SEARCH

SEARCH BY CITATION

Keywords:

  • miRNA;
  • miR-7;
  • CUL5;
  • cell cycle;
  • hepatocellular carcinoma

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

MicroRNAs (miRNAs) are small, non-coding RNAs that participate in the regulation of gene expression. In this study, we demonstrate that miR-7 was downregulated in hepatocellular carcinoma (HCC) tissues compared to adjacent non-tumor tissue. Over-expression of miR-7 in QGY-7703 and HepG2 cell lines inhibited colony formation and induced G1/S phase arrest, whereas knockdown of miR-7 produced the opposite phenotype. A tumor suppressor gene, CUL5, was identified as a direct target of miR-7, and CUL-5 is upregulated upon the binding of miR-7 to its 3′UTR. Furthermore, suppression of CUL5 also suppressed cell colony formation and induced cell cycle arrest. Ectopic expression of CUL5 abrogated the effects of miR-7 inhibition on QGY-7703 and HepG2 cell lines. These results indicate that miR-7 suppresses colony formation and causes cell cycle arrest via upregulation of CUL5, and it may function as a tumor suppressor in HCC. © 2013 IUBMB Life, 65(12):1026–1034, 2013


Abbreviations
miRNA

microRNA

miR-7

microRNA-7

Cul5

Cullin-5

ASO

antisense oligonucleotide

EGFP

enhanced green fluorescence protein

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

UTR

untranslated region

qRT-PCR

quantitative Reverse Transcription-PCR.

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Hepatocellular carcinoma (HCC) is one of the most deadly cancers worldwide, (esp. in China) and it impacts more than one million patients annually [1]. HCC has a high mortality rate, and over 50% of patients will die from recurrence and metastasis after surgery [2]. To improve the survival and cure rate, understanding the molecular mechanism of HCC is very important for the identification of biomarkers for early diagnosis and novel treatment strategies. Recently, it was reported that microRNAs (miRNAs) participate in HCC tumorigenesis [3].

miRNAs are a group of 19–24 nucleotide, non-coding single-stranded RNAs that interfere with post-transcriptional processes that regulate gene expression [4]. miRNAs play important roles in plenty of biological processes, including cell proliferation, migration, apoptosis, and the cell cycle [5, 6]. Previous studies implicate miR-7 in the development of different types of human cancers, including breast cancer [7] and HCC [8], through targeting several proto-oncogenes, including insulin receptor substrate 1 (IRS1), epidermal growth factor receptor (EGFR), and p21 protein (Cdc42/Rac)-activated kinase 1 (PAK1) [9, 10]. It also demonstrated that miR-7 is downregulated in HCC, but the mechanism of its regulation in hepatoma cells is unclear.

Cullin-5 (CUL5) is a member of the Cullin-RING E3 ubiquitin family. CUL5 is involved in varieties of biological processes, such as the cell cycle and proliferation [11, 12]. Cul5 binds to adaptor proteins, such as elongins, which connect Cul5 to SOCS-box proteins and an E2 ubiquitin conjugating enzyme [13]. Elongin A and the Elongin BC complex can associate with Cul5, and this complex efficiently polyubiquitinates the poly II subunit, Rpb1, to influence the cell cycle [14].

In this study, we investigated the expression level of miR-7 in HCC and studied the miR-7 pathway in HCC cell lines to identify new targets that explain its function. We observed that miR-7 and CUL5 were both downregulated in HCC tissues compared to normal tissues and found that miR-7 upregulates CUL5 by binding to their 3′UTR regions, and suppresses cancer cell growth and arrests the G1/S transition.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Cell Culture and Transfection

QGY-7703 cells were maintained in RPMI-1640 (Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum (FBS) and 100 U/mL of penicillin/streptomycin (PS). HepG2 cells were maintained in MEMα supplemented with 20% FBS and 1000 U/mL PS. HCC cell lines, QGY-7703 and HepG2, were cultured at 37 °C in a humidified chamber with 5% CO2. The cells were transfected with Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA), following the manufacturer's instructions.

Human Tissues and RNA Isolation

Twelve paired human liver tumor tissues were obtained from the Cancer Center of Sun Yat-sen University of Medical Sciences. Large and small RNAs from liver tissue and cell lines were isolated using mirVana™ miRNA Isolation Kit (Ambion, Austin, TX), following the manufacturer's instructions.

Plasmid Construction

To construct the pcDNA3.1/pri-miR-miR-7 expression vector, we amplified 351 bp DNA fragments carrying pri-miR-7 from genomic DNA using the primers listed in Table 1.

