SEARCH

SEARCH BY CITATION

Keywords:

  • basolateral membrane;
  • folate;
  • alcoholism;
  • reduced folate carrier;
  • transport

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

The process of folate transport regulation across biological membranes is of considerable interest because of its ultimate role in providing one-carbon moieties for key cellular metabolic reactions and exogenous requirement of the vitamin in mammals. Although, intestinal folate malabsorption is established phenomena in alcoholism; however, there is no knowledge regarding the mechanism of folate exit across intestinal basolateral membrane (BLM) to circulation during alcohol associated malabsorption. In the present study, male Wistar rats were fed 1 g/kg body weight/day ethanol (20% solution) orally for 3 months and regulatory characteristics of folate transport at BLM surface were evaluated. The folate transport was found to be carrier mediated, saturable, with pH optima at 7.0, besides exhibiting Na+ independence. The chronic alcohol ingestion resulted in alteration of transport kinetics, shifting the process to K+ dependent one besides affecting the status of S[BOND]S linkage of the transport system. Importantly, chronic ethanol ingestion reduced the folate exit across the BLM by decreasing the affinity of transporter (high Km) for substrate and by decreasing the number of transporter molecules (low Vmax) on the surface. The decreased basolateral transport activity was associated with down-regulation of the reduced folate carrier (RFC) which resulted in decreased RFC protein levels in BLM in rat model of alcoholism. The study suggests that during alcohol ingestion, RFC mediated deregulated folate transport across BLM also attributes to folate malabsorption. © 2009 IUBMB IUBMB Life, 61(3): 236–243, 2009


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Folate is a highly lipophobic bivalent anion that can only minimally traverse biological membranes by simple diffusion. It plays a critical role in maintaining normal metabolic, differentiation and growth status of mammalian cells1. Because humans and other mammals cannot synthesize it, so they must obtain folate from exogenous source via intestinal absorption. The epithelium of the small intestine is located at a strategic interface where the intestinal lumen is in continuity with the external environment. After intracellular modifications, reduced and methylated form of folate crosses the basolateral enterocyte membrane by an active anion exchange mechanism into the portal circulation via submucosa2. The most well characterized folate transporter, the reduced folate carrier (RFC) is an integral membrane protein that mediates cellular uptake of reduced folates and antifolates and is ubiquitously expressed in tissues3, 4 to play a central role in tissue folate homeostasis. However, in contrast to our knowledge of molecular identity, functional properties and distribution of the RFC uptake system, little is known about the mechanisms that regulate membrane folate transport system in absorptive epithelia, particularly during pathophysiological conditions involving derangement in its transport. This is important because the processes involved in the absorption, transport and intracellular metabolism of folate are complex and are quite susceptible to cellular microenvironment5–8.

Folic acid deficiency is associated with chronic alcoholism worldwide and ethanol is considered as one of the most important toxin consumed regularly and in large quantities by humans9, 10. Alcohol intake exerts a multifaceted impact on the folate bioavailability and subsequently on one-carbon folate metabolism11. Regardless of cause, folate deficiency leads to a variety of clinical abnormalities like megaloblastic anemia and growth retardation, whereas optimization of folate homeostasis prevents certain disorders like neural tube defects12. Alcohol ingestion can be proposed to have role in activity of the RFC because of its association with intestinal folate malabsorption and hence folate deficiency. This inturn may influence the folate delivery via submucosa across basolateral membrane (BLM) and thereby to the body folate homeostasis, which also may attribute to alcohol induced folate deficiency. Earlier, we reported the derangement of RFC across intestinal brush border membrane (BBM) surface during chronic alcohol ingestion13. However, no studies have been attempted to deduce the activity of folate transport system in BLM under such conditions and its role in folate homeostasis. This is important in view of the fact that the basolateral surface not only regulates absorptive and secretory functions of the folate, but also processes it; thereby forms an important factor for determining circulatory folate concentrations. For this, the present work was sought to characterize the folate transport across the intestinal BLM and the role that expression of the RFC plays in folate transport during alcoholism. Such a study will help to understand the insights of folate transport impairment in alcoholism and also in conditions such as intestinal diseases and congenital disorders in the transport systems that might underlie similar mechanism.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Animals

