Heterologous expression and characterization of human cellular glutathione peroxidase mutants

Authors

  • Xiao Guo,

    1. College of Pharmaceutical Science, Jilin University, Changchun, China
    Search for more papers by this author
    • X.G. and Y.Y. contributed equally to this article.

  • Yang Yu,

    1. College of Pharmaceutical Science, Jilin University, Changchun, China
    Search for more papers by this author
    • X.G. and Y.Y. contributed equally to this article.

  • Xixi Liu,

    1. College of Pharmaceutical Science, Jilin University, Changchun, China
    Search for more papers by this author
  • Yinlong Zhang,

    1. College of Pharmaceutical Science, Jilin University, Changchun, China
    Search for more papers by this author
  • Tuchen Guan,

    1. College of Pharmaceutical Science, Jilin University, Changchun, China
    Search for more papers by this author
  • Guiqiu Xie,

    Corresponding author
    1. College of Pharmaceutical Science, Jilin University, Changchun, China
    • Address correspondence to: Jingyan Wei, College of Pharmaceutical Science, Jilin University, 1266 Fujin Road, Changchun 130021, China. Tel.: +86–431-85619716. Fax: +86–431-85619252. E-mail: jingyanweijluedu@163.com or Guiqiu Xie, College of Pharmaceutical Science, Jilin University, 1266 Fujin Road, Changchun, 130021, China. Tel.: +86-431-85619716. Fax: +86-431-85619252. E-mail: jiegq@jlu.edu.cn

    Search for more papers by this author
  • Jingyan Wei

    Corresponding author
    1. College of Pharmaceutical Science, Jilin University, Changchun, China
    • Address correspondence to: Jingyan Wei, College of Pharmaceutical Science, Jilin University, 1266 Fujin Road, Changchun 130021, China. Tel.: +86–431-85619716. Fax: +86–431-85619252. E-mail: jingyanweijluedu@163.com or Guiqiu Xie, College of Pharmaceutical Science, Jilin University, 1266 Fujin Road, Changchun, 130021, China. Tel.: +86-431-85619716. Fax: +86-431-85619252. E-mail: jiegq@jlu.edu.cn

    Search for more papers by this author

Abstract

Cellular glutathione peroxidase (GPx1; EC1.11.1.9) is a major intracellular antioxidant selenoenzyme in mammals. However, the complicated expression mechanism of selenocysteine (Sec)-containing protein increases the difficulty of expressing human GPx1 (hGPx1) in Escherichia coli (E. coli). In this study, hGPx1 gene was cloned from a cDNA library of the human hepatoma cell line HepG2. The codon UGA encoding Sec49 of hGPx1 was first mutated to UGC encoding cysteine (Cys) and then biosynthetically converted to Sec during expression in an E. coli BL21(DE3)cys auxotrophic system. Seleno-GPx1Sec displayed a low GPx activity of 522 U/μmol. To improve the activity, the other five Cys residues (C2, C78, C115, C156, C202) were mutated to serine (Ser) in one hGPx1 molecule. The mutant seleno-hGPx1Ser showed a high activity of 5278 U/μmol, which was more than 10-fold enhanced as compared with seleno-GPx1Sec. The activity was the highest among all of those seleno-proteins obtained by this method so far. Kinetic analysis of seleno-hGPx1Ser showed a typical ping-pong mechanism, which was similar to those of natural GPxs. This research will be of value in overcoming the problem of limited sources of natural GPx and substantially promotes the research of the characterization of GPx. © 2014 IUBMB Life, 66(3):212–219, 2014

Introduction

Reactive oxygen species (ROS) are associated with a variety of disease states, such as atherosclerosis, cancer, Parkinson's disease, diabetes, and aging [1, 2]. The harmful effects of ROS are balanced by the antioxidant action of antioxidant enzymes and nonenzymatic antioxidants [3]. Central antioxidant enzymes include superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx). As a scavenger of ROS, GPx is a critical selenoenzyme which can protect biomembranes and other cellular components from oxidative damage by catalyzing the reduction of hydrogen peroxide (H2O2), organic hydroperoxides, and lipid peroxides to water and the corresponding alcohol, using reduced glutathione (GSH) as an essential cosubstrate [4, 5]. Up to date, eight distinct GPxs have been identified in mammals and these isozymes differ from each other by the structure, substrate specificity, and tissue distribution [6].

