SEARCH

SEARCH BY CITATION

Keywords:

  • NAC transcription factors;
  • stress response;
  • senescence;
  • gene regulatory networks;
  • interactomes

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. NAC Structure as an Interaction Platform
  5. NAC Gene Regulatory and Protein Networks in Stress Responses and Senescence
  6. Conclusion
  7. Acknowledgements
  8. References

Plant-specific NAM/ATAF/CUC (NAC) transcription factors (TFs) have recently received considerable attention due to their significant roles in plant development and stress signaling. Here, we summarize progress in understanding NAC TFs in stress responses and senescence. We focus on interactions between the DNA-binding NAC domain and target genes, and between the large, mostly disordered transcription regulatory domain of NAC TFs and protein interaction partners. Recent studies have identified both up-stream regulators of NAC genes and down-stream NAC target genes, outlining regulatory networks associated with NAC–protein interactions. This connects molecular interactions and signal pathway intersections with biological functions with promising use in agriculture. © 2014 IUBMB Life, 66(3):156–166, 2014


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. NAC Structure as an Interaction Platform
  5. NAC Gene Regulatory and Protein Networks in Stress Responses and Senescence
  6. Conclusion
  7. Acknowledgements
  8. References

Some transcription factor (TF) families are highly expanded, while others have restricted evolutionary proliferation. The NAM/ATAF/CUC (NAC) TFs have only been identified in plants—from mosses to angiosperms—with approximately 110 genes in the model Arabidopsis thaliana [1] and 150 genes in rice [2]. Although NAC proteins were initially associated with development [3], they are increasingly appreciated for their roles in stress responses and senescence [4, 5].

The most well-characterized, stress-associated NAC TFs belong to sub-group III-3 [1], also known as stress-responsive NAC (SNAC) [2]. Three closely related members of this sub-group, ANA019, ANAC055, and ANAC072 (RD26), are induced by drought, high salinity, and the hormones abscisic acid (ABA) and jasmonic acid (JA). ABA controls many physiological processes in plants and is recognized for its role in abiotic stress responses [6], whereas JA is implicated in regulation of wounding and biotic stress responses [6]. Overexpression of each of the three NAC TFs results in up-regulation of several stress-inducible genes and improved drought tolerance [7], and ANAC019 and ANAC072 function as positive regulators of ABA signaling [1, 8]. In addition, ANA019 and ANAC055 are implicated in JA-signaling following pathogen infection [9, 10]. Other sub-group III-3 NAC TFs are also implicated in abiotic and biotic stress responses [11]. The most successful application of NAC TFs in crop engineering so far also involves a rice sub-group III-3 NAC TF, SNAC1, whose over-expression enhances drought resistance and salt tolerance in transgenic rice plants. Importantly, SNAC1 transgenics have higher seed set in the field than the negative control under severe drought stress conditions [12]. Recently ANAC096 of sub-group IV-1 [1] was also shown to mediate ABA-dependent adaptation to dehydration and osmotic stresses in Arabidopsis [13]. Thus, NAC TFs regulate abiotic stress tolerance and hold the potential for improving stress tolerance in transgenic plants.

Uauy et al. [14] showed in 2006 that replacement of a non-functional NAC allele in modern wheat with a functional ancestral counterpart results in increased wheat protein, zinc, and iron content. This initiated great interest in the role of NAC TFs in senescence. Leaf senescence is a key process in plants and involves the action of a large number of TFs among which NAC TFs are prominent [15]. ORESARA1 (ORE1)/ANAC092/NAC2 and ORESARA1 SISTER1 (ORS1) of sub-group II-3 and AtNAP of sub-group III-2 are positive regulators of senescence [16-18], whereas JUNGBRUNNEN1 (JUB1) of sub-group V-1 is a negative regulator [19]. For example, overexpression of ORE1 in transgenic plants triggers early senescence, and ORE1 functions by controlling the expression of various senescence-associated genes (SAGs) [16]. ORE1 is one of several senescence-associated NAC TFs which is also implicated in abiotic stress responses [20, 21].

In this review, we relate insights on NAC structure to specific interactions with target genes and other proteins in gene regulatory networks (GRNs) and protein–protein interaction networks relevant to stress responses and senescence. The focus is on selected Arabidopsis NAC TFs for which detailed molecular interactions have been characterized.

NAC Structure as an Interaction Platform

  1. Top of page
  2. Abstract
  3. Introduction
  4. NAC Structure as an Interaction Platform
  5. NAC Gene Regulatory and Protein Networks in Stress Responses and Senescence
  6. Conclusion
  7. Acknowledgements
  8. References

The NAC Domain

NAC TFs contain an N-terminal dimerization and DNA-binding domain (DBD), the NAC domain, and diverse C-terminal transcription regulatory domains (TRDs) (Fig. 1). The crystal structure of the 168 amino acid residues NAC domain from Arabidopsis ANAC019 revealed a novel dimeric TF fold consisting mainly of β-sheets [22]. Recently, interactions of the NAC domain with a palindrome of the seven base pair ANAC019 binding site (BS) [23] were probed both by crystallography and in solution [24]. The NAC domain inserts an outer β strand with the highly conserved WKATQTD sequence into the major groove of DNA (Fig. 1a) in a manner similar to that of the plant-specific WRKY TF family and the mammalian family of glia cell missing (GCM) TFs. This mechanistic similarity may be explained either by a common evolutionary origin or mechanistic convergence of these TFs. Several conserved basic amino acid residues are within DNA-binding distance. However, changing of only Arg-88 into alanine resulted in significant impairment of DNA binding, suggesting that this residue is most import for DNA binding [24]. This NAC–DNA model provides a platform for investigating NAC–DNA interactions and for engineering—possibly to redirect NAC TFs in GRNs.

image

Figure 1. Structure of NAC proteins. (a) X-ray structure of the NAC019 NAC DBD in complex with the ANAC019 binding site 5′-TCAGTCTTGCGTGTTGGAACACGCAACAGGGA-3′ (PDB accession code 3SWP). Specific phosphates of the NACBS protected from cleavage in uranyl photo-footprinting in the presence of ANAC019 are shown by bold lines and the NAC binding core is underlined [24]. (b) Schematic structure of an intrinsically disordered NAC C-terminus. Sub-group specific sequence motifs, representing putative protein interaction determinants, some of which may represent regions with local structure, for example, preformed structural elements or molecular recognition features, are shown. (c) ID and interactions of NAC TFs. ID was predicted using PONDR-FIT [25] with a threshold value of 0.5. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Download figure to PowerPoint

What is the NAC Binding Site?