Young adult male albino rats (Wistar strain) weighing 100–150 g were obtained from Institute's Central Animal House. The animals were housed in clean wire mesh cages with controlled temperature (23 ± 1 °C) and humidity (45–55%) and had 12 h dark light cycle throughout the study. The animals were acclimatized to laboratory conditions for few days before the experiment. The rats were randomized into two groups of six animals each, such that the mean body weights and the range of body weights for each group of animals were similar. The rats in group I were given 1 g ethanol (20% solution)/kg body weight/day and those in group II received isocaloric amount of sucrose (36% solution) orally by Ryle's tube daily for 3 months. The rats were fed commercially available pellet diet (Ashirwad Industries, India) and water ad libitum. The body weights of rats were recorded twice weekly. At the end of the treatment, animals from both the groups were sacrificed under anesthesia using sodium pentothal and blood was drawn for alcohol estimations employing alcohol dehydrogenase14. Starting from the ligament of Trietz; 2/3rd of small intestine was removed, flushed with saline and used for various studies.

Prior approval was sought from “Institutional Animal Ethical Committee” (IAEC) and “Institutional Biosafety Committee” (IBC) on commencement of the study.

Chemicals

Radiolabelled [3′, 5′, 7, 9-3H]-folic acid, potassium salt with specific activity 24.0 Ci/mmol was purchased from Amersham Pharmacia Biotech (Kwai Chung, Hong Kong). D-[U-14C]-glucose with specific activity 140 mCi/mmol was provided by Radioisotope Division, Bhabha Atomic Research Centre (Mumbai, India). DL-dithiothreitol (DTT) or Cleland's reagent were purchased from Sigma Aldrich Co. (St Louis, MO). Cellulose nitrate membrane filters (0.45 μm) were obtained from Millipore Corporation (Bedford, MA) and Percoll was procured from Fluka (Switzerland). Diaminobenzidine (DAB), HRP-labeled anti rabbit-IgG secondary antibodies were obtained from Bangalore Genei (Bangalore, India). All other chemicals and reagents used in this study were of analytical grade.

Isolation of Basolateral Membrane Vesicles From Small Intestine

Basolateral Membrane Vesicles (BLMV) from intestine were prepared by the self-generating percoll gradient method of Scalera et al.15 with some modifications. Tissue was flushed with ice cold normal saline and divided into 10 cm segments. Intestine was then slit open and mucosa scraped using a metal spatula. The scrapings were homogenized in ice-cold buffer containing 250 mM mannitol and 12 mM HEPES/Tris, pH 7.4 using a Waring blender for 3 min and then centrifuged at 2,500g for 20 min. The supernatant was then centrifuged at 22,000g for 25 min and the resulting fluffy layer of the pellet resuspended in same buffer followed by homogenization in glass Teflon homogenizer. The resulting homogenate was mixed with percoll at a concentration of 15.4% and centrifuged at 48,000g for 2 h. A distinct band of basolateral membrane vesicles (BLMV) was seen at the upper one third of the percoll gradient. The band was aspirated by a syringe and suspended in buffer composing 100 mM mannitol, 100 mM KCl, 12 mM HEPES/Tris, pH 7.4 and centrifuged at 48,000g for 20 min. The pellet obtained was resuspended in loading buffer containing 280 mM mannitol and 20 mM HEPES/Tris, pH 7.4 and centrifuged at 48,000g for 20 min twice in order to wash out the residual percoll from membrane preparations. The final pellet representing purified BLMV was suspended in loading buffer so as to obtain final protein concentration of 5 mg/mL. Purity of the membrane preparations was checked by measuring the specific activities of alkaline phosphatase and Na+, K+-ATPase in BLMV and in original homogenate by the method of Bergmeyer and Quigley and Gotterer16, 17 respectively. The vesicle preparations from both the groups showed enrichment of 8–10-fold with respect to Na+, K+-ATPase activity and with negligible activity of alkaline phosphatase. Under such conditions, the Na+, K+-ATPase activity was 3.07 ± 0.20 and 3.39 ± 0.32 μmol/min/mg protein in control and ethanol fed group respectively. The observed alkaline phosphatase activity was 0.102 ± 0.002 and 0.123 ± 0.010 μmol/min/mg protein in control and ethanol fed group respectively. It is interesting to mention here that Na+, K+-ATPase serves as the marker enzyme for the BLM and alkaline phosphatase to that of brush border membrane. Moreover, the vesicles were sealed and intact without any contamination of subcellular organelles, and were similar in the two groups of rats with right side out orientation. The method of Lowry et al.18 was used for the determination of protein concentration using bovine serum albumin as a standard. The functional integrity of the BLMV was checked by the [14C]-D-glucose uptake which didn't reveal a transient overshoot of the intravesicular glucose concentration over its equilibrium uptake in the presence of sodium gradient and suggested that the BLMV preparations were pure and without contamination of brush border membrane. Under these conditions, the values of [14C]-D-glucose uptake in control group were 35.29 ± 2.20 and 36.20 ± 3.20 pmol/30 sec/mg protein and in ethanol fed group 19.06 ± 2.81 and 19.69 ± 1.90 pmol/30 sec/mg protein, respectively.