GPx1 was the first seleno-containing enzyme to be identified, which is widely expressed and particularly abundant in erythrocytes, kidney, and liver [7, 8]. The pivotal role of GPx1 in protection against different oxidative stressors has been widely demonstrated [9-11]. In the absence of GPx1, it will result in reductions in antioxidant defense and lead to diverse disease progression [12].

Sec encoded by the stop codon UGA is the catalytic group in the active site of GPx [13]. To synthesize GPx, both prokaryotic and eukaryotic cells have their own mechanism of Sec insertion [14]. Selenocysteine insertion sequence (SECIS) in the open reading frame would be needed for expression of a eukaryotic selenoprotein in bacteria. However, the major obstacle to such engineering is that the introduction of SECIS would alter the amino acid sequence and may affect the biological function of the enzyme. Owing to the difficulty in gene recombination technique and important biological roles of GPx, many research efforts have been made to mimic the function of GPx. Ebselen, a synthetic eleno-organic compound, is in phase II clinical trials for the treatment of acute ischemic stroke [15]. Due to the application of Ebselen, several methods for its derivates synthesis have been developed [16, 17]. Glutathione S-transferase (GST) and glutaredoxin (Grx) are natural protein scaffolds with intrinsic GSH-binding sites and widely used to redesign GPx mimics [18, 19]. Furthermore, a number of GPx mimics have been built by a monoclonal antibody and bioimprinting techniques, which introduce the GSH binding site into the models [20, 21].

In this study, we prepared the recombinant hGPx1 using the cysteine auxotrophic system, which could effectively incorporate Sec into protein. The catalytic activity was greatly affected following all Cys residues in the protein changed to Sec in this system. After all Cys residues in hGPx1 were mutated to Ser residues, the mutant displayed remarkably higher activity toward H2O2. The biological properties of the mutant seleno-hGPx1Ser were also characterized.

Materials and Methods

Bacterial Strains, Plasmids, and Media

Bacterial strains and plasmids used in this study are listed in Table 1. The medium used in subcloning experiments and site-directed mutagenesis was Luria-Bertani broth. The media used in expression experiments were a modification of the minimal medium described previously [22].

Table 1. Strains and plasmids
Strains/plasmidsRelevant genotype or descriptionSource or reference
Strains
DH5αSupE44 Δlac U169 (ϕ80 lac ZΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1Invitrogen
BL21(DE3)hsdS gal (lcIts857 ind1 sam7 nin5 lacUV5-T7 gene 1)Invitrogen
BL21(DE3)cysBL21(DE3) selB::kan cysE51[23, 24]
Plasmids
pCold ICloning and expression vector, AmprTakara
pCGpCold I with hGPx1 fragment in NdeI-HindIIIThis study
pCG(U49C)pCold I with hGPx1 (U49C) fragment in NdeI-HindIIIThis study
pCG(C2/78/115/156/202S)pCold I with hGPx1 (U49C,C2/78/115/156/202S) fragment in NdeI-HindIIIThis study

Construction of Plasmids

The cDNA library from human hepatoma cell line HepG2 was used as a template for polymerase chain reaction (PCR). Amplification primers hGPx1-F/hGPx1-R (Table 2) were designed using the hGPx1 cDNA sequences in NCBI. DNA was amplified in a 50 μL volume containing 1 μL template cDNA, 200 μM concentration of each deoxynucleoside triphosphate, 25 pM concentration of the respective primer, 1.5 U of Taq DNA polymerase (TAKARA), and 1× Taq polymerase buffer. PCR was executed under the following conditions: preheating for 120 sec at 94 °C; 30 cycles of 30 sec at 94 °C, 45 sec at 55°C, and 60 sec at 72°C; 10 min at 72 °C. PCR fragments containing sequences encoding hGPx1 were cut with NdeI and HindIII and cloned into pCold I vector that was previously linearized with similar enzymes to give pCG expression vector. Positive clones were verified by enzyme digestion.

