreatment with suramin (5 μM) did not affect the contraction of LM induced by Up4A. In contrast, 5 μM of suramin inhibited Up4A-induced contractions of CM tissues by ∼50% (from 53 to 27% of the KCl response) (Figs. 5B and 5C).

image

Figure 5. Effects of suramin on Up4A-induced contractions of CM and LM preparations. Up4A-induced contractile responses of rat gastric LM (A) and CM (B) tissues were first recorded, followed by incubation with suramin (5 μM) for 30 min and subsequent treatment with Up4A again, in the continued presence of suramin. Traces are representative of at least three independent experiments. (C) Cumulative data showing the effects of suramin (5 μM) on Up4A-induced contractions of LM and CM tissues. Up4A-induced contractile responses were normalized to the prior contractile response to KCl (50 mM) in the same tissue (*P < 0.01, n = 8). Filled triangles (downward) indicate washout of the agonist.

Download figure to PowerPoint

Rho-Associated Kinase is Involved in Up4A-Induced CM Contraction

We demonstrated previously that Up4A-induced contraction of vascular SM is inhibited by the Rho-associated kinase (ROCK) inhibitor Y-27632, suggesting a role of the ROCK pathway in Up4A-induced contraction. Therefore, we examined the effects of Y-27632 (500 nM) on Up4A-induced contractions of LM and CM tissues. As shown in Fig. 6, pretreatment with Y-27632 did not affect the Up4A-induced contractile response of LM tissues, but inhibited the Up4A-induced contractile response in CM tissues by ∼70% (from 46 to 14% of the KCl response).

image

Figure 6. Effects of Y-27632 on Up4A-induced contraction of CM and LM preparations. Contractile responses to Up4A (5 μM) were recorded in rat gastric LM (A) and CM (B) preparations. Tissues were then pretreated with Y-27632 (500 nM) for 30 min, followed by re-exposure to Up4A (5 μM) in the continued presence of Y-27632. Filled triangles (downward) indicate washout of the agonist. (C) Cumulative data showing the effects of Y-27632 on Up4A-induced contractions of LM and CM preparations. Up4A-induced contractions were normalized to the prior contractile response to KCl (50 mM) in the same tissue (*P < 0.01, n = 5).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. REFERENCES

We conclude from this study that: i) Up4A, like ATP and UTP, induces transient contractile responses in both LM and CM tissues of the rat gastric fundus, which are dependent on extracellular Ca2+ and activation of voltage-gated Ca2+ channels; ii) Up4A-induced contractions of LM and CM do not involve P2X receptors and iii) Up4A-induced contractions of CM, but not LM, are inhibited by suramin and Y-27632, suggesting an involvement of suramin-sensitive P2Y receptors and the ROCK pathway in the contractile response of the CM.

Vetri et al. [2] reported that electrical field stimulation induced a TTX-sensitive relaxation of gastric LM, which was inhibited by desensitization of P2X receptors through prolonged treatment with 100 μM of ATP. We found that Up4A-induced contraction of both LM and CM tissues was unaffected by pretreatment with TTX or desensitization of P2X receptors, suggesting that contractile responses were not induced by TTX-sensitive neurotransmitter release or activation of P2X receptors.

RT-PCR revealed the expression of multiple P2X and P2Y receptor subtypes in gastric SM preparations containing a mixture of CM and LM. For the functional studies, LM and CM tissues were prepared by cutting the dissected SM strips longitudinally or circularly, respectively, so that LM tissue contraction did not involve CM tissue, and vice versa. Unfortunately, it was not possible for us to separate LM and CM for RNA extraction and PCR analysis. Nevertheless, our pharmacological studies with IP5I (to block P2X receptors) and α,β-Me-ATP (to activate P2X receptors) showed that P2X receptors are not involved in Up4A-induced contraction of either LM or CM tissues. Thus, a nonselective P2X receptor antagonist did not significantly attenuate Up4A-induced contractions of either tissue, and α,β-Me-ATP, which induced vascular SM contraction, failed to induce contraction of LM or CM tissues. Furthermore, the prolonged presence of α,β-Me-ATP, which induces P2X receptor desensitization, had no effect on Up4A-induced contractions. Therefore, in contrast to vascular SM, activation of P2X receptors appears not to be involved in Up4A-induced contractions of gastric SM tissues. Given the number of P2Y receptor mRNAs detected in the gastric fundus, it will be challenging to identify those involved in the Up4A-induced contractile response of the CM. Although selective antagonists such as MRS2500 (P2Y1) and MRS2578 (P2Y6) are available, complete knowledge of their specificity of action is lacking, particularly in tissue preparations as opposed to cultured cell systems.