Transport of [3H]-Folic Acid

Uptake studies were performed at 37 °C using the incubation buffer of 100 mM NaCl, 80 mM mannitol, 10 mM HEPES, 10 mM 3-[N-morpholino]ethanesulfonic acid (MES), pH 7.5 and 0.5 μM of [3H]-folic acid unless otherwise mentioned. Ten microliter of vesicles (50 μg protein) were added to incubation buffer containing [3H]-folic acid for fixed time interval. Reaction was stopped by adding ice-cold stop solution followed by rapid vacuum filtration. Non-specific binding to the filters was determined by residual filter counts after filtration of the incubation buffer and labeled substrate without vesicles. The radioactivity remained on the filters was determined by liquid scintillation counting (Beckman Coulter LS 6500). To determine the binding component of folate uptake, vesicles were equilibrated for 90 min in incubation buffers containing increasing concentrations of mannitol. Optimum conditions for maximum transport were chosen for various experiments performed as described19. For the determination of the inhibition constants, [3H]-folic acid at 0.5 and 1.0 μM concentrations were used in the presence of range of concentrations of either methotrexate or unlabeled folic acid viz 1, 2, and 3 μM.

RT-PCR Analysis

Total RNA was isolated from the jejunum following the method of Chomeczynski and Sacchi20. cDNA synthesis was carried out from the purified and intact total RNA according to manufacturer's instructions. Expression of RFC and β-actin was evaluated by PCR analysis using sequence specific primers corresponding to the sequence in the open reading frame. 20 μL PCR mixture was prepared in 1x PCR buffer consisting of 0.6 U of Taq polymerase, 2 μM of each primer both for β-actin and RFC along with 200 μM of each dNTP. In optimized PCR, the initial denaturation step was carried out for 2 min @ 95°C. The denaturation, annealing and elongation steps were carried out respectively for 1 min @ 94°C, 1 min @ 68°C, 1 min @ 72°C for 35 cycles. The final extension step was carried out for 10 min @ 72°C. The primers designed using Primer3 Input (version 0.3.0) were RFC, Forward5′GAACGTCCGGCAAC CACAG3′; Reverse 5′GATGGACTTGGAGGCCCAG3′ β-actin, Forward5′CACTGTGCCCATCTATGAGGG3′; Reverse 5′TCC ACATCTGCTGGAAGGTGG3′

Western Blot Analysis

For expression studies, isolated BLMV representing basolateral membrane proteins (100–150 μg) were resolved on 10% SDS-PAGE following the method of Laemmli21 and transferred to nitrocellulose membrane for 4–5 h at 4°C and the transfer was carried out at 25V or 300 mA. Western blotting was performed using the procedure described by Towbin et al.22 using polyclonal primary antibodies as rabbit anti-rat RFC (1:500 dilution) kindly provided by Dr. Hamid M. Said, Professor, Physiology & Biophysics, School of Medicine, University of California Irvine, USA and was raised against specific region of rat RFC synthetic peptide corresponding to amino acids 495–512 of the rat RFC. Secondary antibodies used were goat anti-rabbit IgG HRP-labeled (1:2,000 dilutions).

Statistical Analysis

The data was computed as mean ± SD. Group means were compared by using the Student's t-test, and analysis of variance was used wherever necessary. The acceptable level of significance was P < 0.05 for each analysis. All RT-PCR and western blot analyses were performed on 5 separate tissues from different animals with comparable results. The densitometric analyses of the products were determined using scion image software (Scion Image Corporation, Frederick, MD).