Table 1. Primers and oligonucleotides used in this work
NameSequence (5′[RIGHTWARDS ARROW]3′)α
Pri-miR-7-SCGAGGATCCAAACTGCTGCCAAAACCAC
Pri-miR-7-ACGGAATTCGTAAATCGGACATTAGTAGAACAG
ASO-miR-7-5pACAACAAAACACAGCCCA
miR-7-5p RTGTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACACAACAA
miR-7-5p ForwardTGCGGTGGAAGACTAGTGATTTTG
QYCUL5-RTP-sTAAGACACTTCAGAGGCTATC
QYCUL5-RTP-asGTTGACAGAACTCAGGGACC
QYcul5-UTR-TOPAATTC ATGCTGTCTTATGAATTCTTCC AAGCTTC
QYcul5-UTR-BOTTCGAGAAGCTT GGAAGAATTCATAAGACAGCAT
QYcul5-UTRMUT-TOPGAAACTCCAAGGCTATCACTAAATACAAAGAC
QYcul5-UTRMUT-BOTTCGAGAAGCTTGCTTCTATTCATAAGACAGCAT
Cul5-A-XbaIGCATCTAGATGCCATATATATGAAAGTGTTG
Cul5-S-XhoICCAAGCTCGAGACCATGGCGACGTCTAATC

To construct the CUL5 expression vector, we amplified the coding sequence of CUL-5 from a cDNA clone using PCR and primers listed in Table 1.

Real-time RT-PCR

Quantitative RT-PCR (qRT-PCR) [6] was performed to determine the relative miRNA level of miR-7 and CUL5. To detect mature miR-7 level, 1 µg of small RNA was used as the template. A cDNA library was generated using M-MLV reverse transcriptase (Promega, Madison, WI) and specific RT and PCR primers (Table 1). qPCR was performed using SYBR Premix EX Taq (TaKaRa, Otsu, Japan). For the detection of CUL5, 3 µg of large RNA was reverse-transcribed to cDNA using M-MLV reverse transcriptase. All samples were prepared and analyzed in triplicate.

Fluorescent Reporter Assay

To determine whether miR-7 and CUL5 directly interact, QGY-7703 and HeG2 cells were transfected with the enhanced green fluorescence protein (EGFP) expression vector pcDNA3/EGFP-CUL5 3′UTR reporter vector or the pcDNA3/EGFP-CUL5 3′UTR mutant and pri-miR-7 or antisense oligonucleotide (ASO-miR-7), and red fluorescent protein (RFP) was used to normalize the data. After 48 H, the cells were lysed with RIPA buffer, and the intensity of EGFP and RFP fluorescence was measured using a fluorescence spectrophotometer (HITACHI, Tokyo, Japan).

Detection of Cell Viability and Proliferative Capacity

For The 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl-tetrazolium bromide (MTT) assays, 24 H after transfection, 8000 HepG2 cells or 6000 QGY-7703 cells were seeded in 96-well plates. MTT assays were performed as previously described [6].

For colony formation assays, 600 HepG2 cells or 200 QGY-7703 cells were plated in 12-well plates, as described above. Fresh culture medium was replaced every 3–5 days. After 12 days, the cells were stained with crystal violet, and colonies containing more than 50 cells were counted. Each treatment was performed in triplicate.

Cell Cycle Analysis by Flow Cytometry

Cells were plated in 6-well plates the day before transfection. After transfection, cells were cultured in complete culture solution for 24 H. Then, one group was serum starved for 24 H before harvesting, while complete medium was added to the other group for 24 H. The cells were washed twice with phosphate buffered solution (PBS), centrifuged, fixed in 95% alcohol, and stored at −20 °C overnight. After washing, the cells were stained with propidium iodide buffer (PBS, 0.1% Triton X-100, 60 µg/mL propidium iodide, 0.1 mg/mL DNase-free RNase, and 0.1% trisodium citrate) for 30 Min on ice. The DNA was analyzed using FACS Calibur flow cytometer (BD Biosciences, Franklin Lakes, NJ) and Cell Quest software (BD Biosiences).

