Mutations of SQSTM1 are associated with severity and clinical outcome in paget disease of bone

Authors


Abstract

Paget disease of bone (PDB) is a common disorder characterized by increased bone turnover at one of more sites throughout the skeleton. Genetic factors play an important role in the pathogenesis of PDB, and the most important predisposing gene is SQSTM1, which is mutated in about 10% of patients. Here we investigated the relationship between SQSTM1 mutation status, disease severity, and clinical outcome in 737 patients who took part in a randomized study of two different management strategies for the disease. Mutations of SQSTM1 were detected in 80 of 737 (10.9%) patients. Mutation carriers had an earlier age at diagnosis (59.4 ±11.5 versus 65.0 ± 10.4 years, p < .0001) and a greater number of affected bones (3.2 ± 1.2 versus 2.1 ± 1.2, p < .001) and more commonly required orthopedic surgery (26.2% versus 16.1%, p = .024) and bisphosphonate therapy (86.3% versus 75.2%, p = .01) than those without mutations. Quality of life, as assessed by the short-form-36 (SF36) physical summary score, was significantly reduced in carriers (34.0 ± 11.3 versus 37.1 ± 11.4, p = .036). During the study, fractures were more common in carriers (12.5% versus 5.3%, p = .011), although most of these occurred in unaffected bone. This study demonstrates that SQSTM1 mutations are strongly associated with disease severity and complications of PDB. Genetic testing for SQSTM1 mutations may be of value in identifying individuals at risk of developing severe disease, but further studies will be required to determine if a program of genetic testing and early intervention in these individuals would be cost-effective or be of benefit in preventing these complications. © 2010 American Society for Bone and Mineral Research.

Introduction

Paget disease of bone (PDB) is a common condition characterized by increased and disorganized bone remodeling affecting one or more sites throughout the skeleton. The abnormal remodeling processes disrupts normal bone architecture and can lead to the development of several complications, including bone pain, deformity, secondary osteoarthritis, nerve compression syndromes, and pathologic fractures.1 Some patients with PDB have severe disease that has a major impact on quality of life,2, 3 but others are completely asymptomatic.1 The determinants of clinical severity of PDB are poorly understood.

Both genetic and environmental factors are thought to be involved in the pathogenesis of PDB. The environmental factor that has been studied most widely is paramyxovirus infection,4 although the role of paramyxovirus infection in the pathogenesis of PDB remains controversial.5 Other potential risk factors for PDB include low calcium intake during childhood,6 vitamin D deficiency during childhood,7 repetitive mechanical loading of affected bones,8 and environmental exposures to toxins.9 There have been many advances in understanding the role of genetic factors in the pathogenesis of PDB over recent years, and several genetic variants have been identified that predispose to the disease.10 The most important of these is SQSTM1, which was identified initially in patients with familial PDB by positional cloning.11 Subsequent studies showed that SQSTM1 mutations occur in up to 40% of patients with a familial PDB and up to 10% of patients with “sporadic” PDB.12 Mutations of SQSTM1 are thought to play a causal role in the pathogenesis of PDB.10 They have been found to segregate with the disease in families and have an overall frequency of between 5% and 10% in PDB patients compared with less than 0.07% in unaffected controls.11, 13–19 It should be noted, however, that at least one subject has been described who had not developed PDB by the seventh decade despite being a carrier of the P392L mutation of SQSTM1, indicating that penetrance is incomplete.20 Previous studies have shown that patients with mutations of SQSTM1 tend to have an earlier age at onset than those without mutations,13, 17 but the relationship between SQSTM1 mutations and the clinical outcome of PDB is unclear. The aim of this study was to investigate the environmental and genetic determinants of clinical outcome in PDB, focusing particularly on the role that SQSTM1 mutations might play in regulating disease severity.

Patients and Methods

Patients

This study was based on participants of the Paget's Disease, Randomized Trial of Intensive versus Symptomatic Management (PRISM) study (ISRCTN12989577), which was a randomized comparative trial of two treatment strategies for PDB.21 In brief, the PRISM trial involved 1324 patients with PDB attending secondary-care referral centers in the United Kingdom. They were randomized to receive either “symptomatic” therapy, in which treatment was administered only in patients who had bone pain, or “intensive” bisphosphonate therapy, in which the aim of treatment was to suppress and maintain serum alkaline phosphatase levels within the normal range by use of bisphosphonate therapy. The bisphosphonate of choice in the intensive group was risedronate because the trial was initiated in 2001, prior to the licensing of zoledronic acid for the treatment of PDB. This report is based on a subgroup of 737 study participants who consented to provide a blood sample for genetic analysis.