Table 2. Primers used in this study
Gene(s)Sequence 5′→3′
  1. Italics indicate the substitutions which resulted in mutation.

hGPx1-FGGAATTCCATATGTGTGCTGCTCGGC
hGPx1-RCCCAAGCTTCTAGGCACAGCTGGGC
C2S-FGAAGGTAGGCATATGTCTGCTGCTCGGCTAGCG
C2S-RCGCTAGCCGAGCAGCAGACATATGCCTACCTTC
U49C-FGAATGTGGCGTCCCTCTGCGGCACCACGGTCCGGGAC
U49C-RGTCCCGGACCGTGGTGCCGCAGAGGGACGCCACATTC
C78S-FGTGCTCGGCTTCCCGAGCAACCAGTTTGGGC
C78S-RGCCCAAACTGGTTGCTCGGGAAGCCGAGCAC
C115S-FCATGCTCTTCGAGAAGAGCGAGGTGAACGGTGC
C115S-RGCACCGTTCACCTCGCTCTTCTCGAAGAGCATG
C156S-FCACCTGGTCTCCGGTGAGTCGCAACGATGTTGC
C156S-RGCAACATCGTTGCGACTCACCGGAGACCAGGTG
C202S-FCTCAAGGGCCCAGCTCTGCCTAGAAGCTTGTC
C202S-RGACAAGCTTCTAGGCAGAGCTGGGCCCTTGAG

Point mutations were generated by QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) according to manufacturer's recommendations, and the mutagenic primers used in this study are listed in Table 2. The mutagenesis PCR reactions contained 50 ng template plasmid, 25 pmol of mutagenic primers, 0.1 mM of dNTP, 2.5 U of PfuTurbo DNA polymerase. The reaction was executed under the following conditions: preheating for 120 sec at 95 °C and 18 cycles of 30 sec at 95 °C, 60 sec at 55 °C, and 12 min at 68 °C. Add 1 μL of the DpnI restriction enzyme directly to the amplification reaction to digest the parental DNA template. The products were transformed E. coli DH5α. All mutated constructs were sequenced to confirm that no additional mutations had been introduced into the sequences.

Overexpression and Purification of the Protein

Plasmid DNA of pCG(U49C) and pCG(C2/78/115/156/202S) transformed into BL21(DE3)cys for the production of selenoproteins. Overexpression of seleno-hGPx1 and the mutant in the presence of Sec instead of Cys was performed using the method described previously [24, 25]. Crude protein extracts were prepared in buffer A containing 20 mM sodium phosphate (pH 7.4) and 500 mM NaCl. The proteins were purified by the immobilized metal affinity chromatography purification system using standard Ni2+ charged beads. Unspecifically bound proteins were eluted by a washing step with three column volumes of buffer A containing 20 mM, 50 mM, 75 mM, and 100 mM imidazol. After the column was washed, the target protein was eluted with 300 mM imidazole and dialyzed in 150 mM NaCl to remove imidazole. The 6× His tag at N-terminus was removed by treatment with a factor Xa protease (New England Biolabs). Concentration of proteins was estimated by the Bradford method using bovine serum albumin as a standard.

PAGE and Western Blot Analysis

Cells and the purified protein were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Coomassie Blue staining. Purified protein samples diluted 1:1 with nondenaturing loading buffer [50 mM glycine (pH 8.0), 20% glycerol (vol/vol)], and the mixture was electrophoresed using a 10% native PAGE gel (pH 8.0) with Tris/Glycine running buffer. For Western blotting, protein samples were loaded on a 12% (w/v) SDS-PAGE gel. When it was complete, the proteins on the gel were electrophoretically transferred to nitrocellulose membrane. The membrane was blocked with Tris-borate-NaCl (TBS) containing 5% nonfat dry milk for 1 h at 37°C and incubated with mouse anti-His6 monoclonal antibodies (Pharmacia) (1:1,000) at 37°C for 1 h. The membrane was washed three times with TBST and incubated with goat anti-mouse monoclonal antibody (Pharmacia) conjugated with horseradish peroxidase with gentle agitation for 1 h at 37°C. Reacting proteins were visualized by 3,3N-diaminobenzidine tertrahydrochloride (DAB)-H2O2 substrate that gave brown color.

Assay of Enzyme Activities

GPx activities were assayed according to the method previously described by Wilson [26]. The reaction was carried out at 37°C in 500 μL of solution containing 50 mM PBS (pH 7.4), 1 mM EDTA, 1 mM GSH (Sigma), 0.25 mM NADPH (Sigma), one unit of glutathione reductase, and 20–50 nM of samples. The mixture was preincubated for 5 min at 37 °C and the reaction was then initiated by addition of substrate (0.5 mM H2O2). GPx activity was determined by the decrease of NADPH absorption at 340 nm. Negative control was performed in parallel without enzyme and was subtracted from assay values. The activity unit (U) is defined as the amount of the protein that uses 1 μmol of NADPH per min. The specific activity is expressed in U/μmol.