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Estimation of Blood Alcohol Levels

In order to reestablish the suitability of rat animal model for the studies on experimental alcoholism under our experimental setup, blood was drawn after 24 h of the last dose of ethanol to determine blood alcohol levels. It was found that considerable levels of alcohol (15.04 ± 1.96 mg/dL) were maintained in chronic ethanol fed group.

Kinetics of Folate Transport Across Intestinal BLMV

The carrier-mediated folic acid transport across the BLMV was observed to be 55% less in ethanol fed rats after 3 months of chronic ethanol ingestion (60.44 ± 3.32 vs. 27.19 ± 2.60 pmol/30 sec/mg protein). Folic acid uptake was studied at different time intervals from 20 sec to 5 min and uptake attained maximum value at 60 sec and thereafter decreased abruptly in control group and attained sharp peak at this time interval. However, in case of ethanol fed group, although the maxima obtained was at similar time point but the characteristic peak observed in control group was absent (Fig. 1). There was 13 to 73% (P < 0.05, P < 0.001) decrease in folate transport in ethanol fed group at various time intervals. To examine whether the folic acid associated with the membranes was due to uptake into the closed intravesicular space rather than a nonspecific binding to the vesicular membrane, the effect of varying medium osmolarities on the folic acid uptake was determined. After 90 min of equilibration of vesicles in various concentrations of mannitol, the plot of uptake vs. 1/osmolarity (Fig. 2) showed a linear relationship in both the groups. Moreover, uptake decreased 74 and 53% respectively in control and ethanol fed groups when the medium osmolarities were varied from 300 mosm to 600 mosm. Extrapolation of the line to infinite osmolarity showed negligible amount of folate binding to the membrane surface as maximum folate was taken up by the vesicles in the intravesicular space.

thumbnail image

Figure 1. [3H]-folic acid uptake in intestinal BLMV as a function of time (s). The incubation buffer of pH 7.5 and [3H]-folic acid concentration of 0.5 μM was used for uptake measurements. Each data point is mean ± SD of 3 separate uptake determinations carried out in duplicate. *P < 0.05, ***P < 0.001 vs. Control.

Download figure to PowerPoint

thumbnail image

Figure 2. [3H]-folic acid uptake in intestinal BLMV as a function of 1/osmolarity. BLMV were incubated in incubation buffers of varying osmolarities with pH 7.5 for 90 min before the transport measurements. Uptake was carried out after adding 0.5 μM [3H]-folic acid for 30 sec. Each data point is mean ± SD of 3 separate uptake determinations carried out in duplicate.

Download figure to PowerPoint

Further, to determine whether a proton gradient dependent exchange process is involved in folic acid transport across the intestinal BLMV, the effect of transmembrane pH was studied keeping inside pH constant at 7.5. As the pH was increased in the extravesicular medium from 5.0 to 7.0, the uptake increased in both the groups and thereafter declined and attained the constant value in alkaline pH (Fig. 3). In addition, a significant reduction of the order of 19 to 42% (P < 0.05, P < 0.01, P < 0.001) in transport was observed in ethanol fed group at different pH points studied at and above pH 7.0; however no such uniform reduction was observed in the acidic pH range. Further, kinetic constants were determined in BLMV by varying [3H]-folic acid concentration from 0.125 to 2.0 μM (Fig. 4). There was a gradual increase in folic acid uptake in the two groups of rats with increase in substrate concentration. In ethanol fed group, there was a significant 34 to 51% (P < 0.05, P < 0.01, P < 0.001) decrease in uptake as compared to control group at different concentrations of folic acid used. The data was then extrapolated as Lineweaver-Burk plot and kinetic constants were determined (Fig. 4 inset). The Km value in ethanol fed group was found to be 2.0 ± 0.21 μM in comparison to 1.42 ± 0.13 μM of control group (P < 0.01). In addition, Vmax in control and ethanol fed groups were 250 ± 20.50 and 167 ± 15.75 pmol/30 sec/mg protein (P < 0.001), respectively.

thumbnail image

Figure 3. Determination of the [3H]-folic acid uptake in intestinal BLMV with respect to pH optimum. BLMV were incubated in incubation buffers of different pH and 0.5 μM [3H]-folic acid concentration for 30 sec. Each data point is mean ± SD of 3 separate uptake determinations carried out in duplicate. *P < 0.05, **P < 0.01, ***P < 0.001 vs. Control.