Our observation that Up4A-induced contraction of CM, but not LM, is inhibited by suramin (a nonselective P2Y receptor antagonist) suggests that different P2Y receptor subtypes are stimulated by Up4A to trigger contractions of LM and CM, and that the receptor for Up4A in CM is sensitive to inhibition by suramin. Suramin is a nonspecific antagonist for P2X and P2Y purinergic receptors [21]. Some P2Y receptors are more sensitive to suramin inhibition than others. A previous study showed that suramin (200 μM) significantly reduced relaxations and abolished contractions to ATP in rat gastric fundus LM tissues [6]. In our unpublished studies, we also observed a slight inhibition of Up4A-induced contraction by a high concentration (20 μM) of suramin in LM, but this concentration of suramin completely abolished the contraction induced by Up4A in CM (unpublished observation).

Although activation of distinct P2Y receptors underlies the Up4A-induced contraction of LM and CM gastric tissues, Up4A-induced contraction of both tissues requires activation of voltage-gated Ca2+ channels and influx of extracellular Ca2+. It was previously reported that the contractile response of guinea pig stomach via P2Y purinoceptors is owing to Ca2+ release from internal stores [5]. This disparity may be owing to the use of different agonists and/or animal species in the two studies.

Our other pharmacological studies have provided further evidence in support of the conclusion that Up4A stimulates two different receptor systems to elicit contractile responses of LM and CM tissues. In CM preparations, for example, the contractile response to Up4A was inhibited by Y-27632 (Figs. 6B and 6C), suggesting involvement of the ROCK pathway. However, the same inhibitor had no effect on the Up4A-induced contractile response of LM tissue. Our finding suggesting an involvement of the ROCK pathway in gastric CM tissues is consistent with our previous observations of Up4A-induced contraction of airway SM tissues [15].

Finally, Up4A was first identified from cultured endothelial cells and defined as an endothelium-derived contraction factor [10]. Subsequently, Up4A was found to be released by cultivated renal proximal tubule cells [22]. It remains unknown whether Up4A is also released by cells of the gastrointestinal system. Nevertheless, our previous study showed that plasma concentrations of Up4A are enhanced in hypertensive children [16], implicating its effects on the modulation of gastrointestinal motility.

Conclusions

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. REFERENCES

In conclusion, Up4A induces contraction of not only vascular and airway SM tissues, but also gastric SM tissues. Most interestingly, distinct receptor and intracellular signaling mechanisms appear to be involved in Up4A-induced contractions of LM and CM tissues.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. REFERENCES

This research was supported by a grant-in-aid from the Heart and Stroke Foundation of Canada to X-L.Z., the Natural Science Foundation of China (30772568) to Y.G. and National Basic Research Program of China (2011CB944003). X-L. Zheng is the recipient of a Senior Investigator Award from Alberta Innovates—Health Solutions (AIHS). M. P. Walsh is the recipient of a Canada Research Chair (Tier 1) in Vascular Smooth Muscle Research and AIHS Scientist Award.