Several recent studies have addressed NAC binding to synthetic oligonucleotides and target promoters using different methods (Table 1). Binding of ANAC019 has been investigated in several independent studies. The minimal sequence required for ERD1 promoter binding by ANAC019 contains the NAC core motif, as in the case of binding by ANAC055 and ANAC072 [7]. This is in accordance with the sequence needed for binding of ANAC019 and ANAC055 to the VEGETATIVE STORAGE PROTEIN1 (VSP1) promoter [9]. In addition, the NAC binding site (BS) TTNCGTA was obtained by systematic evolution of ligands by exponential enrichment (SELEX) [23]. In all cases, the BSs contain the CGT[AG] core motif. However, biochemical analysis also shows decreased susceptibility of specific phosphates outside the core of the palindromic NAC BS to cleavage in uranyl photo-footprinting in the presence of ANAC019. This demonstrates that bases flanking the core NAC BS are also involved in binding [24] (Fig. 1a). A sequence similar to the ANAC019 BS was recently identified for ATAF1 using newer technology based on protein binding microarrays (PBMs), which represents an unbiased and sensitive strategy for searching for consensus BSs [26]. This identified T[A,C,G]CGT[AG] and TT[A,C,G]CGTC as the most significant descriptors for ATAF1 binding. TTGCGTA is also present in the 131 bp promoter fragment shown by chromatin immunoprecipitation (ChIP) to be responsible for the binding of ATAF1 to its target gene 9-cis-epoxycarotenoid dioxygenase-3 (NCED3) [27]. Interestingly, ATAF2, a close paralog of ATAF1 [1], binds an unrelated sequence in the nitrilase 2 (NIT2) gene [28]. Originally T[TA][GA]CGT[GA][TCA][TA], also containing the NAC core motif, was selected as the preferred BS for ORE1 [23]. A bipartite BS was later defined for ORS1 [17] and ORE1, and one of the sites of the bipartite BS is conserved in the ORE1 target promoter of BIFUNCTIONAL NUCELASE1 (BFN1) [29]. The BS of JUB1 in the promoter of DEHYDRATION-RESPONSIVE ELEMENT-BINDING PROTEIN2A (DREB2A) [19], VND INTERACTING2 (VNI2) in the promoters of COLD-REGULATED (COR) and RESPONSIVE TO DEHYDRATION (RD) [20], and AtNAP in the promoter of SAG113 [30] also contain the NAC core motif. Interestingly, the relatively distant, membrane anchored NAC TFs NTL6 of sub-group I-1 and NTL4 of sub-group I-2 and ANAC096 also bind to promoter regions of the Pathogenesis-related1 (PR1) [31] gene, the Atrboh A, C, and E genes encoding ROS biosynthetic proteins [32], and the RD29A gene [13], respectively, which all contain the NAC core motif. In contrast, calmodulin (CaM)-binding (CB) NAC recognizes an unrelated site in the PR1 promoter [33, 34].

Table 1. DNA-binding by stress and senescence associated NAC proteins
NACMethodSynthetic DNA/target promoter (name)Ref.
  1. a

    NAC core motif is underlined.

  2. b

    Methylumbelliferyl β-d-cellobioside (MUC) substrate (29). W = AT; K = G, T; R = A, G; V = ACG; M = A, C; D = T, G, A; Y, C, T.

ANAC019 (055/072)Y1H5′-ACATGCGTGTNNNNNNNGA-3′ (ERD1)a[7]
ANAC019EMSA5′-TGCGTGGACATGCGTGGACATGCGTGGACATGCGTGGACATGCG-3′ (VSP1)a[9]
ANAC019SELEX, EMSA5′-WKNCGTR-3′[23]
ANAC019X-ray, footprint5′-TCAGTCTTGCGTGTTGGAACACGCAACAGGGA-3′[24]
ANAC019EMSA5′-CAGTCTTGCGTGTTGGAACACGCAACAGTC-3′[1]
ATAF1PBM5′-TVCGTR-3′ and 5′-TTVCGT-3′[27]
ATAF1ChIP5′-…TTGCGTA…-3′ (131 bp of NCED3)[27]
ATAF2EMSA5′-AAATAAGAAGGCAAATATAATTTGATAACAACTATT-3′ (35 bp of NIT2)[28]
ORE1SELEX, EMSA5′-TWRCGTRDW-3′[23]
ORE1EMSA5′-CAGTCTTGCGTGTTGGAACACGCAACAGTC-3′[1]
ORE1MUCb5′-VMGTRNNNNN(N)YACR-3′[29]
ORE1EMSA/CHiP5′…-ACGTANNNNNCGTG-…3′ (40/141 bp of BNF1)[29]
ORS1SELEX5′-RCGTRNNNN(N)RYACGCAA-3′[17]
JUB1SEELX5′-TGCCGTNNNNNNNACG-3′ 5′-TGCCGTNNNNNNNCCGC-3′[19]
JUB1EMSA/ChIP5′-…GATGCCGTTAGAGACACG…-3′ (40 bp of DREB2A)[19]
AtNAPY1H5′-…CACGTAAGT…-3′ (52 bp of SAG113)[30]
AtNAPEMSA5′-GCACGTAAGTGT-3′[30]
NTL6ChiP5′-TGGACCATGTATTTACAAAAACGTGAGATC-3′[31]
NTL4ChIP, Activation as.5′-…TTATGTCGTACGAAA…-3′ (AtrbohC) 5′-…TACGTGGCGTAATCC…-3′ (AtrbohE)[32]
ANA096EMSA5′-…CACGTATGAAGCGTCTGTTTTCGTGGT…-3′ (49 bp of RD29A)[13]
CBNACEMSA/ChIP5′-TAATAATGCTTAGTTATAAATTACT-3′ (239 bp of PR1)[33, 34]

In conclusion, NAC TFs involved in stress responses and senescence bind to a promoter region with the NAC core CGT[AG] motif. The different flanking sequences are also in contact with the NAC domain [24] and are likely determinants of both affinity and specificity of target promoter binding. ATAF2, which is also stress inducible [35], represents an exception and binds to an unrelated sequence in the NIT2 promoter encoding an auxin hormone synthesis gene [28]. Based on NAC domain sequence characteristics [1], ATAF2 is also likely to be able to bind to the NAC core motif. However, sub-specificities may be used by the NAC TFs in specialized cases such as regulation of the auxin pathway. NAC BSs with less stringent or without a NAC core motif have also been identified for NAC TFs which are not primarily associated with stress responses and senescence [4, 33]. Unraveling the GRNs controlled by TFs benefits from the identification of cis-regulatory elements to which they can bind. Thus, although the NAC BSs shown in Table 1 have not been identified in a systematic analysis for NAC BSs, the information may prove useful for identification of direct NAC target genes from accumulating data for NAC regulons.