Download figure to PowerPoint

thumbnail image

Figure 4. [3H]-folic acid uptake in intestinal BLMV as a function of substrate concentration (inset Lineweaver Burk plot). Uptake was measured by varying [3H]-folic acid concentration from 0.125 to 2.0 μM in the incubation medium of pH 7.5 after incubating BLMV for 30 sec. Each data point is mean ± SD of 3 separate uptake determinations carried out in duplicate. *P < 0.05, **P < 0.0l, ***P < 0.001 vs. Control.

Download figure to PowerPoint

Studying the effect of the structural analogues methotrexate and unlabelled folic acid on transport of [3H]-folic acid in BLMV showed that both the analogues inhibited the transport of [3H]-folic acid in a competitive manner. The inhibition constants (Ki) were determined by the Dixon plot in which 1/uptake (V) is plotted against various concentrations of analogue used at 0.5 and 1.0 μM of [3H]-folic acid concentration. The inhibition constants for methotrexate (Fig. 5a) in control and ethanol fed rats were respectively 1.0 ± 0.16 and 3.6 ± 0.26 μM and that of unlabelled folic acid (Fig. 5b) were 4.0 ± 0.13 and 1.10 ± 0.14 μM, respectively.

thumbnail image

Figure 5. Determination of Dixon constant for (a) methotrexate and (b) unlabeled folic acid in intestinal BLMV. [3H]-folic acid uptake at pH 7.5 was determined with its concentration at 0.5 and 1.0 μM in presence of different concentrations of structural analogs (1–3 μM). Each data point is mean ± SD of 3 separate uptake determinations carried out in duplicate.

Download figure to PowerPoint

The replacement of Na+ by K+ in the incubation medium did not show any significant effect on folic acid uptake in control group whereas as in ethanol fed group there was 50% (P < 0.01) increase in uptake under similar conditions (Table 1). On inclusion of the DTT in the incubation medium, folic acid transport showed increase by 30% (P < 0.001) and 45% (P < 0.01) in control and ethanol fed groups respectively.

Table 1. Effect of Na+ absence and DTT on [3H]-folic acid transport in BLMV of intestine
Reacting elementV (pmol/30 sec/mg protein)
ControlEthanol
  • Each value is mean ± SD of three separate uptake determinations carried out in duplicate. The uptake was carried out by using incubation buffer of pH 5.5 containing [3H]-folic acid (0.5μM). In Na+ free (-Na+) medium, 100 mM KCl replaced the NaCl in the incubation medium.

  • a

    P < 0.001 vs. Control.

  • b

    P < 0.01 vs. None.

  • c

    P < 0.001 vs. None.

None56.79 ± 0.7324.87 ± 0.33a
-Na+56.74 ± 3.3636.53 ± 1.27a,b
DTT73.66 ± 1.98c35.51 ± 1.17a,b

Expression of the mRNA Corresponding to RFC in jejunum

The findings that the folic acid uptake process has an apparent Km in the micromolar range strongly suggest that the process is mediated by RFC. In order to elucidate the mechanism of reduced folate transport in chronic alcoholism (i.e. high Km and low Vmax), transcriptional and translational regulation of the RFC was studied. For this, RT-PCR analysis was performed with the use of gene-specific primers corresponding to a sequence in the open reading frame of rat RFC and β-actin (as an internal control) and the expected products of size that is, 489 and 588bp for RFC and β-actin respectively were obtained on 1.2% agarose gel. The positive control amplified during the RT-PCR was the 1.1 kb RNA provided with the kit by the manufacturers; however the negative control used was the PCR reaction mixture without the polymerase. Quantification by densitometric analysis revealed that the relative mRNA for RFC was 3-fold lower (P < 0.001) in ethanol fed group (Fig. 6a and 6b). Thus, ethanol imparts its effect through transcriptional regulation of the RFC at the primary absorptive site of the folic acid in small intestine.

thumbnail image

Figure 6. RT-PCR analysis of RFC and β-actin as an internal control in jejunal tissues (a) resolved on 1.2% agarose gel electrophoresis and (b) densitometric analysis representing relative change in RFC mRNA expression. Data shown are representative of 5 separate sets of experiments. Lanes 1 and 2: Control; 3–5: Ethanol. ***P < 0.001 vs. Control.