Determination of Optimal pH and Temperature

GPx activity of seleno-hGPx1Ser was measured with the same method as above. The pH value of buffer was changed in determining the initial rates of the reaction to obtain the optimal pH condition for seleno-hGPx1Ser catalyzed reaction. Similarly, the optimal temperature was determined by assaying the activity at various reaction temperatures.

Assay of Kinetics of Seleno-hGPx1Ser

Steady-state kinetics was carried out following the method as described above [19]. The initial rates were measured by observing the decrease of NADPH absorption at 340 nm at several concentrations of one substrate while the concentration of the second substrate was kept constant. GPx activities were measured using the same method as described above at 37 °C and pH 7.4.

Results and Discussion

Human GPx1, a major selenium-containing antioxidant enzyme in mammal, has been implicated in proliferation, apoptosis, activation of transcription factors, and modulating inflammation [27]. Due to its essential function, many efforts have been made to obtain natural GPx and its mimics with prominent activities. In this context, the aim of this work was to express hGPx1 in Cys auxotrophic expression system and characterize its properties.

A full-size hGPx1 cDNA was generated by PCR as described under Materials and Methods section. To express the gene of hGPx1 in E. coli, the codon UGA encoding Sec49 was first mutated to UGC encoding Cys. Then hGPx1 was expressed in Cys auxotrophic strain system, which could be efficiently replaced Cys with Sec in BL21(DE3)cys when Cys was omitted in the medium. However, there are five Cys residues in the protein; multi-Sec substitutions on hGPx1 would affect the structure and property of the protein in this expression system [22, 28, 29]. Based on the results of previous studies, we constructed the mutant that the other five Cys in hGPx1 were mutated to Ser before introducing Sec at position 49.

Heterologous expression of seleno-hGPx1Sec and seleno-hGPx1Ser gave a 24-kDa band visualized by Coomassie staining of SDS-PAGE (Fig. 1A) and the same band was detected by Western blot (Fig. 1C), which indicated that the hGPx1 mutants were successfully expressed and purified. The N-terminal 6× His-tag was removed by digestion with Factor Xa protease, as was proved by SDS-PAGE (Fig. 1B) the molecular weight was smaller than before. Figure 1D showed the results of the analysis of expression. There is no target band in the E. coli transformed with recombinant plasmid before induction (lane 2) and the soluble form of seleno-hGPx1Ser were produced in the expression (Lane 3). The complex of nondenatured and denatured seleno-hGPx1Ser migrated as two bands with apparent molecular weights of 97 kDa and 24 kDa (Lane 5). The denatured and nondenatured enzyme migrated as a single band but showed a distinct migration rate on native page (Fig. 1E). These results indicated that seleno-hGPx1Ser existed in solution as a tetrameric complex, which corresponded to the naturally occurring form of GPx1 [13].

Figure 1.

PAGE and Western blot analysis of recombinant hGPx1. SDS-PAGE analysis of purified seleno-hGPx1Sec and seleno-hGPx1Ser with (A) and without (B) 6× His tag. (C) Western blot analysis of purified seleno-hGPx1 mutants. (D) SDS-PAGE analysis of fractions from E. coli BL21(DE3)cys cells transformed with pCGPx1(C2/78/115/156/202S). Lane 1, marker; lane 2, soluble fraction of E. coli without isopropyl-β-d-1-thiogalactopyranoside (IPTG) induction; lane 3, soluble fraction of E. coli after IPTG induction; lane 4, the purified seleno-hGPx1Ser; lane 5, the complex with nondenatured and denatured seleno-hGPx1Ser. (E) Nondenaturing PAGE analysis of the purified seleno-hGPx1Ser. Lane 1, denatured seleno-hGPx1Ser; lane 2, nondenatured seleno-hGPx1Ser. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com .]