Laboratory investigations

All participants had a radionuclide bone scan prior to entering the study, and the extent of skeletal involvement was assessed by counting the number of affected sites. Routine biochemistry and hematology, including measurement of total serum alkaline phosphatase (ALP) level, was performed at baseline and during the study according to standard techniques.

Clinical assessments

Health-related quality of life was assessed by the Short-form-36 (SF36) questionnaire.22 Deformity was assessed by the attending physicians, who were asked to assess whether the patient had clinical evidence of bone deformity using a three-point scale as follow: 0 = no deformity; 1 = mild or moderate deformity; and 2 = severe deformity. The presence of bone pain was recorded, and physicians were asked to assess whether they thought the pain was caused by PDB. Information was collected on previous fractures and whether they had occurred in affected bone, on orthopedic surgical procedures, on the use of a hearing aid for deafness, on age at first diagnosis of PDB, and on family history of PDB. Information was recorded on whether or not the patient had previously received bisphosphonate treatment and the number of treatment courses given. We devised a disease severity score taking several clinical features into account and giving a point for the number of bones affected (range 1 to 26), the presence of bone pain thought to be due to PDB (0 = no or 1 = yes), previous fractures (0 = no or 1 = yes), previous orthopedic surgical procedures (0 = no or 1 = yes), bone deformity (0 = no deformity to 14 = severe deformity in seven bones), and use of a hearing aid if the patient had PDB of the skull (0 = no or 1 = yes). Using this system, the score theoretically could range from 1 (monostotic PDB with no complications) to 43 (PDB affecting all skeletal sites with multiple complications and multiple bone deformities).

We also collected information on occupation and categorized occupations according to the UK Office for National Statistics Standard Occupation Classification 2000. Occupations were classified into three groups: those which were sedentary (eg, office workers), those which involved moderate physical activity (eg, factory workers, delivery workers, nurses, care assistants), and those which involving heavy physical activity (eg, farmers, miners, manual laborers). Milk consumption (as a surrogate for dietary calcium intake) was assessed by asking whether the patient took the equivalent of at least a glass of milk once a day, once a week, or less than once a week, as described previously.23 Previous episodes of musculoskeletal injury that were serious enough for the patient to seek medical advice were recorded, and patients were categorized into those who had suffered such an injury (score = 1) and those who had not (score = 0).

Genotyping for SQSTM1 mutations

Genomic DNA was extracted from peripheral blood using standard procedures. Mutation screening of SQSTM1 was conducted on PCR-amplified fragments of DNA, focusing on exons 7 and 8 and the intron-exon boundaries because all previously reported mutations occur in these regions.20 The PCR methodology was essentially as described previously.13 For exon 7, we used the following primers: forward, TTAAAGTCACGCTGGGAACCTGCT, and reverse, AGGGCAGGATGCTCTAAAGGG, and for exon 8, we used the following primers: forward, TCTGGGCAGGCTCGGACACT, and reverse, GTGCTGGGCTGCTAACGTA. The PCR products were sequenced using the same primers in both forward and reverse directions. The traces were analyzed by Chromas-pro software Technehysium Pty (Australia) and compared with the reference sequence (NC_000005.8, GI:51511721, NCBI Entrez Gene, www.ncbi.nlm.nih.gov/).

Ethics

The study was approved by the multicentre ethics committee and the local ethical committees of the participating centers. All patients gave written informed consent to being included in the study.

Statistical analysis

Student's t test was used to evaluate differences between patients with and without SQSTM1 mutations for continuous variables, and the chi-square test was used for categorical variables. Univariate and multivariate regression analyses were used to evaluate predictors of disease severity.

Results

Patients who consented to provide DNA samples for analysis (n = 737) were about 1 year younger than those who declined or were not asked to provide samples (n = 578; mean ± SD = 73.2 ± 7.8 versus 74.8 ± 7.9, p < .001). They had an earlier age at diagnosis by about 3 years (64.4 ± 10.6 versus 67.5 ±10.8, p < .001), but their gender distribution was similar (46% female versus 48% male, p = .43), and the number of affected sites was similar (2.22 ± 1.3 versus 2.22 ± 1.4, p = .92).