Statistical Analysis

All experiments were repeated at least three times, and statistical significance was determined using a paired t-test. A P value of less than 0.05 was considered to be significant. (**P < 0.01, *P < 0.05, ns=not significant).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

miR-7 Inhibits HepG2 and QGY-7703 Cell Proliferation

miR-7 was significantly downregulated in 12 pairs of HCC tissues by qRT-PCR (Fig. 1A). To investigate whether miR-7 expression affects cell viability and proliferation, we performed MTT and colony formation assays. First, we modulated miR-7 activity by overexpressing a miR-7 plasmid or inhibiting ASO in QGY-7703 and HepG2 cells (Figs. 1B and 1C). HepG2 and QGY-7703 cell viability was reduced in response to miR-7 over-expression, whereas more viable cells were present when miR-7 was inhibited (Figs. 1D and 1E). We observed the same phenomena in colony formation assays (Figs. 1F and 1G). These results indicate that miR-7 inhibits the proliferation of HepG2 and QGY-7703 hepatoma cell lines.

image

Figure 1.  miR-7 expression is deregulated in HCC, and it suppresses hepatoma cell viability and proliferation. A: The expression level of miR-7 was detected by RT-PCR in twelve pairs of HCC tissues and normal tissues. B,C: Real-time PCR was performed to detect the miR-7 level in QGY-7703 and HepG2 cells treated with pri-miR-7 or ASO-miR-7. D, E: MTT assays were used to determine the effect of pri-miR-7 or ASO-miR-7 on cell viability. F, G: Colony formation assays were used to determine the growth of QGY-7703 and HepG2 cell expressing pri-miR-7 or ASO-miR-7. (*P < 0.05).

Download figure to PowerPoint

miR-7 Causes G1/S-phase Arrest in Human HCC Cell Lines

To determine how miR-7 affects cell proliferation in hepatoma cell lines, we used flow cytometry to detect cell cycle progression. More cells were arrested in G1 phase and less in S phase in QGY-7703 cells transfected with pri-miR-7 (Fig. 2A). The proliferation index (PI) of miR-7-treated QGY-7703 cells was lower than that of the control group (Fig. 2E). Similar results were observed in HepG2 cells (Figs. 2B and 2F). In contrast, inhibition of miR-7 in HepG2 cells decreased the number of cells in G1 phase, and increased the S phase population (Fig. 2D). The proliferation index of ASO-miR-7-treated cells was lower than that of the ASO control (Fig. 2H). These results indicate that miR-7 delays G1/S phase transition in HCC cells.

image

Figure 2.  MiR-7 arrests human HCC cells in G1/S-phase transition. A, B: The proportion of cells in G1, S, and G2-phases after treatment with pri-miR-7 (C, D) or ASO-miR-7 (E–H). The proliferation index (PI) was calculated using the following equation: PI = (S+ G2/M)/G1 (S, G2/M, and G1 are the percentages of cells in S-phase, G2/M-phase and G1-phase, respectively). The PI was significantly elevated in the ASOmiR-7 group.

Download figure to PowerPoint

CUL5 is a Novel Target of miR-7

Using bioinformatics software, including TargetScan, PicTar, and miRanda, we identified hundreds of predicted candidate target genes of miR-7. Among them, CUL5 was chosen for further study because it not only contains a putative miR-7 target site in its 3′UTR but also is associated with the cell cycle. To identify whether CUL5 is a direct target of miR-7, we constructed EGFP reporter vectors carrying the CUL5 3′UTR or mutant CUL5 3′UTR downstream of an EGFP stop codon. In both the QGY-7703 and HepG2 cell lines expressing the wild type 3′UTR, the EGFP expression level was significantly higher than the pcDNA3 control group transfected with miR-7. When miR-7 was blocked by ASO-miR-7, EGFP intensity was significantly reduced compared to the ASO-NC group. Importantly, miR-7 levels did not affect EGFP intensity in cells expressing the mutant 3′UTR (Figs. 3A and 3C). Thus, miR-7 can directly bind to the 3′UTR of CUL-5 and enhance its expression.

image

Figure 3.  CUL5 is a direct target gene of miR-7. A, C: EGFP reporter assays were performed to confirm the direct action of miR-7 on the 3′UTR of CUL5. B, D: Real-time RT-PCR was performed to detect the level of CUL5 mRNA in QGY-7703 and HepG2 cells treated with pri-miR-7 or ASO-miR-7. E: Western blot analysis was used to detect the protein levels of CUL5 in QGY-7703 and HepG2 cells transfected with pri-miR-7 or ASO-miR-7. F: CUL5 mRNA levels were detected by real-time RT-PCR in the twelve pairs of HCC tissues and normal tissues.

Download figure to PowerPoint

miR-7 Upregulates the Expression of CUL5

Next, we confirmed that CUL5 is a novel target of miR-7 using an EGFP reporter system. Moreover, CUL5 mRNA levels were reduced in HCC tissues, and its expression was positively correlated with that of miR-7 in 12 paired HCC tissues (Fig. 3F), in a uniform manner (Figs. 3B and 3D). Similar results were observed for CUL-5 protein levels, as determined by Western blot assays (Fig. 3E). These data indicate that miR-7 positively regulates CUL5 expression.