The C-Terminal Transcription Regulatory Domains

Although NAC TFs are grouped according to their N-terminal DBD structures, they also contain a TRD. Several reports have shown that the NAC C-termini function either as transcriptional activators [1, 7, 36] or repressors [33, 37]. In a systematic analysis of the NAC TF family, 10 NAC proteins, representing functionally important and phylogenetically different clades and including ANAC019, ORE1, ATAF1, and NTL6, were analyzed for their ability to activate transcription in yeast. The transactivational activity of nine of these NAC proteins depends on their C-terminal regions [1]. Truncation of the C-terminal regions showed that the activity depends on short, group-specific sequence motifs such as the WQ and LP motifs [36, 38]. Jensen et al. [1] further dissected structure–function aspects of NAC TF modularity. Interestingly, not only full-length ANAC019 but also the ANAC019 DBD or TRD alone confers ABA hypersensitivity when ectopically expressed in plants, demonstrating the in vivo functional power of both of these domains. Domain-swapping experiments showed that chimeric proteins in which the ANAC019 NAC domain is replaced with the analogous domain from other NAC TFs also functions as positive regulators of ABA signaling. In contrast, replacing the ANAC019 TRD with other NAC TRDs abolished ANAC019-mediated ABA hypersensitivity, demonstrating in vivo functional specificity of a NAC TRD [1]. However, Taoka et al. [36] in 2004 showed that fusing TRDs from three different NAC TFs to the NAC domain of CUC2 maintained the shoot-inducing functionality of native CUC2. This suggests that domain-specific features associated with NAC TF functional specificity are difficult to predict.

In contrast to the structurally well-defined DBDs of TFs, the TRDs have a propensity for flexible protein segments that do not form fixed tertiary structures. This feature is known as protein intrinsic disorder (ID) [39]. Systematic in silico analysis of 10 NAC TFs suggested that their TRDs are mostly disordered (Fig. 1b) and contain short conserved subgroup-specific sequence motifs [1]. The motifs are often located in a short structured region within a large disordered region or at the border between ordered and disordered regions [1]. Such motifs may represent sites for protein interactions in the form of molecular recognition features [40] with a propensity for target-induced folding or pre formed structural elements [41]. Experimental analysis of ID in plant proteins is still limited [42] and has only been experimentally addressed for two NAC TFs, barley senescence-associated HvNAC005 and HvNAC013. These TFs were shown by biophysical analysis to be mostly disordered [38]. Furthermore, HvNAC013 interacts with barley RADICAL-INDUCED CELL DEATH1 (RCD1) via the very C-terminal part of its TRD. Surprisingly, a more extended conformation may form in the NAC TRD upon interaction with RCD1 [38]. Thus, fuzziness, defined as disorder in the partner bound state [43], may characterize the interaction of the HvNAC013 TRD with RCD1. Clearly, a goal is to improve structural information on the NAC TRDs to develop knowledge for future engineering of these malleable and powerful NAC TRDs.

Whereas knowledge about NAC gene regulatory networks has increased dramatically in recent years [4], a similar gain of knowledge has not been obtained for NAC–protein interactions. Many interactions can be expected for the large disordered NAC TRDs (Figs. 1b and 1c) which, due to their flexibility, may be able to adapt to several structurally diverse interaction partners [42]. The low number of interaction partners identified so far may reflect the challenges of identifying interaction partners of self-activating protein regions using yeast two hybrid screenings, and of regulatory proteins participating in transient interactions using protein purification methods.

NAC Gene Regulatory and Protein Networks in Stress Responses and Senescence

  1. Top of page
  2. Abstract
  3. Introduction
  4. NAC Structure as an Interaction Platform
  5. NAC Gene Regulatory and Protein Networks in Stress Responses and Senescence
  6. Conclusion
  7. Acknowledgements
  8. References

Identification of Specific NAC Target Genes

Several approaches have been used for identification of NAC downstream regulons. Microarray analyses have addressed putative downstream NAC targets [7, 16]. However, within the last few years many direct NAC targets genes have also been identified using different approaches. The approach used for identification of the ATAF1 target gene NCED3 was based on the ATAF1 BS determined by PBM analysis [27] in combination with co-expression analysis (Fig. 2a). The relevance of co-expression analysis is supported by the observations that co-expression occurs among TFs and their target genes and that co-expression clusters can be enriched for common TF binding sites [15]. The analysis resulted in 25 top-ranking genes co-expressed with ATAF1 showing strong induction by ABA, drought, osmotic, and salt stresses. These genes were analyzed for the PBM-derived ATAF1 BS in their promoters. This identified the key regulatory ABA biosynthetic gene NCED3 as a likely ATAF1 target. Furthermore, an ATAF1 BS was identified in the NCED3 promoter region that was enriched in ChIPs from ATAF1 overexpressing plants [27]. A different strategy using yeast one-hybrid screening also proved useful for identification of direct NAC target genes, as demonstrated by the identification of ANAC019, ANAC055, and ANAC072 as ERD1 binding and regulating TFs [7]. In this system, identification of ERD1 promoter binding TFs was dependent on the ability of fusions between the yeast GAL4 activation domain (AD) and a protein from an Arabidopsis expression library to activate expression of the marker genes HIS3 and lacZ [7] (Fig. 2b).

image

Figure 2. Strategies for identification of direct NAC target genes. (a) Identification of ATAF1 target genes combining PBM-based identification of ATAF1 binding sites and ATAF1 co-expression analysis under perturbation. ChIP verified the suggestion from initial analyses that NCED3 is a direct target gene of ATAF1 [27]. (b) Identification of ERD1 as a direct target of ANAC019/055/072. Identification of ERD1 promoter binding TFs exploited the ability of fusions between yeast GAL4 AD and transcription factors encoded by an Arabidopsis expression library to activate expression of the marker genes HIS3 and lacZ by binding to copies of an ERD1 promoter fragment fused to the HIS3 and lacZ genes [7]. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Download figure to PowerPoint

Sub-Group III Networks: From Stress Responses to Senescence

The first indications of a NAC-centered GRN came from the identification of ANAC019, ANAC055, and ANAC072 as direct regulators of ERD1, which encodes a Clp protease regulatory subunit (Fig. 3d) [44]. Overexpression of one of the three NAC genes is not sufficient for up regulation of ERD1 [7], but depends on co-expression with the zinc finger homeodomain TF ZFHD1. ZFHD1 also recognizes a cis-acting element in the ERD1 promoter and is up-regulated by drought, high salt, and ABA [45]. This suggests cooperative regulation of stress responses by different TF families in drought tolerance (Fig. 3a) through physical interaction between the NAC and the ZFHD1 TFs [45]. Microarray analysis of transgenic plants over expressing one of the three NAC TFs revealed up-regulation of the expression of several stress and ABA-inducible genes including RD29B, COR47, ERD11, and FER1 genes [1, 7] further supporting the role of these TFs in abiotic stress signaling.

image

Figure 3. Gene regulatory and protein–protein interaction networks of NAC TFs in stress responses and senescence. Direct interactions between the NAC TFs and DNA are shown by arrows (positive effect on expression) or blocked lines (negative effect on expression). Protein–protein interactions are shown by straight lines, and agonistic effects of these interactions are shown by arrows, whereas antagonistic effects are shown by blocked lines. Dashed arrows and lines refer to effects which may involve additional components. (a) Sub-group III-3 ANAC019, ANAC055, and ANAC072 GRN main associations are: MYC2 with JA-signaling and pathogen defense; MYBs, ABFs, and ABI with ABA-signaling and abiotic stress responses, CBF1, 2, and 3 with cold responses, and CBF4 also with ABA. Up-regulation of sub-group III-II ANAC019, ANAC055, and ANAC072 improves drought tolerance either directly or through interactions with ZFHD1. (b) Sub-group III-3 ATAF1 GRN. (c) Sub-group III-3 ATF2 GRN. (d) Sub-group III-2 AtNAP GRN. (e) Sub-group III-2 VNI1 GRN. (f) Sub-group V-1 JUB1 GRN. (g) Sub-group II-3 ORE1 GRN. (h) Sub-group IV-1 ANAC096 GRN. (i) Sub-group I-1 NTL6 GRN. (j) Sub-group I-2 NTL4 GRN. (k) Sub-group I-1 CBNAC GRN.