Mutations of SQSTM1 were identified in 80 of 737 patients (10.9%) studied, as summarized in Table 1. The most common mutation was P392L, but several other mutations were found, including two novel mutations: T1311G, causing an amino acid change from isoleucine to serine at codon 424 (I424S), and C1238T, causing a premature stop codon at position 400 in place of a glutamine residue (Q400X). All mutations were present in heterozygous form, with the exception of one patient who was a compound heterozygote for G425R and I424S.

Table 1. Prevalence and Types of SQSTM1 Mutations in the PRISM study
NucleotideProteinMutation TypeNumber (%)
C1215TP392LMissense60 (75.0%)
1225insT396XTruncating2 (2.5%)
C1238TQ400XTruncating1 (1.3%)
T1251CM404TMissense1 (1.3%)
A1250GM404VMissense4 (5.0%)
G1271AG411SMissense1 (1.3%)
T1311GI424SMissense5 (6.3%)
G1313AG425RMissense5 (6.3%)
G1313A/T1311GG425R/I424SMissense1 (1.3%)
Total  80 (100%)

The clinical characteristics of patients with SQSTM1 mutations differed significantly from those without mutations, as summarized in Table 2. There was no difference between the genotype groups in terms of age, gender, or total ALP at baseline, although it should be noted that a high proportion of patients had been treated previously with bisphosphonates. Patients with SQSTM1 mutations had an earlier age at first diagnosis than those without mutations (59.4 ± 11.5 years versus 65.0 ± 10.4 years, p < .0001), had more frequently required courses of bisphosphonate therapy for PDB (86.3% versus 75.2%, p = .01), had a greater number of affected bones (p < .0001), and had required orthopedic surgery more frequently (26.2% versus 16.1%, p = .024). Several other complications of the disease tended to be more common in carriers of SQSTM1 mutations, including bone deformity, previous fractures through affected bone, and patients with skull disease who used a hearing aid for deafness, but the difference between the groups was not significant for these variables. Overall disease severity, as assessed by the composite score described in the “Patients and Methods” section was significantly greater in SQSTM1 mutation carriers (7.9 ± 3.3 versus 6.0 ± 2.6, p < .0001). In keeping with this, the SF-36 physical summary score was lower in SQSTM1 mutation carriers (34.0 ± 11.3 versus 37.1 ± 11.4, p = .036), although there was no difference in SF-36 bodily pain score or SF-36 mental summary score between SQSTM1 mutation carriers and noncarriers.

Table 2. Relation Between SQSTM1 Mutation Status and Clinical Features of PDB at Baseline
VariableSQTSM1 + ve (n = 80)SQSMT1–ve (n = 657)p Value
  1. Values are mean ± SD or number (%). The p values refer to the differences between the genotype groups assessed by Student's t test or chi-square test. The ALP values have been standardized to the upper limit of the reference range, which was set at 1.0.

Male38 (47.5%)356 (54.2%).13
Age at recruitment71.1 ± 8.173.4 ± 7.8.19
Alkaline phosphatase1.25 ± 1.021.45 ± 1.51.12
Previous courses of bisphosphonate   
 011 (13.7%)163 (24.8%) 
 128 (35.0%)269 (40.1%).01
 224 (30.0%)150 (22.8%) 
 3 or more17 (21.2%)75 (11.4%) 
Age at diagnosis59.4 ± 11.565.0 ± 10.4<.0001
Family history of PDB34 (42.5%)74 (11.3%)<.001
Number of bones affected3.2 ± 2.02.1 ± 1.3<.0001
Patients with bone deformity34 (42.5%)234 (35.7%).23
Any fracture31 (38.7%)265 (40.3%).78
Fracture in unaffected bone20 (25.0%)200 (30.4%).31
Fracture in Pagetic bone11 (13.7%)65 (9.8%).28
Orthopedic surgery21 (26.2%)106 (16.1%).024
Skull disease and hearing aid8 (10.0%)46 (7.0%).33
SF-36 bodily pain38.6 ± 11.040.4 ± 11.4.18
SF-36 physical summary score34.0 ± 11.337.1 ± 11.4.036
SF-36 mental summary score49.2 ± 11.749.4 ± 11.5.90
Composite disease severity score7.9 ±3.36.0 ± 2.6<.0001