Download figure to PowerPoint

Expression of the RFC Protein in Intestine

The effect of chronic alcoholism on the level of expression of the RFC protein at the intestinal BLM was studied by western blot analysis. Immunoblot analyses of the purified vesicles was performed to identify the RFC using polyclonal antibodies raised against specific region of rat RFC synthetic peptide corresponding to amino acids 494–512 of the rat RFC transporter and reactivity was found at approximately 65 kDa (Fig. 7a and 7b). The vesicles from chronic ethanol fed rats showed significant decrease in RFC protein level as compared to the respective controls and the difference in expression was to the extent of 1.5-fold (P < 0.05). Quantification was compared using β-actin as the loading internal control during blotting

thumbnail image

Figure 7. (a) Western blot analysis of intestinal BLMV using anti-RFC antibodies and reactivity was found at approximately 65 kDa and (b) densitometric analysis representing relative change in RFC protein levels. Data shown are representative of 5 separate sets of experiments. Lane 1: Control; Lane 2: Ethanol. *P < 0.05 vs. Control.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

In the present study, after 3 months of ethanol dosing at 1 g/kg body weight/day, it was observed that chronic ethanol feeding reduced the folate transport at BLM and the maximum uptake occurred at 60 sec interval. The uptake exhibited saturation kinetics in both the groups; therefore the carrier mediated transport system for folate operates at BLM surface. In order to determine the chemical driving force for uphill folate transport, the neutral or slightly alkaline pH was found to be the energizing force in the BLM. The results depicted that neither the inwardly nor outwardly directed H+ gradient is responsible for the folate uptake, as maximum folate uptake was observed at pH 7.5 inside and 7.0–7.5 outside pH. Such observation suggested that the driving force other than the transmembrane pH gradient might be responsible for the folate transport system to be operative at the BLM surface. This finding corroborated the earlier suggestion that the acidic microclimate is not necessary factor for operation of the active component of the folate transport system as previously proposed5, 23. Moreover, the folate transport at intestinal brush border membrane (BBM) is acidic pH dependent24 in contrast to that of neutral pH dependence at BLM observed in the present study. Such a discrepancy in pH dependence of folate transport on two membrane surfaces of the intestine suggests that either site specific modifications occurs on the transporter in the microenvironment or diverse transporters are involved in folate transport on these different membrane surfaces. The reduced uptake in ethanol fed rats was attributed to a significant increase in Km and decrease in Vmax which suggested that folate affinity and the number of carrier molecules on BLM surface decreases in chronic alcoholism. The higher value of Km in ethanol fed rats suggested that the folate exit across the BLM does not occur efficiently in chronic alcoholism. In addition, values of Km in both groups in BLM (2.0 and 1.42 μM) were high in comparison to that in BBM (1.53 and 0.90 μM)24 suggesting, the greater affinity for the folate exists in BBM in comparison to the BLM. Such findings indicate that the BBM of enterocytes is ideally adapted for efficient absorption of this essential nutrient. These results were in agreement to the earlier study, where high Km values for folate transport were observed in colonic BLM as compared to that in luminal membrane25. The osmolarity manipulation study demonstrated that the folic acid uptake by intestinal BLM was directed into the intravesicular space rather than towards extravesicular binding. Such data demonstrated that the binding component is not associated with the folate transport in BLM in contrast to renal BBM where a distinctive binding process involving folate binding protein has been suggested19. The values of the inhibition constants (Ki) in presence of the structural analogues under physiological conditions suggest the common uptake route for folic acid and its analogues in intestinal BLM as Ki values were similar to the Km values of the folate. A similar suggestion has also been made by earlier investigators26. However, in chronic alcoholism, the greater Ki values observed in the present study, suggested the folate transport system operates less efficiently for the analogs too upon chronic alcohol ingestion and may propose the deranged antifolate bioavailability may prevail more in alcoholics. Moreover, such findings further corroborated the involvement of a carrier mediated system for the transport of folic acid in BLM.

In line with the previous evidence2, the folate uptake was found to be Na+ and K+ independent under the physiological conditions; however under chronic alcoholic conditions, the process seemed to be dependent on the presence of K+ at the absorptive surface. Such an observation suggests that the alcohol ingestion may alter the presence of these ions at the folate exit site. Additionally, it remains to be determined whether, the carrier mediated folate transport is facilitated at BLM surface, because maximum transport was observed at neutral or slightly alkaline pH and the physiological system was found to be Na+ and K+ independent. The folate uptake system at the basolateral surface showed enhanced transport in the presence of DTT which might be attributed to increase in –SH group (s) on the transporter. The more increase in uptake in ethanol fed group in presence of DTT suggests that the higher number of accessible –SH group(s) on the transporter which inturn proposes that the conformation of the carrier at the folate exit site on BLM surface might be altered during alcoholism.