Download figure to PowerPoint

The first direct up-stream regulators of these three NAC TFs were recently identified in a yeast one-hybrid screen [21]. The key ABA-regulating bZIP TFs, ABA RESPONSIVE ELEMENT BINDING FACTOR3 (ABF3), and ABF4 [46], were identified by their ability to bind to NAC promoter fragments, in accordance with the ABA-association of the three NAC TFs [1, 7, 47]. ANAC019 and ANAC055 also interact with another key mediator of ABA-signaling, ABI4, an AP2 family TF [48]. Five members of the MYB TF family, MYB2, MYB21, MYB108, MYB112, and MYB116 also bound to the promoter fragments. In contrast, the four AP2 TFs, C-REPEAT/DEHYDRATION RESPONSIVE ELEMENT BINDING FACTOR1 (CBF1), CBF2, CBF3, and CBF4 bound to only the ANAC072 promoter. Modeling of expression and mutant analysis suggested further differential contribution to the regulation of the expression of the three NAC genes by potential regulators in stress responses and senescence. For example, of the MYB TFs which bind to the promoters of all three NAC TFs, only MYB2 and MYB108 are implicated in senescence, and although all four CBF TFs can regulate ANAC072, they may play different roles in binding under cold, osmotic and salt stresses, senescence, and during Botrytis cinerea infection [21].

Biotic stress GRNs are also appearing for the three NAC TFs. ANAC019 and ANAC055 are implicated in JA-dependent defense responses with their MeJA-induced gene expression depending on the JA-signaling components CORONTATINE INSENSITIVE1 (COI1) and the basic helix–loop–helix TF AtMYC2. In addition, over expression of ANA019 partially rescues the phenotype of the atmyc2-2 mutant [9]. The phenotype of the anac019anac055 double mutant, which exhibits decreased expression of the JA marker genes LIPOXYGENASE 2 (LOX2) and VSP1 (a direct ANAC019 target), also shows increased resistance to the necrotrophic pathogen B. cinerea [9]. Recently, ChIP was used to show that ANAC019, ANAC055, and ANAC072 are direct in vivo targets of MYC2 [49]. Coronatine, a toxin produced by the pathogenic bacterium Pseudonomas syringae and mimicking JA isoleucine, activates the three NAC genes. The NAC TFs mediate coronatine-induced stomatal reopening and bacterial propagation by inhibiting accumulation of the immune signaling hormone salicylic acid (SA), thereby promoting pathogen virulence. The NAC TFs exert this inhibitory effect by binding (at least in the case of ANAC019) to and repressing ISOCHORISMATE SYNTHASE1 (ICS1) and by activating S-ADENOSYLMETHIONINE-DEPENDENT METHYLTRANSFERASE (BSMT1) involved in SA biosynthesis and metabolism, respectively. Together these studies elucidate the complexity and intersections of the GRNs of ANAC019, ANAC055, and ANAC072 involving ABA- and JA-signaling and enhancing and repressing adaptive abiotic and biotic stress responses as well as developmental senescence signaling (Fig. 3a).

ANAC019 was originally identified as an interaction partner of the small RING-H2 protein RHA2a [47], a positive regulator of ABA-signaling, and a functional E3 ubiquitin ligase [50]. Additional RING-H2 proteins also interact with ANAC019 in yeast two-hybrid assays (Fig. 3a) [47]. However, it remains to be determined if these proteins regulate ANAC019 by ubiquitin-dependent degradation. A putative function of the interaction between ANAC019 and CTD phosphate-like1 (CPL1), which is essential for regulation of stress-responsive gene expression, also remains elusive [51]. Thus, a functional role has so far only been revealed for the interaction with ZFHD1. The NAC DBD has been shown to mediate the interaction with RHA2a and ZFHD1 (Fig. 1c), demonstrating the ability of this domain to interact with molecules other than DNA. Clearly, additional interaction partners, also targeting the disordered TRDs, can be expected.

ATAF1 targets the ABA-biosynthesis gene NCED3 in vivo, and ATAF1-mediated induction of NCED3 expression correlates with increased ABA levels (Fig. 3b) [27]. Plants over-expressing ATAF1 have reduced stomatal aperture [11], and transient expression of NCED3 in guard cells also decreases stomatal aperture [52] suggestive of overlapping physiological functions of ATAF1 and NCED3. Thus, ATAF1 may regulate ABA biosynthesis in a positive feed-back loop by binding to and activating the expression of NCED3. Plants over-expressing ATAF1 display stunted growth and delayed flowering, which is also the case for ABA-hypersensitive plants over-expressing the ATAF1 interaction partner kinase SnRK1.1/AKIN10 [53, 54]. This interaction is likely to involve the relatively disordered TRD of ATAF1 [53] (Fig. 1c). Future studies should address the functional and physiological consequences of this interaction in planta. However, ATAF1 seems largely dispensable for SnRK1 signaling as ataf1 mutant plants display wild-type phenotypes [27]. In addition to NCED3, several other putative ATAF1 targets show ATAF1-dependent expression perturbations. This is the case for ABI2, which as a typical clade A type 2C protein phosphate (PP2C) functions as a negative regulator of ABA signaling by dephosphorylating ABA-activated kinases [55]. Although speculative, the positive correlation between ATAF1 and ABI2 may reflect a negative feed-back loop to decrease endogenous ABA levels associated with ATAF1 induction to limit accelerated ABA signaling and thereby physiological defects [27].

ATAF2, closely related to ATAF1, is also induced by stresses (Fig. 3c) [35]. Recently, ATAF2 was shown to be involved in auxin hormone biosynthesis via regulation of NIT2 [28] encoding an enzyme converting indole-3-3acetonitril (IAN) into auxin in a pathway that can be activated by wounding and pathogens [56]. Expression of both ATAF2 and NIT2 was induced by IAN treatment, and ATAF2 activates the promoter of the NIT2 genes by direct binding. Further studies are needed to clarify how ATAF2 contributes to tryptophan-dependent auxin biosynthesis, which can be activated by wounding and pathogens, and if this is related to plant immunity [28].

