Alpha-tocopherol transport in the lung is affected by the apoE genotype—Studies in transgenic apoE3 and apoE4 mice

Authors

  • Patricia Huebbe,

    1. Institute for Human Nutrition and Food Science, Christians-Albrechts-University of Kiel, Kiel, Germany
    Search for more papers by this author
  • Laia Jofre-Monseny,

    1. Institute for Human Nutrition and Food Science, Christians-Albrechts-University of Kiel, Kiel, Germany
    Search for more papers by this author
  • Gerald Rimbach

    Corresponding author
    1. Institute for Human Nutrition and Food Science, Christians-Albrechts-University of Kiel, Kiel, Germany
    • Institute for Human Nutrition and Food Science, Christians-Albrechts-University of Kiel, Olshausenstrasse 22, H. Rodewald Str. 6, D-24118 Kiel, Germany
    Search for more papers by this author
    • Tel: +49-431-880-2583. Fax: +49-431-880-2628.


Abstract

Apolipoprotein E (apoE) is a major constituent of lipoproteins mediating peripheral uptake of lipids including the lipid-soluble vitamin alpha-tocopherol (α-toc). In a recent study, we observed significant lower α-toc concentrations in the lung of apoE4 compared with apoE3 transgenic mice. In this study, we determined the mRNA levels of genes encoding for proteins centrally involved in the uptake, export, and degradation of vitamin E. Receptors of α-toc uptake including scavenger receptor B1 (SR-B1), LDL receptor (LDLrec), and LDLrec-related protein 1 (LRP1) were lower in apoE4 when compared with apoE3 mice with statistical significance for SR-B1 and LRP1. Lung mRNA levels of the ATP-binding cassette A1 and the multidrug resistance transporter 1, surfactant proteins mediating the export of α-toc, were lower in apoE4 than in apoE3 mice. In addition, the mRNA levels of cytochrome P450 3A, a microsomal enzyme family involved in the degradation of α-toc, tended to be higher in the apoE4 when compared with the apoE3 genotype. Current data indicate that genes encoding for proteins involved in peripheral α-toc transport and degradation are affected by the apoE genotype probably accounting for thelower α-toc tissue concentration as observed in apoE4 mice. © 2009 IUBMB IUBMB Life, 61(4):453–456, 2009

INTRODUCTION

Apolipoprotein E (apoE) is a major component of lipoproteins in the circulation and the brain, with identified roles in protein metabolism and cholesterol transport. Among the three isoforms in humans (apoE2, E3, and E4), apoE3 is considered the wild type and is most common (78%), whereas the apoE4 allele frequency is reported to be 14% in Western populations1. The amino acid substitution of cysteine to arginine at position 112 is supposed to impact on the C- and N-domain interaction and protein stability of the mature apoE4 protein. Because of these conformational changes, apoE4 favors to bind large lower-density lipoproteins, VLDL, LDL, and chylomicron remnants, whereas apoE3 and E2 prefer smaller cholesterol-rich HDL particles2. The lower apoE4 protein stability accounts for a higher VLDL and LDL remnant catabolism, which is believed to suppress LDL receptor (LDLrec) expression in the liver and thereby increasing LDL level in plasma3. As a result, total and LDL cholesterol level are modestly elevated, whereas HDL levels are slightly decreased in apoE4 compared with apoE3 allele carriers. Elevated cholesterol levels may contribute to the higher cardiovascular disease risk associated with the apoE4 genotype4.

Alpha-tocopherol (α-toc) functions as a cell signaling molecule, which regulates key molecular events unrelated to its antioxidant properties5. As a constituent of plasma lipoproteins, the tissue uptake of α-toc is mediated by peripheral lipoprotein receptors, particularly scavenger receptor B1 (SR-B1) in the lung6. Polymorphisms in genes involved in tocopherol tissue uptake, export, and metabolism have been suggested to be important determinants for the potential protective effects of a vitamin E supplementation7.

Albeit the well known differences in lipoprotein metabolism between apoE3 and apoE4, the impact of the apoE genotype on peripheral α-toc metabolism has yet not been investigated. Recently our group has reported significantly lower α-toc levels in the lung of apoE4 when compared with apoE3 transgenic mice8. The aim of this study is to expand current knowledge on the impact of the apoE genotype on the expression of genes encoding for proteins involved in α-toc transport in the lung.