Knockdown of CUL5 Suppresses Cell Proliferation by Arresting Cell Cycle Progression In Vitro

To determine the function of CUL-5 in proliferation and the cell cycle, we inhibited CUL-5 expression using small interfering RNAs (siRNAs) in QGY-7703 and HepG2 cells and monitored its effects. siRNA knockdown of CUL5 suppressed cell viability, colony formation (Figs. 4A and 4B), and caused G1/S-phase transition. Compared to control group, there were more cells in S phase and less cells in G1 phase, as well as a lower PI in cells lacking CUL-5 (Figs. 4C–4E). These effects are similar to the results observed with miR-7 inhibition. These data demonstrate that CUL5 inhibits HCC cell proliferation and induces cell cycle arrest.

image

Figure 4. Knockdown of CUL5 promotes cell growth by accelerating cell cycle progression in vitro. A: MTT assays were used to measure the influence of CUL5 knockdown on cell viability and cell proliferation. B: Colony formation assays. C: Cell cycle distribution was analyzed by FACS. D, E: The PI was calculated as described previously.

Download figure to PowerPoint

Ectopic Expression of CUL5 Counteracts the Effect of ASO-miR-7 on Cell Growth and G1/S Phase Transition

To confirm that miR-7 inhibits HCC cell growth and causes cell cycle arrest via CUL5, we constructed an expression vector pcDNA3.1/HA-CUL5 lacking the 3′UTR or CUL5 and validated its expression in HCC cells by Western blotting (Fig. 5E). Ectopic expression of CUL-5 counteracted the effects of ASO-miR-7 on HCC cell proliferation and the cell cycle (Figs. 5A–5D). Thus, miR-7 inhibits proliferation and causes cell cycle arrest by positively regulating CUL5 expression in HCC cells.

image

Figure 5. Effect of CUL5 on of the phenotype of QGY-7703 and HepG2 cells. Cells were transfected with ASOmiR-7 or ASO-NC, with CUL5 expression vector (lacking the 3′-UTR) or empty vector. The MTT assay (A), colony formation assay (B), FACS (C, D), and Western blotting (E) was performed to assess cell growth and cell cycle alterations.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

In this study, we demonstrated that miR-7 is downregulated in clinical samples, suggesting that low miR-7 levels may be related to the malignant phenotype of HCC. To understand this process, we examined the effect of miR-7 over-expression in QGY-7703 and HepG2 cells. Ectopic miR-7 suppressed colony formation and cell viability. Furthermore, flow cytometry analysis demonstrated that overexpression of miR-7 arrested QGY-7703 and HepG2 cells in G1/S phase. Moreover, ASO-miR-7, an antisense oligonucleotide, had the opposite effect on QGY-7703 and HepG2 cells.

Studies of cancer-related miRNAs and their targets are needed to fully understand their role in tumorigenesis [15]. Recently, it was reported that miRNAs either prevent translation or promote the degradation of specific targets by binding to the 3′UTRs of target mRNAs [16]. However, a novel assortment of miRNAs can function to post-transcriptionally stimulate gene expression through direct mechanisms, a process termed “activation” [17]. For instance, miR-20a upregulates TNKS2 in cervical cancer cells [18], and miR-145 upregulates myocardial mRNA during muscle differentiation [19]. Therefore, miRNA-mediated upregulation is target specific and depends on distinct target mRNAs. Here, we report that the CUL5 transcript contains a predicted miR-7 binding site. We used a fluorescent reporter assay to confirm the interaction between miR-7 and CUL5, revealing that miR-7 binds directly to the 3′UTR of CUL5 and positively regulates its gene expression. Meanwhile, real-time PCR and Western blot assays demonstrated that miR-7 facilitates endogenous CUL5 expression at both the mRNA and protein levels. Moreover, CUL5 is downregulated in clinical samples. Suppression of CUL5 promoted cell growth, viability, and G1/S transition in QGY-7703 and HepG2 cells. Restoration of CUL5 counteracted the malignant phenotype and the G1/S-phase arrest checkpoint induced by ASO-miR-7. However, the mechanism of miRNA-mediated upregulation of CUL5 remains unknown.

Taken together, our results demonstrate that miR-7 and CUL5 expression are downregulated in HCC tissues. miR-7 suppresses hepatoma cell growth and cell cycle progression, at least in part, through the upregulation of CUL5 expression. These findings may contribute to our understanding of HCC, and it may be valuable for the development of diagnostic and treatment approaches.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This work was supported by the National Natural Science Foundation of China (Nos. 91029714; 31071191; 31270818; 31101000) and the Natural Science Foundation of Tianjin (09JCZDJC175 00; 12JCZDJC25100).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References