The relationship between SQSTM1 mutation status and response to treatment is shown in Table 3. The proportion of patients allocated to intensive and symptomatic treatment was similar in the two genotype groups, and there was no difference between the groups in the doses of bisphosphonates administered, the number of patients who required orthopedic surgery, or the level of total ALP at 24 months. Fractures were significantly more common in patients with SQSTM1 mutations (12.5% versus 5.3%, p = .011), but these occurred predominantly in non-Pagetic bone. The SF-36 physical summary score at 24 months was lower in SQSTM1 mutation carriers than in noncarriers (32.7 ± 9.4 versus 36.8 ± 11.3, p = .007). Bodily pain, as assessed by SF-36, also was significantly worse in SQSTM1 mutation carriers at 24 months (38.0 ± 9.8 versus 41.0 ± 11.0, p = .04), but there was no significant difference in the SF-36 mental summary score between the groups.

Table 3. Relation Between SQSTM1 Mutation Status and Response to Treatment
VariableSQTSM1 + ve (n = 80)SQSMT1–ve (n = 637)p Value
  • Values are mean ± SD or number (%). The p values refer to the differences between the genotype groups assessed by Student's t test, chi-square test, or (in the case of bisphosphonate dose) Kruskall-Wallis test. The ALP values have been standardized to the upper limit of the reference range, which was set at 1.0.

  • a

    Total dose of bisphosphonate given during the study, in milligrams.

Intensive treatment38 (47.5%)338 (51.5%).50
Any fracture10 (12.5%)35 (5.3%).011
Fracture in unaffected bone10 (12.5%)26 (4.0%).001
Fracture in affected bone0 (0%)10 (1.8%).25
Orthopedic surgery8 (10.0%)39 (5.9%).16
Bisphosphonate therapy49 (61.2%)402 (61.0%).97
Bisphosphonate dosea (mg)
 Alendronate259 ± 1462106 ± 802.15
 Etidronate2610 ± 214881046 ± 8207.20
 Pamidronate46.9 ± 11853.5 ± 176.74
 Risedronate2013 ± 32532113 ± 3436.79
 Tiludronate6640 ± 271296283 ± 23065.86
Alkaline phosphatase, 24 months1.01 ± 0.700.93 ± 0.71.34
SF-36 bodily pain, 24 months38.0 ± 9.841.0 ± 11.0.04
SF-36 physical summary, 24 months32.7 ± 9.436.8 ± 11.3.007
SF-36 mental summary, 24 months47.2 ± 12.548.1± 11.2.55

In order to identify the predictors of a poor clinical outcome in PDB, we used univariate and multivariate regression analyses to identify factors that were associated with the composite disease severity score at baseline. Univariate analysis showed that age (p = .01), age at diagnosis (p < .001), family history (p < .001), and the presence of a SQSTM1 mutations (p < .001) all were significant predictors of disease severity score. None of the environmental variables studied, including dietary calcium intake, occupation, or previous musculoskeletal injury, predicted disease severity score (p > .4 for all). Multivariate analysis (Table 4) identified four independent predictors of disease severity score that together accounted for 29.1% of the variance in disease severity score. These were SQSTM1 mutation, age at diagnosis, age at the baseline visit, and a positive family history of PDB.

Table 4. Independent Predictors of Baseline Disease Severity Score in the PRISM Study
PredictorCoefficientSDTp Value
  1. Regression equation severity = 9.746 + 0.863 (mutation) + 0.863 (family history) – 0.160 (age at diagnosis) + 0.113 (age at baseline). S = 2.28R2 = 30.3%R2 (adj) = 29.1%.

Constant9.7460.88810.97<.0001
SQSTM1 mutation0.8630.2853.03.003
Family history0.8620.2493.47.001
Age at diagnosis−0.1600.010−15.6<.0001
Age at baseline0.1120.0138.29<.000

Discussion

This study has shown that SQSTM1 mutations are an important marker of disease severity and complications in PDB patients attending secondary referral centers in the United Kingdom. In keeping with previous smaller studies,13, 17 we found that patients who carried SQSTM1 mutations had a younger age at diagnosis and more extensive disease than those without mutations. We have now shown for the first time that SQSTM1 mutation carriers are at greater risk of developing disease complications and have greater impairment of quality of life than noncarriers. It is interesting to note, however, that the reduction in quality of life was restricted to the physical summary score of SF-36, which was between 12 and 16 points below the population normal values of 50, whereas the SF-36 mental summary scores were completely normal in both genotype groups. This suggests that while PDB adversely affects physical functioning, patients seem to be able to overcome adversity and cope with their disability.