EXPERIMENTAL PROCEDURES

Mice

Female apoE3 and apoE4 transgenic mice (Taconic, Denmark, six animals per group) aged 6–8 weeks were housed in macrolon cages according to the German regulations of animal welfare. The animals were fed semisynthetic diets (Ssniff; Soest, Germany) based on casein (20%) and corn starch (15%) with 10% fat from tocopherol-stripped corn oil supplemented with 200 mg of all-rac-α-tocopheryl acetate per kg diet. After 12 weeks, the mice were killed, the lung was removed, and 15–25 mg of entire lung tissue was directly suspended in RNAlater™ RNA stabilization reagent (Qiagen, Hilden, Germany), incubated over night at room temperature and stored at −20 °C until RNA isolation. Vitamin E HPLC analysis was performed as described previously8.

Real-Time qRT-PCR

Total RNA was extracted according to the RNeasy® Lipid Tissue Protocol (Qiagen, Hilden, Germany). Primer sequences for real-time RT-PCR experiments were designed with primer3 software (see Table 1). Primer pairs were obtained from MWG (Ebersberg, Germany). One-step quantitative reverse transcriptase PCR was carried out with the QuantiTec®SYBR®Green RT-PCR kit (Qiagen, Hilden, Germany). Relative mRNA level of genes was quantified as the ratio between the expression level of the target gene and the housekeeping gene (β-actin).

Table 1. PCR primer sequences and annealing temperatures
 Primer sequenceAnnealing temperature (°C)
SR-B1F: GCAAATTTGGCCTGTTTGTT55
R: GATCTTGCTGAGTCCGTTCC
LDLrecF: AAGCTGTGACCGATGAGGAG55
R: CATTGTTCAGGCCCTGCTTA
LRP1F: AAGCTGTGACCGATGAGGAG55
R: CATTGTTCAGGCCCTGCTTA
LPLF: ATCAACTGGATGGAGGAGGA58
R: CAGCTGGATCCAAACCAGTA
αTTPF: GCCAAGAAGATTGCTGCTGT58
R: GCAGATGAATCCGGTCCTTA
ABCA1F: CTGCCACCTCCTCAGAGAAA55
R: GCCATACCGAAACTCGTTCA
MDR1F: GCCAGTATTCTGCCAAGCAT55
R: CTATGAGCACACCAGCACCA
CYP3AF: CAAGGAGATGTTCCCTGTCA55
R: CTGGTGATCACATCCATGCT
β-actinF: GACAGGATGCAGAAGGAGATTACT55
R: TGATCCACATCTGCTGGAAGGT

Statistics

Statistical calculations were conducted with SPSS Version 13.0 (SPSS; Munich, Germany). Data were compared with a t-test for independent samples. In case of absence of normal distribution, data were compared with the Mann–Whitney-U test for independent samples. Results are expressed as means with SEM and significance was accepted at P < 0.05.

RESULTS AND DISCUSSION

This study aimed at investigating the impact of the apoE genotype on mRNA levels of genes encoding for proteins involved in tocopherol import, export, and degradation in the lung, which may in turn affect lung vitamin E levels. This is of particular interest because the apoE4 genotype is associated with increased oxidative stress9 and chronic inflammation10, features that are related to chronic degenerative disorders. Decreased lung but increased plasma α-toc level, as observed in our study in apoE4 mice (Fig. 1), may be indicative for an impaired delivery of vitamin E to the peripheral tissue, which may cause a functional vitamin E deficiency.

Figure 1.

Alpha-tocopherol (α-toc) concentration in the plasma and lung of apoE3 (□) and apoE4 (▪) transgenic mice. Values are given as μmol α-toc/mmol cholesterol or nmol α-toc/g tissue. Data are expressed as means + SEM. *P < 0.05 comparing apoE3 versus apoE4 (Reproduced with permission from Jofre-Monseny et al., Br J Nutr, 2008, 100, 44–53).

Given the lower lung α-toc levels in apoE4 versus apoE3 mice, we determined the mRNA levels of lipoprotein receptors and transporters that have been proposed to mediate α-toc import into the lung (Fig. 2A). As the lung contains an abundance of different cell types, it is likely that a variety of mechanisms modulate pulmonary α-toc level. One of the major proteins regulating α-toc in alveolar type II cells and macrophages is SR-B1, which mediates vitamin E uptake of mainly HDL particles6. Our data indicate lower SR-B1 mRNA levels in apoE4 versus apoE3 mice (P = 0.019). In addition, lung mRNA levels of LDLrec and LDLrec-related protein 1 (LRP1) were lower in apoE4 compared with apoE3 mice suggesting an impaired uptake of α-toc because of decreased lipoprotein receptor expression (Fig. 2A).

Figure 2.