Importantly, the decreased Vmax in ethanol fed rats could relate to the reduced number of RFC molecules on BLM surface. In this context, the decrease in RFC mRNA and protein expression during alcoholism observed in the present study can be explained by the lesser stability of RFC mRNA or enhanced degradation of the RFC protein molecules at BLM surface during alcoholism. In addition, substantial evidence from studies in micropigs suggests that chronic exposure to ethanol at intoxicating serum levels alters RFC expression in jejunum27. Assuming that the RFC message level is a reflection of functional uptake across intestinal BLM surface, our results suggest that decreased RFC expression concomitantly with observed decrease in transport efficiency in BLM surface as a possible reason of lower blood folate levels commonly found in chronic alcoholics. Importantly, after chronic ethanol feeding, the decreased expression level of the RFC seems to be regulated at BLM surface by transcriptional and/or translational machinery. Future work should focus on the mechanism that underlies down-regulation of RFC during alcoholic conditions. In addition, recently identified proton coupled folate transporter (PCFT) has also been found important for folate transport in diverse tissues including intestine. However, role of PCFT as folate transporter at intestinal basolateral surface is questioning because of its acidic pH dependence in contrast to neutral or slightly alkaline pH dependence of folate transport at BLM.

Taken together, these results suggests that the folate transport at the intestinal BLM to be carrier mediated, saturable, pH dependent but Na+ independent process. Chronic ethanol ingestion reduces the folate exit activity across the BLM by a mechanism involving decreased affinity of the RFC to the folate and reduced number of its molecules on membrane surface as revealed by the kinetic and expression studies respectively. In addition, alcohol ingestion shifted the process to K+ dependent besides affecting the –SH status of the transport system.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