To test the catalytic capability of seleno-hGPx1Sec and seleno-hGPx1Ser, the activities were estimated by the coupled enzyme system under the same conditions. Seleno-hGPx1Sec showed a low GPx activity of 522 U/μmol. It could be proposed that the substitutions of the multi-Sec for Cys residues, especially at position 2, 78, 115, 156, and 202 at the same time in the auxotrophic strain, caused a considerable change of the hGPx1 structure and affected the catalytic activity. Seleno-hGPx1Ser displayed a high GPx activity of 5,278 U/μmol that was more than 10-fold higher than that of seleno-hGPx1Sec. Accordingly, the increasing GPx activity of the mutant should result from the conversion of the five Cys residues to Ser, which has been widely recognized. To examine whether the 6× His tag may have an impact on the structure and enzyme activity, equal amounts of pure seleno-hGPx1Sec and seleno-hGPx1Ser proteins without 6× His tag were added for activity assays as described in Material and Methods section. There is no significant difference in the activity between seleno-enzyme with and without 6× His tag. It suggested that 6× His tag had little effect on the structure and activity of the enzyme. However, considering the introduction of 6× His tag may increase immunogenicity of the mutant, it is encouraged to remove the 6× His tag in the future clinical applications.

The capability of catalytic activity of seleno-hGPx1Ser toward H2O2 was found to be much more efficient than most of previous GPx mimics (Table 3). For instance, it was about 5,300-fold higher than Ebselen, which is currently being used in clinical trials against stroke [30]. The activity was still the highest among all of those seleno-proteins obtained by this method so far. And it even could be comparable to those of natural GPx, such as human GPx4 [31], human plasma GPx [32], bovine liver GPx [33], and rabbit liver GPx [34] whose activities were in the order of 102−103 U/μmol. In summary, our data demonstrate a major role for the mutant in protection against H2O2.

Table 3. The GPx activities of seleno-hGPX1 mutants and other catalyst
CatalystActivity (U/µmol)
seleno-hGPx1Sec522 ± 58
seleno-hGPx1Ser5,278 ± 335
Ebselen [30]0.99
seleno-hGrx1 [18]136
seleno-hGSTZ1-1 [19]2,266
GPx (human plasma) [32]302
GPx (bovine liver) [33]2,084
GPx (rabbit liver) [34]5,780

High GPx activity of seleno-hGPx1ser could be attributed to basing the natural hGPx1 scaffold with a conserved catalytic center and an intrinsic GSH binding site. At the catalytic moiety of natural GPx1, Sec and the specific binding site for GSH lie in a shallow groove of the enzyme surface, which is prone to recognize and combine with GSH [13]. In addition, the conserved catalytic triad (Sec, Trp, and Gln) and Arg residues surrounding the active-site selenium composed a unique active center of GPx1, which would facilitate the nucleophilic attach on the hydroperoxide and involve in GSH binding via electrostatic attraction [35]. These characteristics of seleno-hGPx1Ser exhibited an incomparable ability of reduction of peroxides with GSH, which hardly possesses in most GPx mimics.

Temperature and pH exert a significant impact on the catalytic reactions of GPx. So the activity was performed at different temperatures and pH to determine optimal conditions for seleno-hGPx1Ser. It was examined over the temperature range from 20.0 °C to 70.0 °C. As shown in Fig. 2, seleno-hGPx1Ser displayed the highest enzyme activity at 37 °C. At 50 °C relative GPx activity displayed a sharp decrease reaching a value of about 75%, and increasingly higher temperatures resulted in a steady decrease of relative activity, reaching a value of about 45% at 70°C. And the activity was also measured under various pH conditions [6-12]. The enzyme had an optimum pH at 9 (Fig. 2), which was close to the optimum pH8.5 of natural GPx1 from human liver [36] and the optimum pH8.8 of natural GPx1 from bovine red blood cells [37]. It is obvious that the activity of seleno-hGPx1Ser at pH 7.4, 37 °C was only 26% of its maximum at pH 9, 37 °C, but it is still the highest among all GPx mutants and mimics prepared using this method.

Figure 2.

Properties of seleno-hGPx1Ser. The activities were determined when the concentration of GSH and H2O2 were 1 and 0.5 mM, respectively. (A) Relative GPx activity versus temperature. (B) Relative GPx activity versus pH. The GPx activity was converted to the relative value, and the highest activity was defined to be 100%.