Lung mRNA concentrations of different genes encoding for proteins involved in the import (A), export (B), and degradation (C) of α-toc. Relative mRNA level were assessed with real-time qRT-PCR and related to the β-actin mRNA concentration. Data are expressed as means + SEM. *P < 0.05 comparing apoE3 versus apoE4.

Figure 3.

Proteins involved in the import, export, and degradation of α-toc in the lung. α-toc is distributed in the body via different lipoproteins and chylomicrons (CM). Cellular uptake of α-toc is mediated by apoE and lipoprotein lipase (LPL) activity and theirs binding to several lipoprotein receptors including LDL receptor (LDL R) and LDL receptor-related protein (LRP). Intracellular α-toc is subjected to microsomal degradation by the cytochrome P450 family 3A (CYP3A) enzyme subfamily. Delivery of α-toc to the alveolar space is facilitated by the activity of the α-toc transport protein (α-TTP) and ATP-binding cassette A1 (ABCA1). Excessive amounts of α-toc may be also excluded via the multidrug resistance transporter 1 (MDR1).

Several lines of evidence demonstrate an implication of the lipoprotein lipase (LPL) in the delivery of α-toc from triglyceride-rich lipoproteins to peripheral tissues by anchoring lipoproteins and LDL to the cell surface and increasing their degradation11, 12 (Fig. 3). However, in our study, pulmonary LPL expression was not different between apoE3 and apoE4 mice. Hereupon, we tested whether genes encoding for proteins involved in the export of α-toc are altered by the apoE genotype (Fig. 2B). Recently, αTTP was shown to be expressed in the lung13, where it is suggested to play a role in loading intracellular surfactants such as ATP-binding cassette A1 (ABCA1) with α-toc. In our study, αTTP mRNA levels were not affected by the apoE genotype. However, ABCA1 mRNA appeared to be expressed in tendency in lower amounts in apoE4 versus apoE3 mice (P = 0.116). These findings may indicate a lower secretion of α-toc to the alveolar space, which may result in an impaired vitamin E supply of the bronchus in the apoE4 genotype.

Multidrug resistance transporter 1 (MDR1) is a member of the ABC transporter family and has been shown to be localized at the apical membrane of cells lining the bronchus and alveolar epithelium14, 15. MDR1 expression was observed to be upregulated with increasing α-toc supply to regulate cellular levels of α-toc and its metabolites16. In our study, MDR1 mRNA levels were lower in apoE4 (P = 0.028) than in apoE3 mice (Fig. 2C). This may be a consequence of the lower cellular α-toc concentration in apoE4 mice, but may also display a decreased delivery of α-toc to the alveolar space.

Furthermore, cytochrome P450 3A (CYP3A) mRNA expression was higher in apoE4 compared with apoE3 mice, although because of high interindividual differences statistical significance has not been reached. As α-toc is degraded through microsomal ω-hydroxylation by CYP3A members17, it is likely that the degradation of α-toc is more pronounced in the apoE4 genotype. This may also contribute to the decreased cellular vitamin E concentration in the lung as observed in our apoE4 animals. Moreover, in consideration of the lower expression of ABCA1 and MDR1, which also facilitate the exclusion of α-toc metabolites to protect the cell from oxidative damage, one could presume that the apoE4 genotype may face a higher intracellular level of toxic vitamin E metabolites.

It needs to be taken into account that in this study, molecular targets involved in vitamin E transport and degradation have only been determined on the mRNA level using real-time PCR. Overall, moderate but significant effects of the apoE4 genotype on vitamin E transport have been observed by this experimental approach. Real-time PCR is known to be a relatively sensitive method that may detect also minor effects in response to the apoE genotype, which could possibly not have been detected, to the same extend, on the protein level by using Western blotting.

In this study, relatively high levels of α-toc acetate were added to the semisynthetic diets when compared with the AIN-93 mouse diet. We have chosen this approach to achieve a vitamin E supply, which may be comparable to a situation in humans when vitamin E supplements are used.

Taken together, our data indicate that the apoE4 may retain less α-toc in the lung than the apoE3 genotype, which may in turn impact on the dietary vitamin E requirement. In this context, a so-called personalized nutritional advice may be taken into account where individuals could be given dietary recommendations in terms of vitamin E specifically tailored to their apoE genotype18.

Furthermore, as no significant differences of plasma α-toc have been detected between apoE3 and apoE4 transgenic mice, it may be concluded that the plasma vitamin E measurements are rather limited to indicate vitamin E delivery to the peripheral tissues.

Ancillary