This work was supported by the financial grant sanctioned to Dr. Jyotdeep Kaur from Indian Council of Medical Research, New Delhi, India. Abid Hamid was recipient of fellowship from the Council of Scientific and Industrial Research, New Delhi, India.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  • 1
    Sabharanjak, S. and Mayor, S. ( 2004) Folate receptor endocytosis and trafficking. Adv. Drug. Deliv. Rev. 56, 10991109.
  • 2
    Said H. M. and Redha, R. ( 1987) A carrier-mediated transport for folate in basolateral membrane vesicles of rat small intestine. Biochem. J. 247, 141146.
  • 3
    Sirotnak, F. M. and Tolner, B. ( 1999) Carrier-mediated membrane transport of folates in mammalian cells. Annu. Rev. Nutr. 19, 91122.
  • 4
    Zhao, R. and Goldman, I. D. ( 2003) Resistance to antifolates. Oncogene. 22, 74317457.
  • 5
    Kumar, C. K.,Nguyen, T. T.,Gonzales, F. B., and Said, H. M. ( 1998) Comparison of intestinal folate carrier clone expressed in IEC- 6 cells and in Xenopus oocytes. Am. J. Physiol. Cell. Physiol. 274, C289C294.
  • 6
    Mason, J. B. and Choi, S. W. ( 2005) Effects of alcohol on folate metabolism: implications for carcinogenesis. Alcohol. 35, 235241.
  • 7
    Nguyen, T. T.,Dyer, D. L.,Dunning, D. D.,Rubin, S. A.,Grant, K. E., and Said, H. M. ( 1997) Human intestinal folate transport: cloning, expression, and distribution of complementary RNA. Gastroenterol. 112, 783791.
  • 8
    Rajgopal, A.,Sierra, E. E.,Zhao, R., and Goldman, I. D. ( 2001) Expression of the reduced folate carrier SLC19A1 in IEC-6 cells results in two distinct transport activities. Am. J Physiol. Cell. Physiol. 281, C1579C1586.
  • 9
    Poschl, G. and Seitz, H. K. ( 2004) Alcohol and cancer. Alcohol. Alcoholism. 39, 155165.
  • 10
    Salaspuro, M. P. ( 2003) Alcohol consumption and cancer of the gastrointestinal tract. Best. Prac. Res. Clin. Gastroenterol. 17, 679694.
  • 11
    Halsted, C. H.,Villanueva, J. A.,Devlin, A. M.,Niemela, O.,Parkkila, S.,Garrow, T. A.,Wallock, L. M.,Shigenaga., M. K.,Melnyk, S., and James, S. J. ( 2002) Folate deficiency disturbs hepatic methionine metabolism and promotes liver injury in the ethanol-fed micropig. Proc. Natl. Acad. Sci. USA 99, 1007210077.
  • 12
    de Marco, P.,Calevo, M. G.,Moroni, A.,Merello, E.,Raso, A.,Finnell, R. H.,Zhu, H.,Andreussi L.,Cama A., and Capra V. ( 2003) Reduced folate carrier polymorphism (80A[RIGHTWARDS ARROW]G) and neural tube defects. Eur. J Hum. Genet. 11, 245252.
  • 13
    Hamid, A.,Wani, N. A.,Rana, S.,Vaiphei, K.,Mahmood, A., and Kaur, J. ( 2007). Down-regulation of reduced folate carrier may result in folate malabsorption across intestinal brush border membrane during experimental alcoholism. FEBS J. 274, 63176328.
  • 14
    Burtis, C. A. and Ashwood, E. R. ( 1994) Tietz Textbook of Clinical Chemistry, 2nd edn. p. 1170, WB Saunders, Philadelphia.
  • 15
    Scalera, V.,Storelli, C.,Storelli-Joss, C.,Haase, W., and Murer, H. ( 1980) A simple and fast method for the isolation of basolateral membrane from rat small-intestinal epithelial cells. Biochem. J. 186, 177181.
  • 16
    Bergmeyer, H. U. ( 1974) Alkaline phosphatase from calf intestine. In Methods of Enzymatic Analysis, 2nd edn.(Bergmeyer, H. U. ed.) pp. 496498, Academic Press, New York.
  • 17
    Quigley, J. P. and Gotterer, G. S. ( 1969) Distribution of Na+-K+ stimulated ATPase in rat intestinal mucosa. Biochim. Biophys. Acta. 173, 456468.
  • 18
    Lowry, O. H.,Rosenbergh, N. J.,Farr, A. L., and Randall, R. J. ( 1951) Protein measurement with the folin phenol reagent. J. Biol. Chem. 193, 265275.
  • 19
    Hamid, A. and Kaur, J. ( 2006) Chronic alcoholism alters the transport characteristics of folate in rat renal brush border membrane. Alcohol. 38, 5966.
  • 20
    Chomeczynski, P. and Sacchi, N. ( 1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156159.
  • 21
    Laemmli, U. K. ( 1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227, 680685.
  • 22
    Towbin, H.,Staehelin, T., and Gordon, J. ( 1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76, 43504354.
  • 23
    Mason, J. B. and Rosenberg, I. H. ( 1994) Intestinal absorption of folate In Physiology of the Gastrointestinal Tract, 3rd edn. (Johnson, L. R.). pp. 979995, Raven Press, New York.
  • 24
    Hamid, A.,Kaur, J., and Mahmood, A. ( 2007). Evaluation of the kinetic properties of the folate transport system in intestinal absorptive epithelium during experimental ethanol ingestion. Mol. Cell. Biochem. 304, 265271.
  • 25
    Dudeja, P. K.,Kode, A.,Alnounou, M.,Tyagi, S.,Torania, S.,Subramanian, V. S., and Said, H. M. ( 2001) Mechanism of folate transport across the human colonic basolateral membrane. Am. J Physiol. Gastrointest. Liver. Physiol. 281, G54G60.
  • 26
    Montalar, M.,Nalda-Molina, R.,Rodriguez-Ibanez, M.,Garcia-Valcarcel, I.,Garrigues, T. M.,Merino, V., and Bermejo, M. ( 2003) Kinetic modeling of triamterene intestinal absorption and its inhibition by folic acid and methotrexate. J. Drug. Target. 11, 215223.
  • 27
    Villanueva, J. A.,Devlin, A. M., and Halsted, C. H. ( 2001) Reduced folate carrier: tissue distribution and effects of chronic ethanol intake in the micropig. Alcohol. Clin. Exp. Res. 25, 415420.