To probe the mechanism of seleno-hGPx1Ser, comprehensive kinetic studies were carried out. The initial velocities for H2O2 reduction catalyzed by seleno-hGPx1Ser were determined as a function of substrate concentration when the concentration of one substrate was varied and that of the other was fixed. Equation [1] is the relevant steady-state rate equation. kcat is the pseudo-first-order rate constant, math formula and math formula are the apparent Michaelis constants for peroxide and thiol, respectively. The apparent kinetic parameters deduced from Equation [1] and obtained at several GSH and H2O2 concentrations are listed in Table 4. The apparent second-order rate constant math formula and math formula were found to be 1.39 × 107 M−1 min−1 and 1.30 × 107 M−1 min−1, respectively. Although the value of math formula was lower than natural hGPx1 [38], it was much higher than those of some GPx mimics [30, 39]. It illustrated that the rate of catalytic reaction between the enzyme and H2O2 was slower than the natural one, but faster than those mimics. The value of math formula was in the same order of magnitude as that of natural hGPx1 [38], indicating that seleno-hGPx1Ser and native GPx had similar affinities to GSH. It should still be ascribed to the special catalytic center of natural GPx, which could stabilize intermolecular interactions.

Table 4. The kinetic parameters of seleno-hGPx1Ser
[GSH] (mM)kcat (min−1) math formula (M)kcat/ math formula(M−1min−1)
3283 ± 45(2.04 ± 0.24) × 10−5(1.39 ± 0.41) × 107
5636 ± 31(4.58 ± 0.21) × 10−5(1.39 ± 0.15) × 107
82,460 ± 103(1.77 ± 0.37) × 10−4(1.39 ± 0.28) × 107
1043,668 ± 598(3.14 ± 0.26) ×10−3(1.39 ± 0.23) × 107
[H2O2] (μM)kcat (min1) math formula (M)kcat/ math formula(M−1min−1)
30291 ± 23(2.24 ± 0.13) × 10−5(1.30 ± 0.18) × 107
50694 ± 38(5.30 ± 0.21) × 10−5(1.30 ± 0.19) × 107
8013,386 ± 624(1.03 ± 0.26) × 10−4(1.30 ± 0.24) × 107
10040,983 ± 925(3.12 ± 0.25) × 10−3(1.30 ± 0.37) × 107

Double reciprocal plots of the initial velocities versus concentrations of the substrates generate a group of parallel lines (Fig. 3), these values fit in the ping-pong mechanism in analogy with those of natural GPx [38]. That is to say, the catalytic reaction of the enzyme comprises two independent events: oxidation of the reduced enzyme by hydroperoxide and reduction of the oxidized enzyme by GSH [40]. Furthermore, treatment of seleno-hGPx1Ser with excess iodoacetate resulted in complete loss of GPx activity, suggesting the presentation of the enzyme-bound selenol in the catalytic cycle. All these facts are in agreement with those of native GPx.

display math(1)
Figure 3.

Double-reciprocal plots for the reduction of H2O2 by GSH catalyzed by seleno-hGPx1Ser. (A) [E]0/V0 versus 1/[H2O2] (mM−1) at [GSH] = 3 mM (black filled square), 5 mM (red filled circle), 8 mM (green filled triangle), 10 mM (blue filled down triangle). (B) [E]0/V0 versus 1/[GSH] (mM−1) at [H2O2] = 30 μM (black filled square), 50 μM (red filled circle), 80 μM (green filled triangle), 100 μM (blue filled down triangle). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

In conclusion, we successfully cloned hGPx1 gene and expressed seleno-hGPx1 mutant proteins in E. coli using cysteine auxotrophic expression system. The enzymatic properties also have been characterized. Seleno-hGPx1Ser shows an excellent antioxidant capacity in the protection of hydrogen peroxide that could compare with other artificial selenoenzymes. This should be attributed to the structure of natural GPx, which contains a conserved catalytic center and the GSH binding site. We expect that this research would provide a suitable enzymatic model for a further studying of the relationships between structures and functions of GPx. In addition, seleno-hGPx1Ser will be a potential candidate as an oxidant for medical applications.

Acknowledgements

The authors thank Prof. Marie-Paule Strub and August Böck for providing the E. coli Cys auxotrophic strain, BL21(DE3)cys. This work is supported by the National Natural Science Funds, China (Nos. 30970633 and 31270851) and Doctoral Funding Grants, Norman Bethune Health Science Center of Jilin University (No. 2013B73333).

Abbreviations
GPx

glutathione peroxidase

hGPx1

human glutathione peroxidase 1

Sec

selenocysteine

GSH

glutathione

HepG2

human hepatoma cell line

SDS-PAGE

sodium dodecyl sulfate-polyacrylamide gel electrophoresis

PCR

polymerase chain reaction.

Ancillary