Analysis of the relationship with treatment response showed no significant difference between SQSTM1 mutation carriers and noncarriers with regard to the biochemical response to bisphosphonate therapy. The amounts of bisphosphonate administered during the study were equivalent in both genotype groups; ALP levels were suppressed to an equal extent, and the requirement for orthopedic surgery was similar. Quality of life remained lower in SQSTM1 mutation carriers than in noncarriers after 24 months of treatment, however, suggesting that once the complications of PDB and physical impairment have developed, they are not influenced substantially by therapeutic intervention. This is in keeping with the results reported for the PRISM study as a whole, where we found that neither symptomatic nor intensive management had a significant impact on quality of life or disease complications.21 We were interested to note that fractures were significantly more frequent in patients with SQSTM1 mutations during the study, although these occurred predominantly through unaffected bone. Previous studies have shown that fracture risk is increased in PDB,1, 24 and in the PRISM study we found that about 80% of these fractures are in unaffected bone. While the increased risk of fractures in Pagetic bone is explained easily on the basis of reduced bone quality, the reason for the increased risk in unaffected bone is less clear. Previous studies have shown that PDB is associated with an increased risk of osteoarthritis.1, 25 This condition is known to be associated with an increase risk of fracture.26 Another potential reason for an increased fracture risk of unaffected bone in PDB would be deformity with resulting postural instability. This would be in keeping with the trend for patients with SQSTM1 mutations to have worse bone deformities than those without mutations.

Epidemiologic studies have suggested that low dietary calcium intake during childhood is associated with an increased risk of developing PDB.6 In this study we observed no association between disease severity and consumption of dairy products during childhood or at other points in life. Repetitive mechanical loading also has been suggested to play a role in targeting of Paget disease to specific bones in the skeleton, although this is based mainly on anecdote.8 Based on this observation, we looked at the relationship between occupation and disease severity, but no significant association was observed, nor did we observe an association between previous musculoskeletal injury and severity of PDB.

A limitation of our study is that the conclusions hold true only for participants in whom DNA samples were obtained. We feel that the results are likely to be fairly representative of PDB patients being treated in a secondary-care setting, however, because the characteristics of subjects who provided DNA samples were broadly similar to those of subjects who did not.

Previous studies have shown that intervention with potent bisphosphonates such as zoledronic acid and risedronate is very effective at suppressing bone turnover in PDB.27, 28 The effects of these agents on quality of life and disease complications are modest, however, probably because many patients have already developed irreversible skeletal damage by the time treatment is initiated. Our data raise the possibility that genetic testing for SQSTM1 mutations in patients with a family history of the disease might be warranted so that carriers of these mutations can be kept under close surveillance for early signs of the disease developing. It is important to emphasise that if a program of genetic testing were to be implemented, then properly designed studies would need to be conducted to examine whether prophylactic bisphosphonate therapy would be of clinical benefit in asymptomatic SQSTM1 gene carriers. In this regard, it is relevant to point out that the current generation of SQSTM1 gene carriers seems to have a delayed onset of PDB compared with their parents.29 Accordingly, the timing of any intervention would need to be chosen carefully to take the likely age at onset into account. Other issues, such anxiety associated with having a genetic test and cost-effectiveness, also would need to be addressed to determine if the potential clinical benefit of genetic testing and intervention outweight the costs of mutation screening and drug treatment. A trial is now in progress, called the Zoledronate in the Prevention of Paget's disease (ZiPP) study (ISRCTN11616770), in which we are addressing these issues. The ZiPP study aims to explore the risks and benefits of prophylactic zoledronic acid therapy versus placebo in asymptomatic patients with SQSTM1 mutations who have not yet been diagnosed with PDB. The primary aim of the ZiPP study is to determine whether bisphosphonate therapy can prevent the development of elevated bone turnover and bone lesions in mutation carriers, but information is also being gathered on clinically relevant outcomes, such as pain, quality of life, and anxiety and depression. At present, we do not feel that SQSTM1 mutation screening is indicated in routine clinical practice, but it will be important to reevaluate this in light of the results of the ZiPP study, which should be available in 5 to 7 years' time.

Disclosures

All the authors state that they have no conflicts of interest.

Acknowledgements

This research was funded in part by grants from the Arthritis Research Campaign (17646 and 13724) and the Paget's Association (UK). Trial registration: ISRCTN12989577.

Ancillary