The involvement of group III NAC TFs in senescence is clear from analysis of AtNAP (Fig. 3d). A T-DNA insertion knockout of AtNAP displays a delay in leaf senescence, and overexpression of AtNAP in young leaves causes precocious senescence suggesting that AtNAP is a positive regulator of senescence [18]. SAG113 is a direct target of AtNAP [30], and both AtNAP and SAG113 are induced by leaf senescence and ABA. SAG113, which encodes a Golgi-localized protein phosphatase 2C family protein phosphatase, mediates inhibition of stomatal closure resulting in water loss, and triggering senescence in leaves [30, 57].

The expression of VNI2 is induced by senescence and by salt in an ABA-dependent manner, and overexpression of VNI2 enhances resistance to salt stress and prolongs leaf longevity, similarly to the direct target genes COR15A, COR15B, RD29A, and RD29B (Fig. 1e) [20]. Thus, VNI2 integrates ABA-mediated abiotic stress signals and ageing. VNI2 is also an interaction partner of VASCULAR-RELATED NAC-DOMAIN7 (VND7) associated with programmed cell death (PCD) [37], suggesting that abiotic stress adaptation, senescence, and PCD are integrated via a VIN2 centered GRN. In conclusion, several group III NAC TFs are convergence points for different signaling pathways related to stress and senescence, and regulated by several different phytohormones.

JUB1: A Negative Regulator of Senescence

JUB1, a reactive oxygen species (ROS)-responsive NAC TF, delays senescence (Fig. 3f) [19]. The TF decreases intracellular H2O2 levels and activates the AP2 TF gene DREB2A which is important in abiotic stress responses [58]. DREB2A targets the RD29A [58] and HsfA3 [59] genes, and HsfA3 in turn regulates the expression of genes encoding HEAT SHOCK PROTEINS (HSPs) and H2O2 scavenging enzymes, and has been suggested to be part of a positive feedback loop together with HsfA1e and HsfA2 [60]. A model was proposed in which JUB1 acts through the HsfA3-associated feedback loop in lowering the intracellular H2O2 level, resulting in prolonged longevity and increased stress tolerance [19].

ORE1 Networks

As a key senescence-control TF ORE1 directly targets the BFN1, SAG29/SWEET15, and SINA1 genes [29], relating ORE1 to different physiological functions (Fig. 3g). ORE1 and BFN1 have overlapping expression patterns, and ANAC092 and BFN1 were suggested to constitute a regulatory cascade resulting in nucleic acid degradation during senescence and PCD [29]. SAG29, encoding a putative sugar transporter, accelerates senescence when overexpressed [61], possibly by altering sugar transport, and SINA1, encoding a putative E3 ubiquitin ligase, may mediate protein ubiquitination and degradation. ORE1 itself is controlled by mRNA degradation by the transacting micro(mi)RNA164 [62]. miR164 in turn is negatively regulated both by ETHYLENE INSENSITIVE 2 (EIN2), central to ethylene signaling [62], and by its downstream target gene EIN3, encoding a key TF in ethylene signaling which directly represses miR164 accumulation [63]. This again allows ORE1 mRNA accumulation [63].

The Golden2-like TFs, GLK1 and GLK2, were recently shown to interact with the ORE1 TRD [64] (Figs. 1c and 3f). GLK1 and GLK2 are important for chloroplast development and maintenance and thereby for leaf maintenance [65]. Whereas the interaction does not affect the transactivating ability of ORE1, it antagonizes GLK transcriptional activity. A model was proposed in which ORE1 accumulation and interaction with the GLKs at late stages of senescence result in ORE1-GLK heterodimers incapable of activating photosynthetic GLK target genes [64]. This regulatory interaction reveals a novel mechanism for fine tuning senescence and demonstrates the functional power of the ORE1 TRD in protein–protein interactions.

ANAC096: A Novel Player in Intersecting Abiotic Stress GRNs

The involvement of ANAC096 in ABA-mediated stress responses was suggested from a screen for mutants with ABA-hyposensitive phenotypes (Fig. 3h) [13]. ANAC096 functions as a positive regulator of ABA-responsive signaling under dehydration and osmotic stress, and a major proportion of ABA-responsive genes are transcriptionally regulated by ANAC096. It directly interacts with ABF2 and ABF4 (Fig. 1c), and ANAC096 and ABF2 synergistically activate RD29A transcription. Furthermore, the anac096 abf2 abf4 triple mutant is more sensitive to dehydration and osmotic stresses than the anac096 single mutant or the abf2 abf4 double mutant. ANAC096 was therefore suggested to synergistically activate, with the ABFs, ABA-inducible genes in response to dehydration and osmotic stress [13]. This is one of several examples of NAC TF interplay with other types of TFs which may be essential for rapid and specific regulation of gene expression upon stress exposure. In addition to enhancing specificity, such mechanisms allow synergistic effects from different pathways involved in different functions.

Interestingly, ANAC096 interacts with ABF2 and ABF4 but not with ABF3 [13]. The explanation for this differentiation of specificity remains elusive. The fact that ANAC096 has an agonistic, and ANAC019 an antagonistic relationship with ABF2 with respect to RD29A expression, also raises a biochemical question. As the NAC domains are highly conserved [1], ANAC096 and ANAC019 may use their mostly disordered and variable TRDs for the interaction with the ABFs [13]. This region of ANAC096 has also been suggested to be responsible for the interaction with the corepressor protein TOPLESS (TPL) [13].

Networks of Membrane-Anchored NAC TFs

The plasma membrane-anchored NTL6 of sub-group I-1 is proteolytically processed upon exposure to cold and migrates to the nucleus, where it induces the expression of the direct target genes PR1, PR2, and PR5, indicating that NTL6 mediates cold-induced pathogenesis (Fig. 3i) [31]. In addition, ABA promotes NLT6 processing, and transgenic plants overexpressing processed NTL6 are hypersensitive to ABA and high salinity [66]. Taken together, these observations indicate that NTL6 integrates plant responses to both biotic and abiotic stress conditions [66]. It was recently shown that Snf1-related protein kinase (SnRK) 2.8-mediated phosphorylation of NTL6 is necessary for nuclear import of NTL6 [67]. Overexpression of NTL6 results in enhanced drought resistance, as does overexpression of SnRK2.8, and SnRK2.8 knock-out compromises the effect of NTL6 overexpression. This suggests that the SnRK2.8-mediated phosphorylation of NTL6 is important for the NTL6-mediated induction of drought-resistance [67].

The ABA, drought, and heat inducible NTL4 gene encodes a sub-group I-2 membrane-anchored NAC TF which promotes ROS production during drought-induced senescence in Arabidopsis (Fig. 3j). NTL4 directly up-regulates the Atrboh (A, C, and E) genes encoding ROS biosynthetic proteins [32]. Leaf senescence is accelerated in transgenic plants overexpressing proteolytically processed NTL4 under drought conditions, and these transgenics are hypersensitive to drought and ROS accumulates in their leaves. These observations indicate that NTL4 regulates ROS generation as part of processes controlling drought-induced leaf senescence in Arabidopsis [32]. In conclusion, membrane-anchored NTL TFs are nodes connecting different signaling pathways of abiotic and biotic stress responses and of abiotic stress responses and senescence.