REFERENCES

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. REFERENCES
  • 1
    Otsuguro,K., Ito, S., Ohta, T., and Nakazato, Y. (1996) Influence of purines and pyrimidines on circular muscle of the rat proximal stomach. Eur. J. Pharmacol. 317, 97105.
  • 2
    Vetri, T., Bonvissuto, F., Marino, A., and Postorino, A. (2007) Nitrergic and purinergic interplay in inhibitory transmission in rat gastric fundus. Auton. Autacoid Pharmacol. 27, 151157.
  • 3
    Otsuguro, K., Ohta, T., Ito, S., and Nakazato, Y. (1998) Two types of relaxation-mediating P2 receptors in rat gastric circular muscle. Jpn. J. Pharmacol. 78, 209215.
  • 4
    Glasgow, I., Mattar, K., and Krantis, A. (1998) Rat gastroduodenal motility in vivo: involvement of NO and ATP in spontaneous motor activity. Am. J. Physiol. Gastrointest. Liver Physiol. 275, G889G896.
  • 5
    Ahn, S. C., Xu, W. X., So, I., Kim, K. W., and Kang, T. M. (1995) Effects of purinergic agonists on mechanical and electrical activities of gastric smooth muscle of guinea-pig. J. Smooth Muscle Res. 31, 407410.
  • 6
    Jenkinson, K. M. and Reid, J. J. (2000) The P(2)-purinoceptor antagonist suramin is a competitive antagonist at vasoactive intestinal peptide receptors in the rat gastric fundus. Br. J. Pharmacol. 130, 16321638.
  • 7
    Giaroni, C., Knight, G. E., Zanetti, E., Chiaravalli, A. M., Lecchini, S., et al. (2006) Postnatal development of P2 receptors in the murine gastrointestinal tract. Neuropharmacology 50, 690704.
  • 8
    Windscheif, U. (1996) Purinoceptors: from history to recent progress. A review. J. Pharm. Pharmacol. 48, 9931011.
  • 9
    Blottière, H. M., Loirand, G., and Pacaud, P. (1996) Rise in cytosolic Ca2+ concentration induced by P2-purinoceptor activation in isolated myocytes from the rat gastrointestinal tract. Br. J. Pharmacol. 117, 775780.
  • 10
    Jankowski, V., Tölle, M., Vanholder, R., Schönfelder, G., van der Giet, M., et al. (2005) Uridine adenosine tetraphosphate: a novel endothelium-derived vasoconstrictive factor. Nat. Med. 11, 223227.
  • 11
    Matsumoto, T., Tostes, R. C., and Webb, R. C. (2011) The role of uridine adenosine tetraphosphate in the vascular system. Adv. Pharmacol. Sci. 2011, ID435132.
  • 12
    Gui, Y., Walsh.M. P., Jankowski, V., Jankowski, J., and Zheng, X.-L. (2008) Up4A stimulates endothelium-independent contraction of isolated rat pulmonary artery. Am. J. Physiol. Lung Cell Mol. Physiol. 294, L733L738.
  • 13
    Linder, A. E., Tumbri, M., Linder, F. F. P., Webb, R. C., and Leite, R. (2008) Uridine adenosine tetraphosphate induces contraction and relaxation in rat aorta. Vascul. Pharmacol. 48, 202207.
  • 14
    Hansen, P. B., Hristovska, A., Wolff, H., Vanhoutte, P., Jensen, B. L., et al. (2010) Uridine adenosine tetraphosphate affects contractility of mouse aorta and decreases blood pressure in conscious rats and mice. Acta Physiol. 200, 171179.
  • 15
    Gui, Y., Wang, Z., Sun, X., Walsh, M. P., Li, J.-J., et al. (2011) Uridine adenosine tetraphosphate induces contraction of airway smooth muscle. Am. J. Physiol. Lung Cell. Mol. Physiol. 301, L789L794.
  • 16
    Jankowski, V., Meyer, A.-A., Schlattmann, P., Gui, Y., Zheng, X.-L., et al. (2007) Increased uridine adenosine tetraphosphate concentrations in plasma of juvenile hypertensives. Arterioscler. Thromb. Vasc. Biol. 27, 17761781.
  • 17
    Zheng, X.-L., Mokashi, S., and Hollenberg, M. D. (1997) Contractile action of ethanol in guinea pig gastric smooth muscle: inhibition by tyrosine kinase inhibitors and comparison with the contractile action of epidermal growth factor-urogastrone. J. Pharmacol. Exp. Ther. 282, 485495.
  • 18
    Zheng, X.-L., Sharkey, K. A., and Hollenberg, M. D. (1997) Induction of nitric oxide synthase in rat gastric smooth muscle preparations. Am. J. Physiol. Gastrointest. Liver Physiol. 273, G1101G1107.
  • 19
    Dranoff, J. A., Masyuk, A. I., Kruglov, E. A., LaRusso, N. F., and Nathanson, M. H. (2001) Polarized expression and function of P2Y ATP receptors in rat bile duct epithelia. Am. J. Physiol. Gastrointest. Liver Physiol. 281, G1059G1067.
  • 20
    Gui, Y., Zheng, X.-L., and Hollenberg, M. D. (2000) Interleukin-1beta, src- and non-src tyrosine kinases, and nitric oxide synthase induction in rat aorta in vitro. Am. J. Physiol. Heart Circ. Physiol. 279, H566H576.
  • 21
    Burnstock, G. (2006) Pathophysiology and therapeutic potential of purinergic signaling. Pharmacol. Rev. 58:5886.
  • 22
    Jankowski, V., Patzak, A., Herget-Rosenthal, S., Tran, T. N. A., Lai, E. Y., et al. (2008) Uridine adenosine tetraphosphate acts as an autocrine hormone affecting glomerular filtration rate. J. Mol. Med. 86, 333340.