An interesting mechanism of suppression of basal pathogen resistance has been reported for CBNAC/NTL9 whose membrane anchoring is debated (Fig. 3k) [33, 68]. cbnac1 mutants display enhanced resistance to the bacterial pathogen P. syringae (Pst) through relief of PR1 repression. SUPPRESSOR OF NONEXPRESSOR OF PR GENES1, INDUCIBLE1 (SNI1), also a negative regulator of PR1 expression, interacts with CBNAC and enhances binding of CBNAC to the PR1 promoter. Thus, CBNAC and SNI1 could function synergistically as negative regulators of PR1 expression and disease resistance to prevent detrimental effects of constitutive activation of defense on plant growth [34], or they could be Pst effector targets guarded by specific Arabidopsis R genes. The C-terminal of the NAC TF is also used for their interaction in this case (Fig. 1c).

Conclusion

  1. Top of page
  2. Abstract
  3. Introduction
  4. NAC Structure as an Interaction Platform
  5. NAC Gene Regulatory and Protein Networks in Stress Responses and Senescence
  6. Conclusion
  7. Acknowledgements
  8. References

Recent knowledge of NAC-TF centered gene regulatory and protein–protein interaction networks in stress responses and senescence has revealed novel aspects of the biological roles and molecular mechanisms of these powerful TFs. These regulators are themselves regulated transcriptionally and post-transcriptionally at the RNA level, as well as through protein–protein interactions, post translational modifications, and possibly regulated protein turn-over. Structure analysis has revealed how the NAC domain targets both bases from the NAC core BS and from flanking regions present in target genes mediating diverse processes important to plant growth and production. It has also recently become clear from studies of HvNAC013, ORE1, ATAF1, and CBNAC how the mostly disordered NAC TRDs possess enormous potential for regulatory interactions. In particular, the interactions of NAC TFs with unrelated TFs raise the question of how and why plants apply such interactions in stress responses. Under stress, plants experience dramatic transcriptional reprogramming to improve survival. Here, it may be a clear advantage to use multiple pathways. In addition, the physiologically important cooperative interactions between NAC TFs and unrelated TFs may affect both DNA binding affinity and specificity through interactions with several cis-acting promoter elements and activity of the interacting TFs. Future research should illuminate the structural basis of these interactions. In general, the NAC-centered networks reveal intersections between pathways involved in abiotic stresses, biotic stresses, senescence, and PCD. Near future research in the NAC field should further address NAC-centered GRNs using systems biology and modeling strategies and structure-defined yeast 2-hybrid or in planta screenings. Detailed understanding of these molecular networks is a prerequisite for engineering of NAC TFs which represent an enormous future breeding potential for agriculture.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. NAC Structure as an Interaction Platform
  5. NAC Gene Regulatory and Protein Networks in Stress Responses and Senescence
  6. Conclusion
  7. Acknowledgements
  8. References

This work was supported by the Danish Agency for Science Technology and Innovation grant numbers 274-07-0173 (to K.S.)

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. NAC Structure as an Interaction Platform
  5. NAC Gene Regulatory and Protein Networks in Stress Responses and Senescence
  6. Conclusion
  7. Acknowledgements
  8. References
  • 1
    Jensen, M. K., Kjaersgaard, T., Nielsen, M. M., Galberg, P., Petersen, K., et al. (2010) The Arabidopsis thaliana NAC transcription factor family: structure-function relationships and determinants of ANAC019 stress signalling. Biochem. J. 426, 183196.
  • 2
    Nuruzzaman, M., Manimekalai, R., Sharoni, A. M., Satoh, K., Kondoh, H., et al. (2010) Genome-wide analysis of NAC transcription factor family in rice. Gene 465, 3044.
  • 3
    Olsen, A. N., Ernst, H. A., Leggio, L. L., and Skriver, K. (2005) NAC transcription factors: structurally distinct, functionally diverse. Trends Plant Sci. 10, 7987.
  • 4
    Puranik, S., Sahu, P. P., Srivastava, P. S., and Prasad, M. (2012) NAC proteins: regulation and role in stress tolerance. Trends Plant Sci. 17, 17369.
  • 5
    Nakashima, K., Takasaki, H., Mizoi, J., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2012) NAC transcription factors in plant abiotic stress responses. Biochim. Biophys. Acta 1819, 97103.
  • 6
    Fujita, M., Fujita, Y., Noutoshi, Y., Takahashi, F., Narusaka, Y., et al. (2006) Crosstalk between abiotic and biotic stress responses: a current view from the points of convergence in the stress signaling networks. Curr. Opin. Plant Biol. 9, 9436.
  • 7
    Tran, L. S., Nakashima, K., Sakuma, Y., Simpson, S. D., Fujita, Y., et al. (2004) Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant Cell 16, 24812498.
  • 8
    Fujita, M., Fujita, Y., Maruyama, K., Seki, M., Hiratsu, K., et al. (2004) A dehydration-induced NAC protein, RD26, is involved in a novel ABA-dependent stress-signaling pathway. Plant J. 39, 39863.
  • 9
    Bu, Q., Jiang, H., Li, C. B., Zhai, Q., Zhang, J., et al. (2008) Role of the Arabidopsis thaliana NAC transcription factors ANAC019 and ANAC055 in regulating jasmonic acid-signaled defense responses. Cell Res. 18, 18756.
  • 10
    Schweizer, F., Bodenhausen, N., Lassueur, S., Masclaux, F. G., and Reymond, P. (2013) Differential contribution of transcription factors to Arabidopsis thaliana defense against Spodoptera littoralis. Front Plant Sci. 4, 13.
  • 11
    Wu, Y., Deng, Z., Lai, J., Zhang, Y., Yang, C., et al. (2009) Dual function of Arabidopsis ATAF1 in abiotic and biotic stress responses. Cell Res. 19, 191279.
  • 12
    Hu, H., Dai, M., Yao, J., Xiao, B., Li, X., et al. (2006) Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice. Proc. Natl. Acad. Sci. USA 103, 1298712992.
  • 13
    Xu, Z. Y., Kim, S. Y., Hyeon, d. Y., Kim, D. H., Dong, T., et al. (2013) The arabidopsis NAC transcription factor ANAC096 cooperates with bZIP-type transcription factors in dehydration and osmotic stress responses. Plant Cell 25, 47084724.
  • 14
    Uauy, C., Distelfeld, A., Fahima, T., Blechl, A., and Dubcovsky, J. (2006) A NAC gene regulating senescence improves grain protein, zinc, and iron content in wheat. Science 314, 12981301.
  • 15
    Breeze, E., Harrison, E., McHattie, S., Hughes, L., Hickman, R., et al. (2011) High-resolution temporal profiling of transcripts during Arabidopsis leaf senescence reveals a distinct chronology of processes and regulation. Plant Cell 23, 873894.
  • 16
    Balazadeh, S., Siddiqui, H., Allu, A. D., Matallana-Ramirez, L. P., Caldana, C., et al. (2010) A gene regulatory network controlled by the NAC transcription factor ANAC092/AtNAC2/ORE1 during salt-promoted senescence. Plant J. 62, 62250.
  • 17
    Balazadeh, S., Kwasniewski, M., Caldana, C., Mehrnia, M., Zanor, M. I., et al. (2011) ORS1, an H(2)O(2)-responsive NAC transcription factor, controls senescence in Arabidopsis thaliana. Mol. Plant 4, 346360.
  • 18
    Guo, Y. and Gan, S. (2006) AtNAP, a NAC family transcription factor, has an important role in leaf senescence. Plant J. 46, 46601.
  • 19
    Wu, A., Allu, A. D., Garapati, P., Siddiqui, H., Dortay, H., et al. (2012) JUNGBRUNNEN1, a reactive oxygen species-responsive NAC transcription factor, regulates longevity in Arabidopsis. Plant Cell 24, 482506.
  • 20
    Yang, S. D., Seo, P. J., Yoon, H. K., and Park, C. M. (2011) The Arabidopsis NAC transcription factor VNI2 integrates abscisic acid signals into leaf senescence via the COR/RD genes. Plant Cell 23, 21552168.
  • 21
    Hickman, R., Hill, C., Penfold, C. A., Breeze, E., Bowden, L., et al. (2013) A local regulatory network around three NAC transcription factors in stress responses and senescence in Arabidopsis leaves. Plant J. 75, 7526.
  • 22
    Ernst, H. A., Olsen, A. N., Larsen, S., and Lo, L. L. (2004) Structure of the conserved domain of ANAC, a member of the NAC family of transcription factors. EMBO Rep. 5, 5297.
  • 23
    Olsen, A. N., Ernst, H. A., Leggio, L. L., and Skriver, K. (2005) DNA-binding specificity and molecular finctions of NAC transcription factros. Plant Sci. 169, 169785.
  • 24
    Welner, D. H., Lindemose, S., Grossmann, J. G., Mollegaard, N. E., Olsen, A. N., et al. (2012) DNA binding by the plant-specific NAC transcription factors in crystal and solution: a firm link to WRKY and GCM transcription factors. Biochem. J. 444, 444395.
  • 25
    Xue, B., Dunbrack, R. L., Williams, R. W., Dunker, A. K., and Uversky, V. N. (2010) PONDR-FIT: a meta-predictor of intrinsically disordered amino acids. Biochim. Biophys. Acta 1804, 9961010.
  • 26
    Berger, M. F. and Bulyk, M. L. (2009) Universal protein-binding microarrays for the comprehensive characterization of the DNA-binding specificities of transcription factors. Nat. Protoc. 4, 4393.
  • 27
    Jensen, M. K., Lindemose, S., de, M. F., Reimer, J. J., Nielsen, M., et al. (2013) ATAF1 transcription factor directly regulates abscisic acid biosynthetic gene NCED3 in Arabidopsis thaliana. FEBS Open Bio. 3, 3321.
  • 28
    Huh, S. U., Lee, S. B., Kim, H. H., and Paek, K. H. (2012) ATAF2, a NAC transcription factor, binds to the promoter and regulates NIT2 gene expression involved in auxin biosynthesis. Mol. Cells 34, 305313.
  • 29
    Matallana-Ramirez, L. P., Rauf, M., Farage-Barhom, S., Dortay, H., Xue, G. P., et al. (2013) NAC transcription factor ORE1 and senescence-induced BIFUNCTIONAL NUCLEASE1 (BFN1) constitute a regulatory cascade in Arabidopsis. Mol. Plant 6, 14321452.
  • 30
    Zhang, K. and Gan, S. S. (2012) An abscisic acid-AtNAP transcription factor-SAG113 protein phosphatase 2C regulatory chain for controlling dehydration in senescing Arabidopsis leaves. Plant Physiol. 158, 158961.
  • 31
    Seo, P. J., Kim, M. J., Park, J. Y., Kim, S. Y., Jeon, J., et al. (2010) Cold activation of a plasma membrane-tethered NAC transcription factor induces a pathogen resistance response in Arabidopsis. Plant J. 61, 61661.
  • 32
    Lee, S., Seo, P. J., Lee, H. J., and Park, C. M. (2012) A NAC transcription factor NTL4 promotes reactive oxygen species production during drought-induced leaf senescence in Arabidopsis. Plant J. 70, 70831.
  • 33
    Kim, H. S., Park, B. O., Yoo, J. H., Jung, M. S., Lee, S. M., et al. (2007) Identification of a calmodulin-binding NAC protein as a transcriptional repressor in Arabidopsis. J. Biol. Chem. 282, 28236292.
  • 34
    Kim, H. S., Park, H. C., Kim, K. E., Jung, M. S., Han, H. J., et al. (2012) A NAC transcription factor and SNI1 cooperatively suppress basal pathogen resistance in Arabidopsis thaliana. Nucleic Acids Res. 40, 409182.
  • 35
    Delessert, C., Kazan, K., Wilson, I. W., Van Der Straeten, D., Manners, J., et al. (2005) The transcription factor ATAF2 represses the expression of pathogenesis-related genes in Arabidopsis. Plant J. 43, 43745.
  • 36
    Taoka, K., Yanagimoto, Y., Daimon, Y., Hibara, K., Aida, M., et al. (2004) The NAC domain mediates functional specificity of CUP-SHAPED COTYLEDON proteins. Plant J. 40, 40462.
  • 37
    Yamaguchi, M., Ohtani, M., Mitsuda, N., Kubo, M., Ohme-Takagi, M., et al. (2010) VND-INTERACTING2, a NAC domain transcription factor, negatively regulates xylem vessel formation in Arabidopsis. Plant Cell 22, 12491263.
  • 38
    Kjaersgaard, T., Jensen, M. K., Christiansen, M. W., Gregersen, P., Kragelund, B. B., et al. (2011) Senescence-associated barley NAC (NAM, ATAF1,2, CUC) transcription factor interacts with radical-induced cell death 1 through a disordered regulatory domain. J. Biol. Chem. 286, 28635418.
  • 39
    Dyson, H. J. and Wright, P. E. (2005) Intrinsically unstructured proteins and their functions. Nat. Rev. Mol. Cell. Biol. 6, 6197.
  • 40
    Vacic, V., Oldfield, C. J., Mohan, A., Radivojac, P., Cortese, M. S., et al. (2007) Characterization of molecular recognition features, MoRFs, and their binding partners. J. Proteome Res. 6, 62351.
  • 41
    Fuxreiter, M., Simon, I., Friedrich, P., and Tompa, P. (2004) Preformed structural elements feature in partner recognition by intrinsically unstructured proteins. J. Mol. Biol. 338, 3381015.
  • 42
    Kragelund, B. B., Jensen, M. K., and Skriver, K. (2012) Order by disorder in plant signaling. Trends Plant Sci. 17, 17625.
  • 43
    Tompa, P. and Fuxreiter, M. (2008) Fuzzy complexes: polymorphism and structural disorder in protein-protein interactions. Trends Biochem. Sci. 33, 332.
  • 44
    Nakashima, K., Kiyosue, T., Yamaguchi-Shinozaki, K., and Shinozaki, K. (1997) A nuclear gene, erd1, encoding a chloroplast-targeted Clp protease regulatory subunit homolog is not only induced by water stress but also developmentally up-regulated during senescence in Arabidopsis thaliana. Plant J. 12, 12851.
  • 45
    Tran, L. S., Nakashima, K., Sakuma, Y., Osakabe, Y., Qin, F., et al. (2007) Co-expression of the stress-inducible zinc finger homeodomain ZFHD1 and NAC transcription factors enhances expression of the ERD1 gene in Arabidopsis. Plant J. 49, 4946.
  • 46
    Fujita, Y., Fujita, M., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2011) ABA-mediated transcriptional regulation in response to osmotic stress in plants. J. Plant Res. 124, 124509.
  • 47
    Greve, K., La, C. T., Jensen, M. K., Poulsen, F. M., and Skriver, K. (2003) Interactions between plant RING-H2 and plant-specific NAC (NAM/ATAF1/2/CUC2) proteins: RING-H2 molecular specificity and cellular localization. Biochem. J. 371, 37197.
  • 48
    Reeves, W. M., Lynch, T. J., Mobin, R., and Finkelstein, R. R. (2011) Direct targets of the transcription factors ABA-Insensitive(ABI)4 and ABI5 reveal synergistic action by ABI4 and several bZIP ABA response factors. Plant Mol. Biol. 75, 75347.
  • 49
    Zheng, X. Y., Spivey, N. W., Zeng, W., Liu, P. P., Fu, Z. Q., et al. (2012) Coronatine promotes Pseudomonas syringae virulence in plants by activating a signaling cascade that inhibits salicylic acid accumulation. Cell. Host Microbe 11, 587596.
  • 50
    Bu, Q., Li, H., Zhao, Q., Jiang, H., Zhai, Q., et al. (2009) The Arabidopsis RING finger E3 ligase RHA2a is a novel positive regulator of abscisic acid signaling during seed germination and early seedling development. Plant Physiol. 150, 150463.
  • 51
    Bang, W. Y., Kim, S. W., Jeong, I. S., Koiwa, H., and Bahk, J. D. (2008) The C-terminal region (640–967) of Arabidopsis CPL1 interacts with the abiotic stress- and ABA-responsive transcription factors. Biochem. Biophys. Res. Commun. 372, 372907.
  • 52
    Melhorn, V., Matsumi, K., Koiwai, H., Ikegami, K., Okamoto, M., et al. (2008) Transient expression of AtNCED3 and AAO3 genes in guard cells causes stomatal closure in Vicia faba. J. Plant Res. 121, 121125.
  • 53
    Kleinow, T., Himbert, S., Krenz, H., Jeske, H., and Koncz, C. (2009) NAC domain transcription factor ATAF1 interacts with SNF1-related kinases and silencing of its subfamily causes severe developmental defects in Arabidopsis. Plant Sci. 177, 177360.
  • 54
    Jossier, M., Bouly, J. P., Meimoun, P., Arjmand, A., Lessard, P., et al. (2009) SnRK1 (SNF1-related kinase 1) has a central role in sugar and ABA signalling in Arabidopsis thaliana. Plant J. 59, 59316.
  • 55
    Ma, Y., Szostkiewicz, I., Korte, A., Moes, D., Yang, Y., et al. (2009) Regulators of PP2C phosphatase activity function as abscisic acid sensors. Science 324, 10641068.
  • 56
    Hillebrand, H., Bartling, D., and Weiler, E. W. (1998) Structural analysis of the nit2/nit1/nit3 gene cluster encoding nitrilases, enzymes catalyzing the terminal activation step in indole-acetic acid biosynthesis in Arabidopsis thaliana. Plant Mol. Biol. 36, 3689.
  • 57
    Zhang, K., Xia, X., Zhang, Y., and Gan, S. S. (2012) An ABA-regulated and Golgi-localized protein phosphatase controls water loss during leaf senescence in Arabidopsis. Plant J. 69, 69667.
  • 58
    Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., et al. (1998) Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 10, 13911406.
  • 59
    Schramm, F., Larkindale, J., Kiehlmann, E., Ganguli, A., Englich, G., et al. (2008) A cascade of transcription factor DREB2A and heat stress transcription factor HsfA3 regulates the heat stress response of Arabidopsis. Plant J. 53, 53264.
  • 60
    Nishizawa-Yokoi, A., Nosaka, R., Hayashi, H., Tainaka, H., Maruta, T., et al. (2011) HsfA1d and HsfA1e involved in the transcriptional regulation of HsfA2 function as key regulators for the Hsf signaling network in response to environmental stress. Plant Cell. Physiol. 52, 52933.
  • 61
    Seo, P. J., Park, J. M., Kang, S. K., Kim, S. G., and Park, C. M. (2011) An Arabidopsis senescence-associated protein SAG29 regulates cell viability under high salinity. Planta 233, 189200.
  • 62
    Kim, J. H., Woo, H. R., Kim, J., Lim, P. O., Lee, I. C., et al. (2009) Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis. Science 323, 10531057.
  • 63
    Li, Z., Peng, J., Wen, X., and Guo, H. (2013) Ethylene-insensitive3 is a senescence-associated gene that accelerates age-dependent leaf senescence by directly repressing miR164 transcription in Arabidopsis. Plant Cell 25, 33113328.
  • 64
    Rauf, M., Arif, M., Dortay, H., Matallana-Ramirez, L. P., Waters, M. T., et al. (2013) ORE1 balances leaf senescence against maintenance by antagonizing G2-like-mediated transcription. EMBO Rep. 14, 14382.
  • 65
    Waters, M. T., Moylan, E. C., and Langdale, J. A. (2008) GLK transcription factors regulate chloroplast development in a cell-autonomous manner. Plant J. 56, 56432.
  • 66
    Seo, P. J. and Park, C. M. (2010) A membrane-bound NAC transcription factor as an integrator of biotic and abiotic stress signals. Plant Signal. Behav. 5, 5481.
  • 67
    Kim, M. J., Park, M. J., Seo, P. J., Song, J. S., Kim, H. J., et al. (2012) Controlled nuclear import of the transcription factor NTL6 reveals a cytoplasmic role of SnRK2.8 in the drought-stress response. Biochem. J. 448, 448353.
  • 68
    Yoon, H. K., Kim, S. G., Kim, S. Y., and Park, C. M. (2008) Regulation of leaf senescence by NTL9-mediated osmotic stress signaling in Arabidopsis. Mol. Cells 25, 438445.